Prevalence of High risk Human Papillomavirus in cervical dysplasia and cancer samples from twin cities in Pakistan

International Journal of Infectious Diseases 34 (2015) 14–19

Contents lists available at ScienceDirect

International Journal of Infectious Diseases journal homepage: www.elsevier.com/locate/ijid

Prevalence of High risk Human Papillomavirus in cervical dysplasia and cancer samples from twin cities in Pakistan Sana Gul, Sheeba Murad *, Aneela Javed Health Care Biotechnology Department, Atta- ur- Rahman School of Applied Biosciences, National University of Sciences & Technology (NUST), Islamabad 44000, Pakistan

A R T I C L E I N F O

Article history: Received 5 December 2014 Received in revised form 15 February 2015 Accepted 22 February 2015 Corresponding Editor: Eskild Petersen, Aarhus, Denmark Keywords: Cervical cancer Pakistan human papillomavirus HPV16

S U M M A R Y

Introduction: Human Papilloma Virus (HPV) is small DNA virus mostly infecting mucosa and cutaneous keratinocytes. So far, more than 200 Human papillomaviruses are known. HPV have been divided into high- and low-risk on the basis of their oncogenic potential. High risk HPV is considered to be the main etiological cause for cervical cancer. Objective: The current study was designed to screen the local cervical cancer patients from the twin cities of Pakistan for the occurance of high risk HPV. Methodology: A total of 67 formalin fixed paraffin-embedded samples of cervical cancer biopsies were obtained from the government hospitals in Islamabad and Rawalpindi. Cervical cancer biopsies were examined for the presence of HPV DNA. Polymerase chain reaction (PCR) was used for the amplification of a region in the HPV-L1 gene for the general detection of the Papilloma virus and for the genotype specific detection of high risk HPV 16 and 18 using the GP5/GP6 primers and genotype specific primers, respectively. Results: HPV DNA was detected in 59 out of 67 samples analyzed. 30 samples showed the presence of HPV16 while 22 samples were positive for HPV18. HPV subtype could not be determined in 7 samples. Conclusion: Our results show a strong association between HPV infection and cervical cancer among women in twin cities of Pakistan. One way to minimize the disease burden in relation to HPV infection in Pakistani population is the use of prophylactic vaccines and routine screening. An early diagnosis of HPV infection will allow better health management to reduce the risk of developing cervical cancer. ß 2015 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).

1. Introduction Human Papilloma Virus (HPV) belongs to a large and diverse Papillomaviridae family of small, non enveloped DNA viruses.1 Several hundred species of Papilloma viruses, infecting a wide range of hosts ranging from mammals to birds and reptiles, have been identified so far. Infection of papilloma viruses in these species is either asymptomatic or causes warts or papillomas. The association between HPV infection and the development of cervical, anal, and genital lesions (abnormality in the tissue) and the cancers has been confirmed since 1976.2,3 HPV is the most common sexually transmitted virus in both men and women.4Over 200 different subtypes of HPV are known, and are differentiated on the basis of their genetic sequences.5 The majority of the types are

* Corresponding author. Tel.: +92-51-9085-6139. E-mail addresses: [email protected], [email protected] (S. Murad).

epitheliotropic infecting mucosa and cutaneous keratinocytes. Mucosal infecting HPV are further subdivided into low or high risk on the basis of their oncogenic potential. Low-risk HPV types lead to the development of benign neoplasms, such as warts and condyloma acuminatum, whereas high-risk HPV types infect the anogenital tract and lead to malignant neoplasms, such as cervical cancer.6,7 High-risk HPV strains such as HPV 16 and 18 causes about 70% of cervical cancers, while other high risk HPV genotypes show an association with more than 20% of cervical cancers globally.8–10 Low-risk HPV 6 and 11 cause about 90% of genital warts and benign neoplasm, which rarely develop into cancer.6,7 According to the International Agency for Research on Cancer (IARC-WHO), Cervical cancer is the fourth most common cancer in women, with an estimated 528,000 new cases and 266,000 deaths worldwide during 2012.11 The use of prophylactic vaccine and routine cervical testing through Papanicolaou testing (also commonly known as Pap smear testing) has resulted in a decrease in cervical cancer incidence by over 70 percent.

http://dx.doi.org/10.1016/j.ijid.2015.02.018 1201-9712/ß 2015 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

