- Email: [email protected]
Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran
Microbial Pathogenesis 107 (2017) 425e429
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran Lida Lotfollahi a, Ardalan Chaharbalesh b, c, Mohammad Ahangarzadeh Rezaee b, d, *, Alka Hasani d a
Department of Microbiology, Faculty of Medicine, Urmia University of Medical Sciences, Urmia, Iran Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran d Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 September 2016 Received in revised form 19 April 2017 Accepted 19 April 2017 Available online 23 April 2017
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using Etest. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/ 2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Listeria monocytogenes PCR-serotyping Antimicrobial resistance Foods Livestock Iran
1. Introduction The genus Listeria includes a variety of species among which Listeria monocytogenes and L. ivanovii and occasionally, L. seeligeri are known as pathogens in both animals and humans (L. monocytogenes) or animals (L. ivanovii) [1]. L. monocytogenes is an important food-borne pathogen causing febrile gastroenteritis in healthy people and invasive diseases in high risk populations such as pregnant women, individuals in extremities of age and immunosuppressed persons. Septicemia, meningitis, spontaneous
* Corresponding author. Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, 51666-14766, Iran. E-mail address: [email protected] (M. Ahangarzadeh Rezaee). http://dx.doi.org/10.1016/j.micpath.2017.04.029 0882-4010/© 2017 Elsevier Ltd. All rights reserved.
abortion and stillbirth are examples of invasive diseases due to the bacterium and these conditions result in high case-fatality rate. In recent years, the growing consumption of Ready-to-Eat (RTE) foods is recognized as the root of L. monocytogenes outbreaks, because these bacteria have an ability to grow at refrigerator temperatures, at which most RTE foods are stored for a long time and some of them are not reheated or only reheated for a few minutes before serving [2,3]. Beside temperature, the bacterium has the ability to survive at harsh environmental conditions such as low pH and high concentrations of salt [4]. Several outbreaks of listeriosis all over the world, including the USA, Japan, New Zealand, Germany, England and France, have been associated with the consumption of such RTE foods [5]. Currently, at least 13 serovars have been identified for L. monocytogenes which all of them have the potential
426
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
ability to cause human listeriosis, but serovars 1/2a, 1/2b, 1/2c and 4b are involved in most cases. Moreover, L. monocytogenes can be divided into four evolutionary lineages (I, II, III, and IV) with different but overlapping ecological niches. For example, the most human listeriosis outbreaks are associated with lineage I while lineage III and IV strains are rare and predominantly isolated from animal sources [6]. The risk of disease is more in pregnant, as compared to non-pregnant individuals (18 times), because the placenta provides a niche for the growth of bacterium, resulting in such adverse outcomes as spontaneous abortion [7,8]. Because there are many reports regarding the resistance of L. monocytogenes to antibiotic agents that are specially involved in listeriosis treatment, demonstrating the existence of resistance in L. monocytogenes isolated from different sources (clinical, food, environmental and animal) is a major issue [9]. Iran is among the major consumers of animal source and dairy based foods and the increasing use of antibiotics in animals has caused the antibiotic resistance problem as an important public health concern. Although some studies have been previously designed to address the detection of L. monocytogenes in Iran [10,11], but isolation from different sources (human, food and livestock) at the same time and detailed characterization (including PCR-serotyping and MIC value determination) of this hazardous pathogen are lacking. The aim of this study was isolation, determination of antimicrobial susceptibility and molecular serotyping of L. monocytogenes isolated from clinical, food and animal sources in Iran. 2. Materials and methods 2.1. Study design and sample collection In this study, a total of 442 samples including 125 clinical specimens, 267 food samples (sausage, milk, cheese, chicken and meat stock cubes from retail markets) and 50 livestock (goat and sheep carcasses from slaughterhouses) were collected and examined during June 2013 to December 2015, in Iran. Clinical specimens were a set of five different samples including blood, urine, placental tissue, rectal and vaginal swabs from each pregnant woman was admitted to hospital with a diagnosis of abortion [12]. 2.2. Enrichment, culturing and identification For the purpose isolating L. monocytogenes from aseptically collected specimens, 5 ml from each of blood and urine samples and 25 g of the placental tissue, food and livestock samples were inoculated into 50 and 225 ml of TSBYE broth (Trypticase Soy broth with 0.6% yeast extract, Merck, Germany), respectively. Furthermore, each of rectal and vaginal swabs was inoculated into 10 ml of TSBYE. All of the samples were incubated at 4 C. After one or two weeks, until 6 months incubation, aliquots from enrichment broth (TSBYE broth) were streaked onto PALCAM (Merck, Germany) and chromogenic Agar (Merck, Germany) for 24e48 h, and the plates were incubated at 35 C. The green shiny colonies with diffuse black shadow around them on PALCAM agar, because of the hydrolysis of esculin and blue colonies with a halo around the colonies on the chromogenic agar medium were suspected to be Listeria. About 5 typic presumptive Listeria spp. colonies from culture media were purified on Brain Heart Infusion agar (Merck, Germany) and identified using morphological and biochemical tests [1,3]. Confirmation of the isolates was based on conventional standard methods including Gram staining, catalase, oxidase, methyl red, VogesProskauer tests and the fermentation of xylose, rhamnose, mannitol and a-methyl D-mannopyranoside. Moreover, all the biochemically characterized isolates were tested for hemolysis on Sheep blood agar and CAMP test [1]. Finally, Listeria spp. colonies
were selected and submitted to PCR tests for further identification and serotyping. 2.3. Molecular identification of Listeria genus and species All isolates phenotypically considered as L. monocytogenes were confirmed by PCR targeting plcA gene (encoded phosphatidylinositole phospholipase-C). The primers for amplification of this gene (plc-A F-50 -TTAGTTGAATTTATTGTTTTTTTATG-30 and plc-A R 50 TTGTATAAGAATTATTTGC-30 ) were designed in the author's previous study [13]. Also, the prs gene, specific for the strains of the genus Listeria, was amplified [10]. 