- Email: [email protected]
Prevalence of human cosavirus and saffold virus with an emergence of saffold virus genotype 6 in patients hospitalized with acute gastroenteritis in Chiang Mai, Thailand, 2014–2016
Infection, Genetics and Evolution 53 (2017) 1–6
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Research paper
Prevalence of human cosavirus and saffold virus with an emergence of saffold virus genotype 6 in patients hospitalized with acute gastroenteritis in Chiang Mai, Thailand, 2014–2016 Lucy Menage a,b, Arpaporn Yodmeeklin b, Pattara Khamrin b, Kattareeya Kumthip b, Niwat Maneekarn b,⁎ a b
Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand
a r t i c l e
i n f o
Article history: Received 20 March 2017 Received in revised form 2 May 2017 Accepted 7 May 2017 Available online 08 May 2017 Keywords: Cosavirus Saffold virus Gastroenteritis Saffold virus genotype 6 Thailand
a b s t r a c t Human cosavirus and saffold virus are both newly discovered members of the Picornaviridae family. It has been suggested that these viruses may be the causative agents of acute gastroenteritis. In this study, 1093 stool samples collected from patients with acute gastroenteritis between January 2014 and December 2016, were screened for cosavirus and saffold virus using reverse transcription-polymerase chain reaction. The viral genotypes were then established via nucleotide sequencing. Here, cosavirus was detected in 16 of 1093 stool samples (1.5%) and saffold virus was detected in 18 of 1093 stool samples (1.6%). The saffold virus genotypes 1 (16.7%), 2 (50%) and 6 (33.3%), and the cosavirus genetic groups A (87.5%), C (6.25%) and D (6.25%), were all identified across the three-year study period. Interestingly, saffold virus genotype 6 has now been detected for the first time in Thailand. The present study provides the prevalence of cosavirus and saffold virus with the emergence of saffold virus genotype 6 in Thailand. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Acute gastroenteritis is a common cause of morbidity and mortality worldwide and is responsible for an estimated 2.2 million deaths globally, which are most commonly occurring in infants aged 6–24 months (Dennehy, 2011). The cause of gastroenteritis can be from bacteria, but viruses are often the most common causative agents (Thongprachum et al., 2016). The viruses in the Picornaviridae family are comprised of 12 genera of both human and animal viruses (Adams et al., 2016). Cardiovirus is one genus of the Picornaviridae family that was previously believed to infect just rodents and pigs, but not humans (Blinkova et al., 2009). However, in 2007 a new member of the Cardiovirus genus, named saffold virus (SAFV), was isolated from an 8-month-old infant presenting with fever of unknown origin (FUO) in America (Jones et al., 2007). This suggests the existence of a human-specific Cardiovirus (Jones et al., 2007). Furthermore, in 2008 another member of the Picornaviridae family, human cosavirus, was identified (Kapoor et al., 2008). Human cosavirus (HCoSV), of the Cosavirus genus, was initially isolated from the stools of non-polio acute flaccid paralysis (AFP) cases and healthy children in Pakistan (Kapoor et al., 2008). Like all other members of the Picornaviridae family, HCoSV and SAFV both
⁎ Corresponding author. E-mail address: [email protected] (N. Maneekarn).
http://dx.doi.org/10.1016/j.meegid.2017.05.005 1567-1348/© 2017 Elsevier B.V. All rights reserved.
consist of a positive sense, single stranded ribonucleic acid (RNA) genome (Jones et al., 2007; Kapoor et al., 2008). The HCoSV genome is 7632 base pairs (bp) long and codes for seven non-structural proteins (2A, 2B, 2C,3A, 3B, 3C, 3D) and four structural proteins (VP1, VP2, VP3, VP4) (Kapoor et al., 2008). The SAFV genome is 7846 bp long with a single open reading frame (ORF) that also codes for four structural proteins (VP4, VP2, VP3, VP1) and seven non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C, 3D) (Jones et al., 2007). However, HCoSV has 6 genetic groups (A-F) and consists of more than 30 genotypes (Kapusinszky et al., 2012) whereas SAFV has 11 established genotypes (SAFV 1–11) (Naeem et al., 2014). HCoSV and SAFV both have a worldwide distribution. Both viruses have been detected in the stools of patients with acute gastroenteritis in several countries such as: Japan, China, Brazil, and Thailand; each reporting different prevalence rates and incidences of co-infection with other diarrhea-causing viruses (Chiu et al., 2008; Holtz et al., 2008; Ren et al., 2009; Dai et al., 2011; Khamrin et al., 2011; Stocker et al., 2012; Nielsen et al., 2013; Okitsu et al., 2014; Yodmeeklin et al., 2015). Previous studies have also found HCoSV in healthy controls (Dai et al., 2010). However, there have been instances of sole HCoSV and SAFV infection in acute gastroenteritis samples (Nielsen et al., 2013; Okitsu et al., 2014; Yodmeeklin et al., 2015). Therefore, it can be difficult to determine the pathogenicity of SAFV and HCoSV in acute gastroenteritis alone (Khamrin and Maneekarn, 2014; Khamrin et al., 2011). It is also important that the pathogenicity of HCoSV and SAFV
2
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
is established due to possible neurovirulence (Kotani et al., 2016; Zhang et al., 2015; Rezig et al., 2015). It is still crucial to screen for both viruses in order to gain a full understanding of their genetic diversity, the association with gastroenteritis and how the viruses are distributed globally. Therefore, the aim of this study is to screen for SAFV and HCoSV from pediatric patients who were admitted to hospitals with acute gastroenteritis in Chiang Mai, Thailand over the period of 2014–2016. Positive samples were further analyzed via genetic characterization to gain a deeper understanding of the different genotypes and prevalence of these two potentially harmful viruses.