S. Gul et al. / International Journal of Infectious Diseases 34 (2015) 14–19

However, cervical cancer remains a leading cause of cancer related death for women in the developing countries.11,12 In Asia, cervical cancer is more widespread, where it records around half of the world’s new cases of cervical cancer each year. This situation could be related to the lack of access to the proper medical services and expensive vaccinations. Unfortunately not all cancer cases are registered, and that is why cancer is underestimated by 40 to 50 percent.13 Pakistan is a developing country, and HPV screening in Pakistan is normally not practiced. There is a lack of documented studies in relation to the HPV associated cervical cancer in local patients. For a very long time, there were no data regarding HPV prevalence in Pakistan. Recently, however, small regional studies indicating HPV prevalence have started to emerge, but they are not the true representation of the actual cervical cancer related disease burden. This is mainly because of the lack of an HPV program as a part of regular screening.14–16 According to Information center on HPV and cancer (ICO), cervical cancer in Pakistan ranks as the 3rd most frequent cancer among women, and every year 5233 women in Pakistan are diagnosed with cervical cancer, while 2876 die of the disease.17 Acquiring the data of HPV associated cervical cancer is essential in order to lower the burden of cervical cancer and to check the potential relevance of HPV vaccination. Therefore the aim of this study was to screen the local cervical cancer patients from twin cities of Pakistan for the prevalence of high risk HPV, i.e. subtypes 16 and 18.

2. Materials and methods 2.1. Sample collection Current study was planned and conducted at Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of science and technology Islamabad (NUST) Pakistan. The study was approved by Ethics Committee of NUST. A total of 67 formalin fixed paraffin-embedded cervical cancer biopsy samples reported from 2010 to 2013 were obtained from the government hospitals of Twin cities (Islamabad and Rawalpindi) including Pakistan Institute of Medical Sciences (PIMS), Holy Family and Railway General Hospital Rawalpindi. Informed consent was obtained from patients included in the study. PIMS hospital is one of the biggest hospital of the federal capital. The patients visiting the PIMS hospital are from various parts of the country, especially from Punjab and Khyber Pakhtun Khwa (KPK) province and symbolize various ethnicities and broad social backgrounds. Biopsy samples were histopathologically confirmed by histopathologists as squamous cell carcinoma, adenocarcinoma, cervical intraepithelial neoplasia I (CINI), cervical intraepithelial neoplasia II (CINII) or cervical intraepithelial neoplasia III (CINIII).

15

2.2. HPV detection through PCR DNA was extracted from paraffin embedded tissue samples. Paraffin embedded cervical cancer tissue biopsy sections 1015 mm thick were deparaffinized with xylene. Rehydration in graded ethanol was carried out as described by Wright and Manos.18 The extracted DNA was subjected to PCR. The consensus sequence of HPV L1 gene was amplified by using previously reported sets of primers GP5+/GP6+ that can detect up to 44 different HPV genotypes (Table 1).19 The PCR conditions for these primers were as follows; for primers GP5/GP6, the total 25 ml PCR reaction mixture contained 100 ng -200 ng of template DNA, 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 1 mM MgCl2, 200 mM deoxynucleotide triphosphates (dNTPs), 0.2 pmol of each primer, and 0.2 U of Taq polymerase. The PCR thermal profile was: 95 8C for 5 min, and 35 cycles of 94 8C for 30 s, 45 8C for 30 s, 72 8C for 30 s, and final extension of 5 min at 72 o C. PCR conditions for TS-16 and TS-18 primers were the same as for the GP primers, except that for TS-16 and TS-18 the annealing temperatures were 58 8C and 56 8C respectively. For beta globin primers, the PCR thermal profile was 94 8C for 5 min, and 35 cycles of 94 8C for 30 s, 55 8C for 30 s, 72 8C for 30 s, and 5 min final extension at 72 8C. 3. Results Cervical cancer biopsies from 67 patients were collected and were pathologically confirmed for cervical cancer by histopathologists. DNA was isolated from tissue samples. As an internal control for checking the quality of extracted DNA, b-globin gene was amplified through PCR. All the samples were first subjected to HPV DNA detection using consensus primers based on conserved region of L1 gene. The paraffin embedded biopsies were further screened for high risk HPV type 16 and 18 with the help of PCR. HPV type 16 was detected in 44.8% (30) of cervical cancer biopsies, while 32.8% (22) of cervical specimens were positive for HPV 18. 10.4% (7) of cervical specimens were positive for HPV but negative for type 16 or 18, whereas 11.9% (8) of cervical cancer biopsies were found to be HPV negative (Figure 1). Figure 2 represents the 2% Agrose gel showing amplified 150 bp region of L1 gene of HPV. Out of 67 formalin-fixed paraffinembedded cervical cancer samples 59 were found to be HPV positive. The 2% agarose gels for HPV type 16 and HPV type 18 are shown in Figure 3 and 4, respectively. The PCR product of 96 bp represents HPV type 16 (Figure 3) and 115 bp represents type 18 (Figure 4). The incidence of the HPV according to histopathological diagnosis (Table 2) revealed the prevalence of HPV 16 (42%) and 18% (45%) at comparable levels in squamous cell carcinoma of the cervix, while in adenocarcinoma HPV16 (50%) was more prevalent as compared to HPV 18 (38.8%). HPV16 was frequently found (87%)