2.4. Polymerase chain reaction (PCR) and serotyping The extraction of bacterial chromosomal DNA was performed using the Geno Plus™ Genomic DNA Extraction Mini prep System Kit (VIOGENE, Taiwan), in accordance with the manufacturer specifications. The DNA extracted from L. monocytogenes was applied as templates for PCR assay. L. monocytogenes ATCC 7644 and sterile distilled water were used as a positive control and a negative control, respectively. Other oligonucleotide primers used in the present study including lmo 0737, lmo 1118, ORF 2819, ORF 2110 and prs for genus identification, was as previously described by Doumith et al. (Table 1) [14]. The marker genes selected for the multiplex PCR assay were lmo 0737 and lmo 1118, as identified in the sequenced L. monocytogenes serovar 1/2a, and ORF 2819 and ORF 2110, as identified in the partial sequence of L. monocytogenes 4b strain. The prs gene, specific for the strains of the genus Listeria, was targeted for an internal amplification control [10]. The PCR reaction was performed in a 50 ml mixture containing 1X PCR buffer (Ampliqon, Denmark), 0.2 mM of each dNTPs (Ampliqon, Denmark), 1.5 mM MgCl2 (Ampliqon, Denmark), 0.2 mM of each primers (lmo 0737, lmo 1118, ORF 2819, ORF 2110 and prs), 2.5 units of Taq DNA polymerase enzyme, 5 ml of the template DNA and sterilized Milli-Q water. The amplification program consisted of an initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 95 C for 40s, annealing at 53 C for 75s and extension at 72 C for 75s with a final extension at 72 C for 7 min. After the reaction, electrophoresis was performed by 2% agarose gel in the 1X TAE buffer, stained with safe stain and visualized by UV transilluminator. 2.5. Antimicrobial susceptibility The antibiotic susceptibility of the isolates was determined by the disc diffusion method (Kirby-Bauer) according to the Clinical and Laboratory Standards Institute (CLSI) [15] recommendations. The antibiotics used were chloramphenicol, linezolid, kanamycin, tetracycline, sulfamethoxazole-trimethoprim, gentamicin, penicillin G, ampicillin, amoxicillin-clavulanic acid, clindamycin and rifampicin. Staphylococcus aureus ATCC 25923 was used as a control strain. The antibiotic discs were obtained from Mast Co, UK. The strains were classified as sensitive, intermediate and resistant. 2.6. Determination of minimum inhibitory concentration The minimum inhibitory concentration (MIC) of clindamycin, gentamicin, penicillin G and ampicillin against all tested isolates were determined by the E-test strips, according to the manufacturer's instructions (Liofilchem, Italy). The MIC results were interpreted according to breakpoints mentioned in CLSI [15], for penicillin and ampicillin, and the Staphylococcus aureus criteria were used for the remaining antibacterials.
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
427
Table 1 Nucleotide sequences of primer sets used in this study. Target gene lmo0737 lmo1118 ORF2819 ORF2110 prs
F R F R F R F R F R
Primer Sequence
Product Size (bp)
Serotype Specificity
AGGGCTTCAAGGACTTACCC ACGATTTCTGCTTGCCATTC AGGGGTCTTAAATCCTGGAA CGGCTTGTTCGGCATACTTA AGCAAAATGCCAAAACTCGT CATCACTAAAGCCTCCCATTG AGTGGACAATTGATTGGTGAA CATCCATCCCTTACTTTGGAC GCTGAAGAGATTGCGAAAGAAG CAAAGAAACCTTGGATTTGCGG
691
1/2a, 1/2c, 3a and 3c
906
1/2c and 3c
471
1/2b, 3b, 4b, 4d
597
4b, 4d and 4e
370
All Listeria species
3. Results The prevalence of L. monocytogenes strains isolated from different specimens and their serovar characterization by multiplex PCR can be seen in Table 2 and Fig. 1 respectively. Among 22 L. monocytogenes isolates, 19 (86.4%) were classified as serovar [(1/ 2c and 3c), lineage II] and the remaining 3 isolates were identified as [(4b, 4d or 4e), lineage I] and [(1/2a, 3a), lineage II], respectively (Fig. 1). All human and food isolates belonged to (1/2c and 3c), 1 isolate from sheep referred to (1/2a, 3a) and 2 livestock samples (one from sheep and the other from goat) were considered as (4b, 4d or 4e).
3.1. Antimicrobial susceptibility All L. monocytogenes strains isolated from clinical, food and livestock samples were susceptible to chloramphenicol, linezolid, amoxicillin-clavulanic acid, kanamycin, tetracycline, sulfamethoxazole-trimethoprim, gentamicin and ampicillin. Among the 22 isolates assessed, 6 (27.2%) of them were resistant to penicillin G. The intermediate rates were as follows: all evaluated isolates were intermediate to clindamycin and 2 (9%) were intermediate to rifampicin. The origin of penicillin resistant isolates was urine, vaginal and rectal swab and cheese. All of them belonged to the serovar [(1/2c and 3c), lineage II], 2 rifampicin intermediate isolates were from milk and sausage; they also belonged to the serovar [(1/2c and 3c), lineage II]. Among clindamycin intermediate isolates, 2 belonged to the [(4b, 4d or 4e), lineage I], (one from sheep and one from goat) and all of the remaining strains had the serovar [(1/2c and 3c), lineage II]. No multiple resistant isolates were found in this research. All 22 L. monocytogenes isolates tested against two antimicrobial agents (ampicillin and gentamicin) using the E-test were found to be sensitive. Furthermore, sixteen isolates (72.7%) were intermediate to clindamycin and 6 isolates (27.2%) were completely
resistant to penicillin G when using this method. The susceptibility of L. monocytogenes to ampicillin, gentamicin and penicillin G had the same results in both disk diffusion and MIC determination, using E-test strips. From all 22 L. monocytogenes isolates that were intermediate resistant to clindamycin in the disk diffusion method, only 16 of them showed intermediate susceptibility in MIC determination and the remaining ones (6 isolates) were completely sensitive. The MIC values of the four tested antibiotics are as shown in Table 3. 4. Discussion The results of the present study indicated that L. monocytogenes contamination rates were 8.8%, 2.9% and 6% for human clinical, food and livestock samples, respectively. The results of human contamination rates were found to be in agreement with those reported by Eslami et al. [16], which were 7.3% and much more than those obtained by Soni et al. [17], who reported 0.81% of clinical isolated strains as L. monocytogenes. The results of food contamination by L. monocytogenes were in close correlation with those obtained by Jalali et al. [10], Terzi et al. [5] and Chen et al. [18], who reported food contamination rates as 1.2%, 4% and 4.4%, respectively. Our results were different from those of Indrawattana et al., which showed 15.4% for meat contamination [19]. In the livestock section, our results for contamination rate (6%) were different from those of Yadav et al. (1.79%) [20] and Osman et al. (1.43%) [21]. The reasons for such a divergence in the results of all kinds of specimens could lie in the differences in geographic locations, race, hygienic conditions and methods in the isolation of L. monocytogenes. Because of the increasing number of resistant strains among L. monocytogenes and our knowledge about acquiring resistance genes, especially from organisms found in food, the concerns about the emergence of resistant clinical isolates seem to be serious [5]. Although the overall prevalence of antibiotic resistance in the present study was low, but resistance to penicillin was (22%) and
Table 2 Incidence of L. monocytogenes isolates in clinical specimens, food samples and livestock. Samples
No. of samples
No. of positive isolates
Percentage of positive isolates
Placental tissue Vaginal swabs Rectal swabs Blood Urine Sausage Milk Cheese Chicken and meat stock cubes Sheep carcasses Goat carcasses Total
40 25 25 15 20 50 37 130 50 35 15 442
4 2 4 0 1 1 1 4 2 2 1 22
10 8 16 0 5 2 2.7 3.1 4 5.7 6.7 4.98
428
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
Fig. 1. Serotype identification of L. monocytogenes isolates by the multiplex PCR. M: 100e1000 bp DNA ladder, Ng: Negative control, S1: standard strain 7644 (1/2c), S2: standard strain 19115 (1/2a), and S3: standard strain 19117 (4b). 370 bp: prs, 471 bp: ORF 2819, 597 bp: ORF 2110, 691 bp: lmo 0737, 906 bp: lmo 1118.