conditions for multiplex PCR were as follows: 94 °C for 3 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min and followed by a final extension at 72 °C for 10 min. The second round of nested-PCR was then conducted separately for each virus. To detect SAFV, the primers CF204 and CR718 were used to amplify a 500 bp fragment. To detect HCoSV, the primers DKV-N5U-F2 and DKV-N5 U-R3 were used to amplify a 316 bp fragment. The thermal cycling conditions were the same as mentioned previously except for the annealing temperature for SAFV was 54 °C and the annealing temperature for HCoSV was 65 °C. All of the primer sequences are shown in Table 1.
2. Materials & methods
2.4. Sequence and phylogenetic analysis
2.1. Specimen collection
Amplification of HCoSV 5′UTR was achieved using the same primers and thermal cycling conditions as those for the HCoSV multiplex screening method mentioned above. The SAFV positive samples in this study were further analyzed via amplification of the partial viral protein 1 (VP1) via two rounds of nested-PCR using a combination of previously published primers (Itagaki et al., 2010). First round of amplification used the primers 315F and 738R and the second round of amplification used the primers 316F and 621R. The thermal cycling conditions for both rounds were as follows: 94 °C for 3 min followed by 40 cycles of 94 °C for 40 s, 50 °C for 40 s, 72 °C for 1 min, followed by a final extension at 72 °C for 10 min. All information for the primers used in amplification is shown in Table 1. All positive PCR products were purified using Geneaid Gel/PCR kit protocol (Geneaid, Tapei, Taiwan) and subsequently sequenced (First Base Laboratories SDNBHD Selangor Darul Ehsan, Malaysia). The sequences of HCoSV and SAFV were each separately compared with reference strains available in the NCBI GenBank database, using the BLAST server (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The selection of the reference sequences from the NCBI GenBank database was based on several criteria. Firstly, a few strains that were most closely related to our strain from BLAST results were selected as the reference strains. Secondly, the strains that were commonly used by other studies as the prototype strains for particular genotypes were also selected. Thirdly, the strains isolated from the same geographical area or from the countries in the same continent were included for our analysis. Multiple sequence alignment and sequence editing was performed by Clustal X (1.81) and Bioedit (v7.0.5.3). Phylogenetic trees were then constructed using the neighbour joining method via MEGA (v6.0) software (Tamura et al., 2013). The HCoSV phylogenetic tree was constructed using the maximum likelihood composite model with a bootstrap value of 1000. The SAFV phylogenetic tree was constructed using the Kimura 2-parameter model with a bootstrap value of 1000.
During the period of January 2014 to December 2016, a total of 1093 samples were collected from patients with acute gastroenteritis admitted to Nakhon Ping hospital, Maharaj Nakorn Chiang Mai hospital, and San Pa Tong hospital. Overall, 268 samples were collected in 2014, 335 samples were collected in 2015, and 490 samples were collected in 2016. The age of patients enrolled in this study ranged from neonate to 14 years old. The study was conducted with the approval of the Ethical Committee for Human Rights related to human experimentation, Faculty of Medicine, Chiang Mai University (MIC-2557-02710). The same set of fecal specimens were also screened for several other diarrhea-causing viruses, including rotavirus, adenovirus, norovirus, sapovirus, astrovirus, enterovirus, bocavirus, parechovirus, salivirus, and Aichivirus, using reverse transcription polymerase chain reaction (PCR), multiplex PCR, nested-PCR and nucleotide sequencing. 