Table 1 Oligonucleotide sequences used as primers for HPV Genotyping Primers

Primer sequence (50 -)

Target gene

Product size

Annealing temperature

Beta globin

FP- ACACAACTGTGTTCACTAGC RP- CAACTTCATCCACGTTCACC FP- TTTGTTACTGTGGTAGATAC RP- GAAAAATAAACTGTAAATCA FP- GGTCGGTGGACCGGTCGATG RP- GCAATGTAGGTGTATCTCCA FP- CCTTGGACGTAAATTTTTGG RP- CACGCACACGCTTGGCAGGT

b-globin gene

110 bp

558 C

L1

150 bp

458 C

L1

96 bp

588 C

L1

115 bp

568 C

GP 5/ GP6 TS16 TS18

Beta globin for b-globin gene, GP5/GP6, general primers for HPV; TS16-F/TS16-R for HPV subtype 16 and TS18-F/TS-18R for HPV subtype 18. TS; type specific, FP; forward primer, RP; reverse primer.

16

S. Gul et al. / International Journal of Infectious Diseases 34 (2015) 14–19

Figure 1. Distribution of HPV types 16 and 18 in cervical lesions. 59 out of 67 formalin-fixed paraffin-embedded cervical cancer samples were HPV positive. HPV type 16 was detected in 44.8% (30) of cervical cancer biopsies, and 32.8% (22) of cervical specimens were positive for HPV 18. 10.4% (7) samples were HPV positive but the HPV type could not be determined, whereas 11.9% (8) cervical cancer biopsies were found to be HPV negative.

Figure 2. PCR-based detection of HPV-DNA in cervical lesions. 2% Agarose gel showing 150bp long PCR product obtained by amplification of a region in L1 gene in HPV DNA by using GP5+/GP6+ consensus primers. Lane M shows 50 bp ladder. Sample numbers 1-5 are positive for HPV; lanes 6 and 7 show positive and negative control respectively.

Figure 3. PCR-based detection of HPV-16 in cervical lesions. 2% Agarose gel showing 96 bp long PCR product obtained by amplification of a region in L1 gene in HPV-16 by using type-specific primer pair (TS16). Lane M shows 50 bp ladder. Sample numbers 1-2 are positive for HPV16, Lane 3 shows negative control.

Figure 4. PCR-based detection of HPV-18 in cervical lesions. 2% Agarose gel showing 115bp long PCR product obtained by amplification of a region in L1 gene in HPV-18 by using type-specific primer pair (TS18). Lane M shows 50 bp ladder. Sample numbers 1-4 are positive for HPV18 with 115 bp, Lanes 5 & 6 show negative and positive control.

S. Gul et al. / International Journal of Infectious Diseases 34 (2015) 14–19 Table 2 HPV genotype distribution in women with cervical abnormalities HistoPathological Status

SCC Adenocarcinomas CIN1 CIN2 CIN3 Total

HPV genotypes

Table 3 Distribution of HPV genotype in different age groups Total HPV positive

16

18

untyped HPV

14 (42.42%) 9 (50%) 1(100%) 6 (100%) 30

15 (45.45%) 7 (38.88%) 22

4 (12.12%) 2 (11.11%) 1 (100%) 7

17

33 18 1 1 6 59

SCC; Squamous cell carcinoma, CIN; Cervical intraepithelial neoplasia.