Table 3 The MIC ranges of tested antibiotics against Listeria monocytogenes isolates. Antimicrobial agent
Strip concentration (mg/l)
Susceptibility breakpoints
Resistance breakpoints
Range (mg/l)
Ampicillin Penicillin G Gentamicin Clindamycin
0.016e256 0.016e256 0.016e256 0.016e256
2 2 4 0.5
>2 >2 32 4
0.125e6 0.125e3.0 0.016e4 0.38e4
MIC: minimum inhibitory concentration.
intermediate levels to clindamycin and rifampicin were 100% and 9%, respectively. The results of the present investigation were in agreement with those obtained by Ruiz-Bolivar et al.; also in their study, the overall resistance was low but like our work, decreased susceptibility to clindamycin was seen and 16% of isolates were non susceptible to penicillin [22]. Moreover, in a study conducted by Jamali et al. it showed that 53.1% and 3.1% of L. monocytogenes strains were resistant to penicillin G and clindamycin, respectively [23]. Resistance to penicillin and the intermediate results related to clindamycin which the majority of them could only be confirmed by the quantitative susceptibility testing (MIC determination) except for clindamycin that needs a gold standard method like PCR, could be due the excess use of these drugs in the veterinary field [13]. The results of this study showed complete susceptibility of the isolates to ampicillin and tetracycline in accordance with previous studies, where Abuin et al. reported susceptibility to ampicillin [24] or Yucel et al. results showed high prevalence of susceptibility to tetracycline [25] among tested isolates of L. monocytogenes. Also, the good activity of tetracycline against L. monocytogenes in the present study was in agreement with that reported previously by Altuntas et al. and Terzi et al. [26]. In our study, the penicillin MIC90 was 1.5 mg/ml and lower than the susceptibility breakpoint. Because the resistance to penicillin was seen more frequently in clinical samples including urine, vaginal and rectal swabs than food (only one sample of cheese), in comparison with the clinical isolates of other studies, we found agreement with the results of MartinezMartinez et al. [27], showing MIC90 of 1 mg/ml, but the level of MIC90 for penicillin in Ruiz-Boliver et al. study was about 4 mg/ml, thereby exceeding the susceptibility breakpoint. Overall, the results of the current study indicated that the most of isolates from livestock origin and all clinical and food strains in this work belonged to lineage I. From food point of view, our results were in agreement with Jamali et al., because mentioned authors also found that lineage I strains were more frequent in foods [1] and
interestingly in disagreement with some other researchers such as Shen et al. that reported lineage II isolates were more frequent in foods [28]. The presence of [(4b, 4d or 4e), lineage I] (potential serotype 4b) in livestock samples could be hazardous for human, because this serotype might responsible for several outbreaks of listeriosis in human [29]. The results of serogrouping in goat and sheep samples mentioned above were similar with those obtained by Yadav et al., in 2011 [20], showing that the identified serotype was also 4b from the animal source. The serotype 4b, which was identified in some animal samples in the present study, were found to be the serotype predominantly associated with animal listeriosis and foodborne outbreaks due to Listeria spp [19]. 5. Conclusions Finally, based on the results of the present study, the most prevalent serovars of L. monocytogenes was belonging to lineage II (1/2c and 3c). Since most serovars reported in previous studies belonged to 1/2a [30], more prevalence of serovar 1/2c and 3c (potentially 1/2c), with alarming rates of decreased susceptibility to penicillin G and clindamycin in our study could raise concerns about this serovar and to likelihood of resistant listeriosis due to the 1/2c serovar in Iran. Conflicts of interest The authors declare no conflicts of interest. Acknowledgment This work was fully supported by Immunology Research Center (grant No. 93-104), Tabriz University of Medical Sciences. It is also a report originating from a database developed for the thesis of
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
second author registered in Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
[16]
References [17] [1] H. Jamali, M. Paydar, S. Ismail, C.Y. Looi, W.F. Wong, B. Radmehr, et al., Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets, BMC Microbiol. 15 (2015) 144. [2] D. Meloni, P. Galluzzo, A. Mureddu, F. Piras, M. Griffiths, R. Mazzette, Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates, Int. J. Food Microbiol. 129 (2) (2009) 166e173. [3] J.A. V azquez-Boland, M. Kuhn, P. Berche, T. Chakraborty, G. Domınguez-Bernal, W. Goebel, et al., Listeria pathogenesis and molecular virulence determinants, Clin. Microbiol. Rev. 14 (3) (2001) 584e640. [4] H. Yan, S.B. Neogi, Z. Mo, W. Guan, Z. Shen, S. Zhang, et al., Prevalence and characterization of antimicrobial resistance of foodborne Listeria monocytogenes isolates in Hebei province of Northern China, 2005e2007, Int. J. Food Microbiol. 144 (2) (2010) 310e316. € M. Alisarli, Serotyping and anti[5] G. Terzi, A. Gucukoglu, Uyanik T. Çadirci O, biotic susceptibility of Listeria monocytogenes isolated from ready-to-eat foods in Samsun, Turkey, Turkish J. Veterinary Animal Sci. 39 (2) (2015) 211e217. [6] P. Bracegirdle, A. West, M. Lever, R. Fitzgeorge, A. Baskerville, A comparison of aerosol and intragastric routes of infection with Listeria spp, Epidemiol. Infect. 112 (01) (1994) 69e79. [7] M. Abram, D. Schlüter, D. Vuckovic, B. Wraber, M. Doric, M. Deckert, Murine model of pregnancy-associated Listeria monocytogenes infection, FEMS Immunol. Med. Microbiol. 