in cervical intraepithelial neoplasia samples CINII CINIII. None of the pre-malignant samples were positive for HPV-18 (Figure 5). The distribution of HPV in different age groups is shown in Table 3 and Figure 6. The HPV induced cervical cancer rate is higher in the age group of 41-60 years. HPV 16 was found to be comparatively more prevalent than HPV 18 among the women aged between 21 and 60, while HPV 18 was found in patients older than 60. 4. Discussion Cervical cancer is the fourth most common malignancy among women worldwide.20 A wide range of regional diversity in the incidence of cervical cancer in different parts of the world is evident from several reports. Population-based cancer registries are a goldmine for calculating the cancer burden in a defined population. Unfortunately, these programs are either non-existent or are partially functional in most developing countries, thus preventing the estimation of actual disease burden.20 In the case of cervical cancer, the situation of inadequate health care facilities, lack of cancer registries, gynecological screening and HPV testing, is further compounded by additional factors such as socioeconomic issues, beliefs and culture that may prevent estimation of the actual disease burden.21 The conservative societies, morals, laws, and beliefs used by societies may protect against the spread of sexually transmitted disease but can equally make such issues taboo, resulting in under reporting. Hence there is no or very little data available to calculate the HPV-associated disease burden in Pakistani women.16 The cervical cancer incidence, although

Age Group

21-30 31-40 41-50 51-60 61-70 71-80 Unknown Total

HPV genotype

Total HPV positive

16

18

untyped HPV

1(50%) 4 (57.14%) 7 (50%) 12 (63.15%) 2 (25%) 1(100%) 3 (37.5%) 30

2 (28.57%) 5 (35.71%) 7 (36.84%) 3 (37.5%) 5 (62.5%) 22

1(50%) 1(14.28%) 2 (14.28%) 3 (37.5%) 7

2 7 14 19 8 1 8 59

difficult to assess precisely, is estimated to be low in Pakistan as compared to the rest of the world.20 The current data available on cervical cancer incidence and its association with HPV is the result of opportunistic cervical cancer screening in some parts of the country. Although, studies showing association of HPV in cervical cancer have started to emerge, there seems to be regional disparity regarding HPV genotype prevalence and its etiological role in cervical cancer in different parts of Pakistan, highlighting the essential need for further investigation.22–24 High-risk HPV infection accounts for more than 99% of cervical cancer cases and approximately 5 percent of all cancers worldwide.25 As a necessary factor for the development of cervical malignancies, high risk HPV is often found in the pre-malignant genital lesions.3,9 In order to establish HPV in the etiology of the local cervical cancers, the PCR-based method was used to detect HPV in pre-malignant and malignant lesions. HPV DNA was detected in 88% of all the cervical cancer samples and in all cervical intra-epithelial lesions (CINI-III). Genotype specific primers were used for the detection of high risk HPV subtypes HPV 16 (TS 16) and HPV18 (TS 18). HPV 16 was detected in 14/33, 9/18 and 7/8 of Squamous cell carcinoma (SCC), Adenocarcinoma and CIN cervical lesions respectively. HPV 18 was detected in 15/33, 7/18 of SCC, Adenocarcinoma samples. According to the International Association for Research in Cancer (IARC), the most prevalent high risk HPV genotypes found to be associated with cervical cancer are: HPV16 (53%), HPV18 (15%), HPV45 (9%), HPV31 (6%), and HPV33 (3%). HPV 16 was found to be universally common but HPV 18 was particularly common in South East Asian countries.26 Likewise, our

Figure 5. HPV genotype distribution among women according to histopathological diagnosis. The rate of SCC was higher and associated with HPV18, the incidence of CINI, CINII were low, and the incidence of Adenocarcinoma and CINIII was moderate and were associated with incidence of HPV16.

18

S. Gul et al. / International Journal of Infectious Diseases 34 (2015) 14–19

Figure 6. Distribution of HPV genotype in different age groups. The maximum rate of cervical cancer was found in age group 51-60, followed by the 41-50 and 31-40 age groups respectively. The rates of HPV16 & HPV18 were higher in age group 51-60.

data reports a higher prevalence of HPV 18 in comparison to that reported in other parts of the world. The current study shows the occurrence of HPV 16 and 18 in cervical lesions at a comparable rate. HPV 16 and 18 was detected in 42% and 45% of SCC and in 50% and 38.8% of Adenocarcinoma sections respectively. The seven HPV+ cervical cancer sections that were negative for HPV16 and 18 are predicted to harbour other high risk HPV subtypes. HPV DNA was not detectable in eight cervical cancer samples through the GP5/GP6 primer pair. Other studies carried out locally, likewise report a minor subpopulation with undetermined genotype (HPV16-/HPV18). Studies reporting the prevalence of high risk HPV subtypes other than HPV 16 and 18 are scarce in Pakistan. However, a study carried out in Karachi reported the presence of HPV45, HPV56, 59 and 33 in a minor subpopulation of Invasive cervical carcinoma (4.4%, 2.2%, 1.1% and 1.1%) evident of oncogenic HPV subtypes other than HPV 16 and 18.23 Major high risk HPV subtypes reported in neighbouring countries such as Saudi Arabia include: HPV 11, 33, 31, 39, 45, 51, 52, 53, 58, 59, 66, 68 and 73.28 HPV subtypes reported in Iran include; HPV 6, 11, 31, 33, 35,39, 42, 43, 44, 45,51, 52, 56, 58, 59, 66 and 68.29 Most of these studies, however, are based on normal or abnormal cervical cytology screening results obtained from women visiting the gynecologic institutes.28,29 As most HPV infections are self resolving, these subtypes do not represent the major oncogenic subtypes, as evident from the prevalence of HPV16 and 18 in most of the cervical cancer samples from Pakistan and its neighboring countries, including Iran and Saudi Arabia.30–38 Although most of the studies are in agreement, regional differences within Pakistan are evident. A study carried out in Karachi reported HPV prevalence in 18% of cervical cancer samples.27 This highlights the need for a systematic and large scale study based on multiple detection techniques. Most of the studies are based on HPV detection through GP5/GP6 primers which can detect forty four subtypes of HPV. It might be possible that HPV variants in Karachi are not detectable through this primer pair, which calls for a more detailed analysis of the local cervical cancer samples. Current data based on cervical cancer patients from the twin cities of Pakistan, however, show the effective use of GP5/GP6 primer pairs for the detection of HPV DNA in majority of samples (88%). A more detailed analysis is required for the 12% of cervical cancer samples found to be negative for HPV DNA through GP5/GP6 primers.

Intratypic sequence variation has been found in HPV early genes; E2, E4, E5, E6, and E7. These variations are reported to have functional significance, correlating with pathogenicity and oncogenicity of specific HPV variants.39 Intratypic sequence variation appears to vary geographically and also with the ethnic origin of the population. There are an inadequate number of reports regarding HPV 16 and 18 variants from this region of the world. Therefore, sequence analysis of HPV 16 and 18 positive samples is required to gain insight about the locally prevalent variants and for designing therapeutic strategies and disease management.40 Age plays an important role in cervical cancer. More than 50% of cervical cancer cases were in women aged between 41-60 years of age. A study carried out in 2010 reported overall low prevalence of HPV infection in the general population with no evidence of higher HPV prevalence in young women. HPV positivity was associated with factors such as women married to either an older man with history of partners, or who were in multiple relations.23 Therefore, the use of prophylactic vaccine by the susceptible population can reduce the disease burden. High costs of vaccine and lack of knowledge about the disease and its prevention are the biggest hurdles in its effective use. There is an urgent need for programs to educate people, even the health care staff.41 Based on these results, it can be concluded that there is a growing need for routine gynecological screening, HPV testing, and awareness programs in order to determine the HPV-related disease burden and its management. Dissemination of knowledge pertaining to the HPV related diseases, risk factors, and its prevention to all women is necessary to reduce the disease burden in future.41,42 Acknowledgments We are thankful to the Higher Education Commission of Pakistan and the recurring budget of ASAB provided by NUST for the financial support of this project. Conflict of interest: No conflict of interest is declared by the authors. References 1. Zur Hausen H. Papillomavirus infections: a major cause of human cancers. Biochim Biophy Acta 1996;1288:F55–78.