35 (3) (2003) 177e182. [8] C. Romana, L. Salleras, M. Sage, Latent listeriosis may cause habitual abortion intrauterine deaths, fetal malformations. When diagnosed and treated adequately normal children will be born, Acta Microbiol. Hung. 36 (2e3) (1988) 171e172. [9] A.A. Saulo, Ready-to-eat Foods and Listeriosis, 2005. [10] M. Jalali, D. Abedi, Prevalence of Listeria species in food products in Isfahan, Iran. Int. J. Food Microbiol. 122 (3) (2008) 336e340. [11] L. Lotfollahi, J. Nowrouzi, G. Irajian, F. Masjedian, B. Kazemi, L.E.A. Falahat, et al., Prevalence and antimicrobial resistance profiles of Listeria monocytogenes in spontaneous abortions in humans, Afr. J. Microbiol. Res. 5 (14) (2011) 1990e1993. ́ [12] S. Kaur, S. Malik, V. Vaidya, S. Barbuddhe, Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR, J. Appl. Microbiol. 103 (5) (2007) 1889e1896. [13] L. Lotfollahi, A. Pournajaf, J. Nowrouzi, Polymerase chain reaction (PCR4)based detection of hly and plc-A genes in Listeria monocytogenes isolated from dairy and meat products in Iran, Afr. J. Microbiol. Res. 8 (10) (2014) 1098e1101. [14] M. Doumith, C. Buchrieser, P. Glaser, C. Jacquet, P. Martin, Differentiation of the major Listeria monocytogenes serovars by multiplex PCR, J. Clin. Microbiol. 42 (8) (2004) 3819e3822. [15] Clinical and Laboratory Standard Institute, Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
429
Animals. Approved Standard, 3rd ed., Clinical and Laboratory Standards Institute, Wayne (PA), 2014. M31eA3.28. G. Eslami, R. Samadi, R. Taherpanah, A. Taherpor, N. Baseri, Detection of actA and inlB genes in Listeria monocytogenes isolated from women with spontaneous abortions, Nov. Biomed. 2 (1) (2014) 18e21. D.K. Soni, D.V. Singh, S.K. Dubey, Pregnancy-associated human listeriosis: virulence and genotypic analysis of Listeria monocytogenes from clinical samples, J. Microbiol. 53 (9) (2015) 653e660. M. Chen, Q. Wu, J. Zhang, J. Wang, Prevalence and characterization of Listeria monocytogenes isolated from retail-level ready-to-eat foods in South China, Food control. 38 (2014) 1e7. N. Indrawattana, T. Nibaddhasobon, N. Sookrung, M. Chongsa-nguan, A. Tungtrongchitr, S-i Makino, et al., Prevalence of Listeria monocytogenes in raw meats marketed in Bangkok and characterization of the isolates by phenotypic and molecular methods, J. Health, Popul. Nutr. (2011) 26e38. M.M. Yadav, A. Roy, B. Bhanderi, R. Jani, Prevalence of Listeria species including L. monocytogenes from apparently healthy animals at Baroda Zoo, Gujarat State, India, J. Threat. Taxa 3 (7) (2011) 1929e1935. K.M. Osman, T.R. Zolnikov, A. Samir, A. Orabi, Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions, Pathogens Glob. Health 108 (1) (2014) 21e29. Z. Ruiz-Bolivar, M.C. Neuque-Rico, R.A. Poutou-Pinales, A.K. Carrascal-Camacho, S. Mattar, Antimicrobial susceptibility of Listeria monocytogenes food isolates from different cities in Colombia, Foodborne Pathogens Dis. 8 (8) (2011) 913e919. S. Harakeh, I. Saleh, O. Zouhairi, E. Baydoun, E. Barbour, N. Alwan, Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products, Sci. Total Environ. 407 (13) (2009) 4022e4027. ndez, C.F. Sampayo, J.R. Otero, L.D. Rodriguez, A.C. S C.F. Abuin, E.Q. Ferna aez, Susceptibilities of Listeria species isolated from food to nine antimicrobial agents, Antimicrob. Agents Chemother. 38 (7) (1994) 1655e1657. € N. Yücel, S. Cıtak, M. Onder, Prevalence and antibiotic resistance of Listeria species in meat products in Ankara, Turkey, Food Microbiol. 22 (2) (2005) 241e245. A. Evrim Gunes, K. Deniz, C. Serap, A. Kamuran, K.J. Vijay, M. Luis, Antibiotic and bacteriocin sensitivity of Listeria monocytogenes strains isolated from different foods, Food Nutr. Sci. (2012) 2012. rez, E.J. Perea, Activities of gemiL. Martínez-Martínez, P. Joyanes, A.I. Sua floxacin and five other antimicrobial agents against Listeria monocytogenes and coryneform bacteria isolated from clinical samples, Antimicrob. Agents Chemother. 45 (8) (2001) 2390e2392. J. Shen, L. Rump, Y. Zhang, Y. Chen, X. Wang, J. Meng, Molecular subtyping and virulence gene analysis of Listeria monocytogenes isolates from food, Food Microbiol. 35 (1) (2013) 58e64. T.J. Ward, T. Usgaard, P. Evans, A targeted multilocus genotyping assay for lineage, serogroup, and epidemic clone typing of Listeria monocytogenes, Appl. Environ. Microbiol. 76 (19) (2010) 6680e6684. H. Jamali, B. Radmehr, K.L. Thong, Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks, Food control. 34 (1) (2013) 121e125.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran Lida Lotfollahi a, Ardalan Chaharbalesh b, c, Mohammad Ahangarzadeh Rezaee b, d, *, Alka Hasani d a
Department of Microbiology, Faculty of Medicine, Urmia University of Medical Sciences, Urmia, Iran Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran d Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 September 2016 Received in revised form 19 April 2017 Accepted 19 April 2017 Available online 23 April 2017
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using Etest. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/ 2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Listeria monocytogenes PCR-serotyping Antimicrobial resistance Foods Livestock Iran
1. Introduction The genus Listeria includes a variety of species among which Listeria monocytogenes and L. ivanovii and occasionally, L. seeligeri are known as pathogens in both animals and humans (L. monocytogenes) or animals (L. ivanovii) [1]. L. monocytogenes is an important food-borne pathogen causing febrile gastroenteritis in healthy people and invasive diseases in high risk populations such as pregnant women, individuals in extremities of age and immunosuppressed persons. Septicemia, meningitis, spontaneous
* Corresponding author. Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, 51666-14766, Iran. E-mail address: [email protected] (M. Ahangarzadeh Rezaee). http://dx.doi.org/10.1016/j.micpath.2017.04.029 0882-4010/© 2017 Elsevier Ltd. All rights reserved.