S. Gul et al. / International Journal of Infectious Diseases 34 (2015) 14–19 2. Burd EM. Human Papillomavirus and Cervical Cancer. Clinical Microbiology Reviews 2003;1–17. 3. Bosch FX, Lorincz A, Munoz NM, Meijer CJL, Shah KV. The causal relation between human papillomavirus and cervical cancer. J Clin Pathol 2002;55:244–65. 4. http://www.who.int/mediacentre/factsheets/fs380/en/. 5. Conway MJ, Meyers C. Replication and Assembly of Human Papillomaviruses. J Dent Res 2009;88(4):307–17. 6. De Villiers EM, Fauquet C, Broker TR, Bernard HU, Zur Hausen H. Classification of papillomaviruses. Virology 2004;324:17–27. 7. Longworth MS, Laimins LA. Pathogenesis of human papillomaviruses in differentiating epithelia. Microbial Mol Biol Rev 2004;68:362–72. 8. Walboomers JMM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of Invasive cancer worldwide. Journal of pathology 1999 September;189(Issue 1):12–9. 9. Lombard I, Vincent-Salomon A, Validire P, Zafrani B, de la Rochefordiere A, Clough K, et al. Human papillomavirus genotype as a major determinant of the course of cervical cancer. J Clin Oncol 1998;16(8):2613–9. 10. World Health Organization (WHO/ICO Information Centre on HPV and Cervical Cancer (HPV Information Centre) (2010) Human Papillomavirus and Related Cancers in World. Summary Report 2010 http://www.hpvcentre.net/statistics/ reports/XWX.pdf. 11. http://globocan.iarc.fr/Pages/fact_sheets_cancer.aspx?cancer=cervix. 12. de Sanjose S, Quint WG, Alemany L, Geraets DT, Klaustermeier JE, Retrospective International Survey, HPV Time Trends Study Group. Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study. Lancet Oncol 2010;11(11):1048–56. 13. Lyn TE. Cervical cancer underestimated in Asia: expert http://www.reuters. com/article/2007/11/06/us-cancercervixidUSHKG26266720071106MAY 05,2014. 14. Aziz Z, Sana S, Saeed S, Akram M. Institution based tumor registry from Punjab: five year data based analysis. J Pak Med Assoc 2003;53:350–3. 15. Badar F, Anwar N, Meerza F, Sultan F. ervical carcinoma in a Muslim community. Asian Pac J Cancer Prev 2007;8:24–6. 16. Bhurgri Y. arachi Cancer Registry Data–implications for the National Cancer Control Program of Pakistan. Asian Pac J Cancer Prev 2004;5:77–82. 17. http://www.hpvcentre.net/statistics/reports/PAK.pdf. 18. Wright DK and Manos MM. Sample preparation from paraffinembedded tissues, in Polymerase chain reaction protocols: a guide to methods and applications p. (Innis, M.A., D.H. Gelfand, and J.J. Sninsky andwhite, T.J.,ds.),Academic, Newyork 1990; pp.153–158. 19. Baay MF, Quint WG, Koudstaal J, Hollema H, Duk JM, Burger MP. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas. J Clin Microbiol 1996;3:745–7. 20. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. GLOBOCAN 2008, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 10 [Internet]. 2010. Lyon, France, International Agency for Research on Cancer, Available from: http://globocan.iarc.fr. [last accessed April 2012]. 21. Aniebue UU and Onyeka TC. Ethical, Socioeconomic, and Cultural Considerations in Gynecologic Cancer Care in Developing Countries. International Journal of Palliative Care Volume 2014 (2014), Article ID 141627, 6 pages http://dx.doi.org/10.1155/2014/141627. 22. Khan S, Jaffer NN, Khan MN, Rai MA, Shafiq M, Ali A, Pervez S, et al. Human papillomavirus subtype 16 is common in Pakistani women with cervical carcinoma. Int J Infect Dis 2007;11:313–7. 23. Raza SA, Franceschi S, Pallardy S, Malik FR, Avan BI, ZafarA. et al. Human papillomavirus infection in women with and without cervical cancer in Karachi, Pakistan. Br J Cancer 2010;102:1657–60. 24. Siddiqa A, Zainab M, Qadri I, Bhatti MF, Parish JL. Prevalence and Genotyping of High Risk Human Papillomavirus in Cervical Cancer Samples from Punjab, Pakistan. Viruses 2014;6(7):2762–77.