abortion and stillbirth are examples of invasive diseases due to the bacterium and these conditions result in high case-fatality rate. In recent years, the growing consumption of Ready-to-Eat (RTE) foods is recognized as the root of L. monocytogenes outbreaks, because these bacteria have an ability to grow at refrigerator temperatures, at which most RTE foods are stored for a long time and some of them are not reheated or only reheated for a few minutes before serving [2,3]. Beside temperature, the bacterium has the ability to survive at harsh environmental conditions such as low pH and high concentrations of salt [4]. Several outbreaks of listeriosis all over the world, including the USA, Japan, New Zealand, Germany, England and France, have been associated with the consumption of such RTE foods [5]. Currently, at least 13 serovars have been identified for L. monocytogenes which all of them have the potential
426
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
ability to cause human listeriosis, but serovars 1/2a, 1/2b, 1/2c and 4b are involved in most cases. Moreover, L. monocytogenes can be divided into four evolutionary lineages (I, II, III, and IV) with different but overlapping ecological niches. For example, the most human listeriosis outbreaks are associated with lineage I while lineage III and IV strains are rare and predominantly isolated from animal sources [6]. The risk of disease is more in pregnant, as compared to non-pregnant individuals (18 times), because the placenta provides a niche for the growth of bacterium, resulting in such adverse outcomes as spontaneous abortion [7,8]. Because there are many reports regarding the resistance of L. monocytogenes to antibiotic agents that are specially involved in listeriosis treatment, demonstrating the existence of resistance in L. monocytogenes isolated from different sources (clinical, food, environmental and animal) is a major issue [9]. Iran is among the major consumers of animal source and dairy based foods and the increasing use of antibiotics in animals has caused the antibiotic resistance problem as an important public health concern. Although some studies have been previously designed to address the detection of L. monocytogenes in Iran [10,11], but isolation from different sources (human, food and livestock) at the same time and detailed characterization (including PCR-serotyping and MIC value determination) of this hazardous pathogen are lacking. The aim of this study was isolation, determination of antimicrobial susceptibility and molecular serotyping of L. monocytogenes isolated from clinical, food and animal sources in Iran. 2. Materials and methods 2.1. Study design and sample collection In this study, a total of 442 samples including 125 clinical specimens, 267 food samples (sausage, milk, cheese, chicken and meat stock cubes from retail markets) and 50 livestock (goat and sheep carcasses from slaughterhouses) were collected and examined during June 2013 to December 2015, in Iran. Clinical specimens were a set of five different samples including blood, urine, placental tissue, rectal and vaginal swabs from each pregnant woman was admitted to hospital with a diagnosis of abortion [12]. 2.2. Enrichment, culturing and identification For the purpose isolating L. monocytogenes from aseptically collected specimens, 5 ml from each of blood and urine samples and 25 g of the placental tissue, food and livestock samples were inoculated into 50 and 225 ml of TSBYE broth (Trypticase Soy broth with 0.6% yeast extract, Merck, Germany), respectively. Furthermore, each of rectal and vaginal swabs was inoculated into 10 ml of TSBYE. All of the samples were incubated at 4 C. After one or two weeks, until 6 months incubation, aliquots from enrichment broth (TSBYE broth) were streaked onto PALCAM (Merck, Germany) and chromogenic Agar (Merck, Germany) for 24e48 h, and the plates were incubated at 35 C. The green shiny colonies with diffuse black shadow around them on PALCAM agar, because of the hydrolysis of esculin and blue colonies with a halo around the colonies on the chromogenic agar medium were suspected to be Listeria. About 5 typic presumptive Listeria spp. colonies from culture media were purified on Brain Heart Infusion agar (Merck, Germany) and identified using morphological and biochemical tests [1,3]. Confirmation of the isolates was based on conventional standard methods including Gram staining, catalase, oxidase, methyl red, VogesProskauer tests and the fermentation of xylose, rhamnose, mannitol and a-methyl D-mannopyranoside. Moreover, all the biochemically characterized isolates were tested for hemolysis on Sheep blood agar and CAMP test [1]. Finally, Listeria spp. colonies
were selected and submitted to PCR tests for further identification and serotyping. 2.3. Molecular identification of Listeria genus and species All isolates phenotypically considered as L. monocytogenes were confirmed by PCR targeting plcA gene (encoded phosphatidylinositole phospholipase-C). The primers for amplification of this gene (plc-A F-50 -TTAGTTGAATTTATTGTTTTTTTATG-30 and plc-A R 50 TTGTATAAGAATTATTTGC-30 ) were designed in the author's previous study [13]. Also, the prs gene, specific for the strains of the genus Listeria, was amplified [10]. 2.4. Polymerase chain reaction (PCR) and serotyping The extraction of bacterial chromosomal DNA was performed using the Geno Plus™ Genomic DNA Extraction Mini prep System Kit (VIOGENE, Taiwan), in accordance with the manufacturer specifications. The DNA extracted from L. monocytogenes was applied as templates for PCR assay. L. monocytogenes ATCC 7644 and sterile distilled water were used as a positive control and a negative control, respectively. Other oligonucleotide primers used in the present study including lmo 0737, lmo 1118, ORF 2819, ORF 2110 and prs for genus identification, was as previously described by Doumith et al. (Table 1) [14]. The marker genes selected for the multiplex PCR assay were lmo 0737 and lmo 1118, as identified in the sequenced L. monocytogenes serovar 1/2a, and ORF 2819 and ORF 2110, as identified in the partial sequence of L. monocytogenes 4b strain. The prs gene, specific for the strains of the genus Listeria, was targeted for an internal amplification control [10]. The PCR reaction was performed in a 50 ml mixture containing 1X PCR buffer (Ampliqon, Denmark), 0.2 mM of each dNTPs (Ampliqon, Denmark), 1.5 mM MgCl2 (Ampliqon, Denmark), 0.2 mM of each primers (lmo 0737, lmo 1118, ORF 2819, ORF 2110 and prs), 2.5 units of Taq DNA polymerase enzyme, 5 ml of the template DNA and sterilized Milli-Q water. The amplification program consisted of an initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 95 C for 40s, annealing at 53 C for 75s and extension at 72 C for 75s with a final extension at 72 C for 7 min. After the reaction, electrophoresis was performed by 2% agarose gel in the 1X TAE buffer, stained with safe stain and visualized by UV transilluminator. 2.5. Antimicrobial susceptibility The antibiotic susceptibility of the isolates was determined by the disc diffusion method (Kirby-Bauer) according to the Clinical and Laboratory Standards Institute (CLSI) [15] recommendations. The antibiotics used were chloramphenicol, linezolid, kanamycin, tetracycline, sulfamethoxazole-trimethoprim, gentamicin, penicillin G, ampicillin, amoxicillin-clavulanic acid, clindamycin and rifampicin. Staphylococcus aureus ATCC 25923 was used as a control strain. The antibiotic discs were obtained from Mast Co, UK. The strains were classified as sensitive, intermediate and resistant. 2.6. Determination of minimum inhibitory concentration The minimum inhibitory concentration (MIC) of clindamycin, gentamicin, penicillin G and ampicillin against all tested isolates were determined by the E-test strips, according to the manufacturer's instructions (Liofilchem, Italy). The MIC results were interpreted according to breakpoints mentioned in CLSI [15], for penicillin and ampicillin, and the Staphylococcus aureus criteria were used for the remaining antibacterials.
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
427
Table 1 Nucleotide sequences of primer sets used in this study. Target gene lmo0737 lmo1118 ORF2819 ORF2110 prs
F R F R F R F R F R
Primer Sequence
Product Size (bp)
Serotype Specificity
AGGGCTTCAAGGACTTACCC ACGATTTCTGCTTGCCATTC AGGGGTCTTAAATCCTGGAA CGGCTTGTTCGGCATACTTA AGCAAAATGCCAAAACTCGT CATCACTAAAGCCTCCCATTG AGTGGACAATTGATTGGTGAA CATCCATCCCTTACTTTGGAC GCTGAAGAGATTGCGAAAGAAG CAAAGAAACCTTGGATTTGCGG
691
1/2a, 1/2c, 3a and 3c
906
1/2c and 3c
471
1/2b, 3b, 4b, 4d
597
4b, 4d and 4e
370
All Listeria species
3. Results The prevalence of L. monocytogenes strains isolated from different specimens and their serovar characterization by multiplex PCR can be seen in Table 2 and Fig. 1 respectively. Among 22 L. monocytogenes isolates, 19 (86.4%) were classified as serovar [(1/ 2c and 3c), lineage II] and the remaining 3 isolates were identified as [(4b, 4d or 4e), lineage I] and [(1/2a, 3a), lineage II], respectively (Fig. 1). All human and food isolates belonged to (1/2c and 3c), 1 isolate from sheep referred to (1/2a, 3a) and 2 livestock samples (one from sheep and the other from goat) were considered as (4b, 4d or 4e).
3.1. Antimicrobial susceptibility All L. monocytogenes strains isolated from clinical, food and livestock samples were susceptible to chloramphenicol, linezolid, amoxicillin-clavulanic acid, kanamycin, tetracycline, sulfamethoxazole-trimethoprim, gentamicin and ampicillin. Among the 22 isolates assessed, 6 (27.2%) of them were resistant to penicillin G. The intermediate rates were as follows: all evaluated isolates were intermediate to clindamycin and 2 (9%) were intermediate to rifampicin. The origin of penicillin resistant isolates was urine, vaginal and rectal swab and cheese. All of them belonged to the serovar [(1/2c and 3c), lineage II], 2 rifampicin intermediate isolates were from milk and sausage; they also belonged to the serovar [(1/2c and 3c), lineage II]. Among clindamycin intermediate isolates, 2 belonged to the [(4b, 4d or 4e), lineage I], (one from sheep and one from goat) and all of the remaining strains had the serovar [(1/2c and 3c), lineage II]. No multiple resistant isolates were found in this research. All 22 L. monocytogenes isolates tested against two antimicrobial agents (ampicillin and gentamicin) using the E-test were found to be sensitive. Furthermore, sixteen isolates (72.7%) were intermediate to clindamycin and 6 isolates (27.2%) were completely
resistant to penicillin G when using this method. The susceptibility of L. monocytogenes to ampicillin, gentamicin and penicillin G had the same results in both disk diffusion and MIC determination, using E-test strips. From all 22 L. monocytogenes isolates that were intermediate resistant to clindamycin in the disk diffusion method, only 16 of them showed intermediate susceptibility in MIC determination and the remaining ones (6 isolates) were completely sensitive. The MIC values of the four tested antibiotics are as shown in Table 3. 4. Discussion The results of the present study indicated that L. monocytogenes contamination rates were 8.8%, 2.9% and 6% for human clinical, food and livestock samples, respectively. The results of human contamination rates were found to be in agreement with those reported by Eslami et al. [16], which were 7.3% and much more than those obtained by Soni et al. [17], who reported 0.81% of clinical isolated strains as L. monocytogenes. The results of food contamination by L. monocytogenes were in close correlation with those obtained by Jalali et al. [10], Terzi et al. [5] and Chen et al. [18], who reported food contamination rates as 1.2%, 4% and 4.4%, respectively. Our results were different from those of Indrawattana et al., which showed 15.4% for meat contamination [19]. In the livestock section, our results for contamination rate (6%) were different from those of Yadav et al. (1.79%) [20] and Osman et al. (1.43%) [21]. The reasons for such a divergence in the results of all kinds of specimens could lie in the differences in geographic locations, race, hygienic conditions and methods in the isolation of L. monocytogenes. Because of the increasing number of resistant strains among L. monocytogenes and our knowledge about acquiring resistance genes, especially from organisms found in food, the concerns about the emergence of resistant clinical isolates seem to be serious [5]. Although the overall prevalence of antibiotic resistance in the present study was low, but resistance to penicillin was (22%) and
Table 2 Incidence of L. monocytogenes isolates in clinical specimens, food samples and livestock. Samples
No. of samples
No. of positive isolates
Percentage of positive isolates
Placental tissue Vaginal swabs Rectal swabs Blood Urine Sausage Milk Cheese Chicken and meat stock cubes Sheep carcasses Goat carcasses Total
40 25 25 15 20 50 37 130 50 35 15 442
4 2 4 0 1 1 1 4 2 2 1 22
10 8 16 0 5 2 2.7 3.1 4 5.7 6.7 4.98
428
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
Fig. 1. Serotype identification of L. monocytogenes isolates by the multiplex PCR. M: 100e1000 bp DNA ladder, Ng: Negative control, S1: standard strain 7644 (1/2c), S2: standard strain 19115 (1/2a), and S3: standard strain 19117 (4b). 370 bp: prs, 471 bp: ORF 2819, 597 bp: ORF 2110, 691 bp: lmo 0737, 906 bp: lmo 1118.