19

25. Parkin DM. The global health burden of infection-associated cancers in the year 2002. International Journal of Cancer 2006;118(12):3030–44. ˜ oz N. Human papillomavirus and cancer: the epidemiological evidence. J 26. Mun Clin Virol 2000 Oct;19(1-2):1–5. 27. Yousuf S, Syed S, Moazzam A, Lucky MH. Frequency of high risk human papillomavirus types in squamous cell carcinoma of cervix among women. Journal of Pakistan medical association 2010;60(3):103–96. 28. AlObaid A, Al-Badawi IA, Al-Kadri H, Gopala K, Kandeil W, Quint W, Al-Aker M, DeAntonio R. Human papillomavirus prevalence and type distribution among women attending routine gynecological examinations in Saudi Arabia. BMC Infect Dis 2014 Dec 14;14(1):643. 29. Yousefzadeh A, Mostafavizadeh SM, Jarollahi A, Raeisi M, Garshasbi M, Siavashvahabi Z, Moazzami B, Shafaghi B. Human papillomavirus (HPV) prevalence and types among women attending regular gynecological visit in Tehran, Iran. Clin Lab 2014;60(2):267–73. 30. Alsbeih G. HPV Infection in Cervical and Other Cancers in Saudi Arabia: Implication for Prevention and Vaccination. Front Oncol. 2014 Mar 31;4:65. http://dx.doi.org/10.3389/fonc.2014.00065. eCollection 2014. 31. Al-Ahdal MN1, Al-Arnous WK, Bohol MF, Abuzaid SM, Shoukri MM, Elrady KS, Firdous N, Aliyan R, Taseer R, Al-Hazzani AA, Al-Qahtani AA. Human papillomaviruses in cervical specimens of women residing in Riyadh, Saudi Arabia: a hospital-based study. Asian Pac J Cancer Prev 2013;14(5):3177–81. 32. Turki R1, Sait K, Anfinan N, Sohrab SS, Abuzenadah AM. Prevalence of human papillomavirus in women from Saudi Arabia. Asian Pac J Cancer Prev 2013;14(5):3177–81. 33. Jalilvand S1, Shoja Z, Hamkar R. Human papillomavirus burden in different cancers in Iran: a systematic assessment. Asian Pac J Cancer Prev 2014;15(17):7029–35. 34. Akcali S, Goker A, Ecemis T, Kandiloglu AR, Sanlidag T. Human Papilloma Virus Frequency and Genotype Distribution in a Turkish Population. Asian Pacific J Cancer Prev 2013;14(1):503–6. 35. Sait TK, Anfinan N, Sohrab SS, Abuzenadah AM. Prevalence of Human Papillomavirus in Women from Saudi ArabiaAsian Pacific Journal of Cancer Prevention 2013;14(5):3177–81. 36. Alsbeih G, Ahmed R, Al-Harbi N, Venturina LA, Tulbah A, Balaraj K. Prevalence and genotypes’ distribution of human papillomavirus in invasive cervical cancer in SaudiArabia. Gynecol Oncol 2011;121:522–6. 37. Ghaffari SR, Sabokbar T, Mollahajian H, Dastan J, Ramezanzadeh F, Ensani F, et al. Prevalence of Human papillomavirus genotypes in women with normal and abnormal cervical cytology in Iran. Asian Pac J Cancer Prev 2006;7:529–32. 38. Shahsiah R, Khademalhosseini M, Mehrdad N, Ramezani F, Nadji SA. Human papillomavirus genotypes in Iranian patients with cervical cancer. Pathol Res Pract 2011;207:754–7. 39. C Ka¨mmer, 1M Tommasino, 2 S Syrja¨nen, 3 H Delius, 2 U Hebling, 2 U Warthorst, 1 H Pfister, 1 and I Zehbe 2 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. Br J Cancer. 2002 Jan 21; 86(2): 269–273. http://dx.doi.org/10. 1038/sj.bjc.6600024. 40. Mohabatkar H. Prediction of epitopes and structural properties of Iranian HPV16 E6 by bioinformatics methods. Asian Pac J Cancer Prev 2007 OctDec;8(4):602–6. 41. Ali SF, Ayub S, Manzoor NF, Azim S, Afif M, Akhtar N, Jafery WA, Tahir I, Farid-UlHasnian S, Uddin N. Knowledge and awareness about cervical cancer and its prevention amongst interns and nursing staff in Tertiary Care Hospitals in Karachi, Pakistan. PLoS One 2010 Jun 10;5(6):e11059. http://dx.doi.org/ 10.1371/journal.pone.0011059. 42. Mulazim Hussain Bukhari, Muhammad Muddasar Majeed, Samina Naeem, Shahida Niazi, Samina Qamar, Kanwal Saba. Clinicopathological importance of Papanicolaou smears for the diagnosis of premalignant and malignant lesions of the cervix. Journal of Cytology, Vol. 29, No. 1, January-March, 2012, pp. 20–25