Table 3 The MIC ranges of tested antibiotics against Listeria monocytogenes isolates. Antimicrobial agent
Strip concentration (mg/l)
Susceptibility breakpoints
Resistance breakpoints
Range (mg/l)
Ampicillin Penicillin G Gentamicin Clindamycin
0.016e256 0.016e256 0.016e256 0.016e256
2 2 4 0.5
>2 >2 32 4
0.125e6 0.125e3.0 0.016e4 0.38e4
MIC: minimum inhibitory concentration.
intermediate levels to clindamycin and rifampicin were 100% and 9%, respectively. The results of the present investigation were in agreement with those obtained by Ruiz-Bolivar et al.; also in their study, the overall resistance was low but like our work, decreased susceptibility to clindamycin was seen and 16% of isolates were non susceptible to penicillin [22]. Moreover, in a study conducted by Jamali et al. it showed that 53.1% and 3.1% of L. monocytogenes strains were resistant to penicillin G and clindamycin, respectively [23]. Resistance to penicillin and the intermediate results related to clindamycin which the majority of them could only be confirmed by the quantitative susceptibility testing (MIC determination) except for clindamycin that needs a gold standard method like PCR, could be due the excess use of these drugs in the veterinary field [13]. The results of this study showed complete susceptibility of the isolates to ampicillin and tetracycline in accordance with previous studies, where Abuin et al. reported susceptibility to ampicillin [24] or Yucel et al. results showed high prevalence of susceptibility to tetracycline [25] among tested isolates of L. monocytogenes. Also, the good activity of tetracycline against L. monocytogenes in the present study was in agreement with that reported previously by Altuntas et al. and Terzi et al. [26]. In our study, the penicillin MIC90 was 1.5 mg/ml and lower than the susceptibility breakpoint. Because the resistance to penicillin was seen more frequently in clinical samples including urine, vaginal and rectal swabs than food (only one sample of cheese), in comparison with the clinical isolates of other studies, we found agreement with the results of MartinezMartinez et al. [27], showing MIC90 of 1 mg/ml, but the level of MIC90 for penicillin in Ruiz-Boliver et al. study was about 4 mg/ml, thereby exceeding the susceptibility breakpoint. Overall, the results of the current study indicated that the most of isolates from livestock origin and all clinical and food strains in this work belonged to lineage I. From food point of view, our results were in agreement with Jamali et al., because mentioned authors also found that lineage I strains were more frequent in foods [1] and
interestingly in disagreement with some other researchers such as Shen et al. that reported lineage II isolates were more frequent in foods [28]. The presence of [(4b, 4d or 4e), lineage I] (potential serotype 4b) in livestock samples could be hazardous for human, because this serotype might responsible for several outbreaks of listeriosis in human [29]. The results of serogrouping in goat and sheep samples mentioned above were similar with those obtained by Yadav et al., in 2011 [20], showing that the identified serotype was also 4b from the animal source. The serotype 4b, which was identified in some animal samples in the present study, were found to be the serotype predominantly associated with animal listeriosis and foodborne outbreaks due to Listeria spp [19]. 5. Conclusions Finally, based on the results of the present study, the most prevalent serovars of L. monocytogenes was belonging to lineage II (1/2c and 3c). Since most serovars reported in previous studies belonged to 1/2a [30], more prevalence of serovar 1/2c and 3c (potentially 1/2c), with alarming rates of decreased susceptibility to penicillin G and clindamycin in our study could raise concerns about this serovar and to likelihood of resistant listeriosis due to the 1/2c serovar in Iran. Conflicts of interest The authors declare no conflicts of interest. Acknowledgment This work was fully supported by Immunology Research Center (grant No. 93-104), Tabriz University of Medical Sciences. It is also a report originating from a database developed for the thesis of
L. Lotfollahi et al. / Microbial Pathogenesis 107 (2017) 425e429
second author registered in Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.
[16]
References [17] [1] H. Jamali, M. Paydar, S. Ismail, C.Y. Looi, W.F. Wong, B. Radmehr, et al., Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets, BMC Microbiol. 15 (2015) 144. [2] D. Meloni, P. Galluzzo, A. Mureddu, F. Piras, M. Griffiths, R. Mazzette, Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates, Int. J. Food Microbiol. 129 (2) (2009) 166e173. [3] J.A. V azquez-Boland, M. Kuhn, P. Berche, T. Chakraborty, G. Domınguez-Bernal, W. Goebel, et al., Listeria pathogenesis and molecular virulence determinants, Clin. Microbiol. Rev. 14 (3) (2001) 584e640. [4] H. Yan, S.B. Neogi, Z. Mo, W. Guan, Z. Shen, S. Zhang, et al., Prevalence and characterization of antimicrobial resistance of foodborne Listeria monocytogenes isolates in Hebei province of Northern China, 2005e2007, Int. J. Food Microbiol. 144 (2) (2010) 310e316. € M. Alisarli, Serotyping and anti[5] G. Terzi, A. Gucukoglu, Uyanik T. Çadirci O, biotic susceptibility of Listeria monocytogenes isolated from ready-to-eat foods in Samsun, Turkey, Turkish J. Veterinary Animal Sci. 39 (2) (2015) 211e217. [6] P. Bracegirdle, A. West, M. Lever, R. Fitzgeorge, A. Baskerville, A comparison of aerosol and intragastric routes of infection with Listeria spp, Epidemiol. Infect. 112 (01) (1994) 69e79. [7] M. Abram, D. Schlüter, D. Vuckovic, B. Wraber, M. Doric, M. Deckert, Murine model of pregnancy-associated Listeria monocytogenes infection, FEMS Immunol. Med. Microbiol. 35 (3) (2003) 177e182. [8] C. Romana, L. Salleras, M. Sage, Latent listeriosis may cause habitual abortion intrauterine deaths, fetal malformations. When diagnosed and treated adequately normal children will be born, Acta Microbiol. Hung. 36 (2e3) (1988) 171e172. [9] A.A. Saulo, Ready-to-eat Foods and Listeriosis, 2005. [10] M. Jalali, D. Abedi, Prevalence of Listeria species in food products in Isfahan, Iran. Int. J. Food Microbiol. 122 (3) (2008) 336e340. [11] L. Lotfollahi, J. Nowrouzi, G. Irajian, F. Masjedian, B. Kazemi, L.E.A. Falahat, et al., Prevalence and antimicrobial resistance profiles of Listeria monocytogenes in spontaneous abortions in humans, Afr. J. Microbiol. Res. 5 (14) (2011) 1990e1993. ́ [12] S. Kaur, S. Malik, V. Vaidya, S. Barbuddhe, Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR, J. Appl. Microbiol. 103 (5) (2007) 1889e1896. [13] L. Lotfollahi, A. Pournajaf, J. Nowrouzi, Polymerase chain reaction (PCR4)based detection of hly and plc-A genes in Listeria monocytogenes isolated from dairy and meat products in Iran, Afr. J. Microbiol. Res. 8 (10) (2014) 1098e1101. [14] M. Doumith, C. Buchrieser, P. Glaser, C. Jacquet, P. Martin, Differentiation of the major Listeria monocytogenes serovars by multiplex PCR, J. Clin. Microbiol. 42 (8) (2004) 3819e3822. [15] Clinical and Laboratory Standard Institute, Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
429
Animals. Approved Standard, 3rd ed., Clinical and Laboratory Standards Institute, Wayne (PA), 2014. M31eA3.28. G. Eslami, R. Samadi, R. Taherpanah, A. Taherpor, N. Baseri, Detection of actA and inlB genes in Listeria monocytogenes isolated from women with spontaneous abortions, Nov. Biomed. 2 (1) (2014) 18e21. D.K. Soni, D.V. Singh, S.K. Dubey, Pregnancy-associated human listeriosis: virulence and genotypic analysis of Listeria monocytogenes from clinical samples, J. Microbiol. 53 (9) (2015) 653e660. M. Chen, Q. Wu, J. Zhang, J. Wang, Prevalence and characterization of Listeria monocytogenes isolated from retail-level ready-to-eat foods in South China, Food control. 38 (2014) 1e7. N. Indrawattana, T. Nibaddhasobon, N. Sookrung, M. Chongsa-nguan, A. Tungtrongchitr, S-i Makino, et al., Prevalence of Listeria monocytogenes in raw meats marketed in Bangkok and characterization of the isolates by phenotypic and molecular methods, J. Health, Popul. Nutr. (2011) 26e38. M.M. Yadav, A. Roy, B. Bhanderi, R. Jani, Prevalence of Listeria species including L. monocytogenes from apparently healthy animals at Baroda Zoo, Gujarat State, India, J. Threat. Taxa 3 (7) (2011) 1929e1935. K.M. Osman, T.R. Zolnikov, A. Samir, A. Orabi, Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions, Pathogens Glob. Health 108 (1) (2014) 21e29. Z. Ruiz-Bolivar, M.C. Neuque-Rico, R.A. Poutou-Pinales, A.K. Carrascal-Camacho, S. Mattar, Antimicrobial susceptibility of Listeria monocytogenes food isolates from different cities in Colombia, Foodborne Pathogens Dis. 8 (8) (2011) 913e919. S. Harakeh, I. Saleh, O. Zouhairi, E. Baydoun, E. Barbour, N. Alwan, Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products, Sci. Total Environ. 407 (13) (2009) 4022e4027. ndez, C.F. Sampayo, J.R. Otero, L.D. Rodriguez, A.C. S C.F. Abuin, E.Q. Ferna aez, Susceptibilities of Listeria species isolated from food to nine antimicrobial agents, Antimicrob. Agents Chemother. 38 (7) (1994) 1655e1657. € N. Yücel, S. Cıtak, M. Onder, Prevalence and antibiotic resistance of Listeria species in meat products in Ankara, Turkey, Food Microbiol. 22 (2) (2005) 241e245. A. Evrim Gunes, K. Deniz, C. Serap, A. Kamuran, K.J. Vijay, M. Luis, Antibiotic and bacteriocin sensitivity of Listeria monocytogenes strains isolated from different foods, Food Nutr. Sci. (2012) 2012. rez, E.J. Perea, Activities of gemiL. Martínez-Martínez, P. Joyanes, A.I. Sua floxacin and five other antimicrobial agents against Listeria monocytogenes and coryneform bacteria isolated from clinical samples, Antimicrob. Agents Chemother. 45 (8) (2001) 2390e2392. J. Shen, L. Rump, Y. Zhang, Y. Chen, X. Wang, J. Meng, Molecular subtyping and virulence gene analysis of Listeria monocytogenes isolates from food, Food Microbiol. 35 (1) (2013) 58e64. T.J. Ward, T. Usgaard, P. Evans, A targeted multilocus genotyping assay for lineage, serogroup, and epidemic clone typing of Listeria monocytogenes, Appl. Environ. Microbiol. 76 (19) (2010) 6680e6684. H. Jamali, B. Radmehr, K.L. Thong, Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks, Food control. 34 (1) (2013) 121e125.