2.2. RNA extraction and reverse transcription The viral genome was extracted from the supernatant of 10% fecal suspension in phosphate buffered saline solution according to the manufacturer's instructions using the viral nucleic acid extraction kit II (Geneaid, Taipei, Taiwan). The RNA genome was then reverse transcribed into cDNA using the Thermo Scientific RevertAid Firststrand cDNA synthesis kit (Thermo Scientific, USA) and stored at −80 °C. 2.3. Multiplex PCR and nested PCR The cDNA was used as a template for PCR to detect both SAFV and HCoSV using a thermocycler machine (peqSTAR 96 universal, Isogen Life Science, Netherlands). The first round of PCR was multiplex and was for the screening of the SAFV and HCoSV 5′untranslated region (UTR) using a combination of previously published primers (Kapoor et al., 2008; Drexler et al., 2008). The primers DKV-N5U-F1 and DKVN5 U-R2 were used to detect HCoSV by amplifying a fragment size of 441 bp, whereas the primers CF188 and CR990 were used to detect SAFV by amplifying a fragment size of 800 bp. The thermal cycling
2.5. Accession numbers The nucleotide sequences of HCoSV and SAFV described in this study have been deposited in the GenBank database under the accession
Table 1 Description of primers used in this study for the screening and genotyping of SAFV and HCoSV. Virus
Primer Name
Primer nucleotide sequence
Orientation
Usage
Reference
HCoSV HCoSV SAFV SAFV SAFV SAFV HCoSV HCoSV SAFV SAFV SAFV SAFV
DKV-N5 U-F1 DKVN5 U-R2 CF188 CR990 CF204 CR718 DKV-N5 U-F2 DKV-N5 U-R3 315F 738R 316F 621R
CGTGCTTTACACGGTTTTTGA GTACCTTCAGGACATCTTTGG CTAATCAGAGGAAAGTCAGCAT GACCACTTGGTTTGGAGAAGCT CAGCATTTTCCGGCCCAGGCTAA GCTATTGTGAGGTCGCTACAGCTGT ACGGTTTTTGAACCCCACAC GTCCTTTCGGACAGGGCTTT HAARCARGRRYTGGARYTTYNTNATGTT DDGBCKDGGRCARUAVACYCTCAT AARCARGRYTGGARYTTYDTHATGTTYTC RRTRKKRAARTYNGMRDANCYRTTRAACCA
+ – + – + – + – + – + –
Multiplex PCR 1st round Multiplex PCR 1st round Multiplex PCR 1st round Multiplex PCR 1st round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 1st round Nested PCR 1st round Nested PCR 2nd round Nested PCR 2nd round
Kapoor et al., 2008 Kapoor et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Kapoor et al., 2008 Kapoor et al., 2008 Itagaki et al., 2010 Itagaki et al., 2010 Itagaki et al., 2010 Itagaki et al., 2010
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
3
Table 2 SAFV genotype, accession number and sample information detected in this study. SAFV strains
Date of specimen collection
Gender
Age
Genotype
Co-infected viruses
Genbank accession no.
CMH-S036-14 CMH-S057-14 CMH-N015-14 CMH-N054-14 CMH-N058-14 CMH-N060-14 CMH-N061-14 CMH-N081-14 CMH-N114-14 CMH-S080-15 CMH-S155-16 CMH-S166-16 CMH-S176-16 CMH-ST144-16 CMH-ST162-16 CMH-ST165-16 CMH-ST185-16 CMH-ST195-16
02/02/2014 16/05/2014 11/01/2014 16/01/2014 22/02/2014 26/02/2014 28/02/2014 13/03/2014 02/12/2014 23/04/2015 11/07/2016 11/07/2016 11/07/2016 18/06/2016 05/08/2016 13/08/2016 08/10/2016 23/11/2016
female male male male female female female female female male male male female female female male female male
1Y2M 2Y5M 1Y3M 1Y1M 9M 1Y2M 11 D 1Y 1Y4M 5Y2M 1Y3M 1Y3M 11 M 1Y8M 2Y8M 1 Y 11 M 1Y6M 2M
SAFV2 SAFV1 SAFV1 SAFV2 SAFV2 SAFV2 SAFV2 SAFV2 SAFV1 SAFV2 SAFV6 SAFV6 SAFV6 SAFV6 SAFV6 SAFV2 SAFV2 SAFV6
NoV EV
KY780428 KY780420 KY780422 KY780424 KY780427 KY780423 KY780426 KY780425 KY780421 KY780429 KY780434 KY780433 KY780435 KY780436 KY780432 KY780430 KY780431 KY780437
RVA RVA RVA RVA
EV NoV NoV, SaLV NoV
NoV = norovirus; EV = enterovirus; RVA = Group A rotavirus; SaLV = salivirus.
numbers: KY780404 - KY780419 for HCoSV, and KY780420 - KY780437 for SAFV. 3. Results Of 1093 stool samples tested, 18 (1.6%) were positive for SAFV (Table 2) and 16 (1.5%) were positive for HCoSV (Table 3). Prevalence of SAFV was found to be 3.4% (9 of 268) in 2014, 0.3% (1 of 335) in 2015, and 1.6% (8 of 490) in 2016. In addition, the prevalence of HCoSV was found to be 3.4% (9 of 268) in 2014, 1.2% (4 of 335) in 2015, and 0.6% (3 of 490) in 2016. SAFV positive cases were found in both males and females at a ratio of 4:5 and in HCoSV positive cases at a ratio of 5:3, respectively. SAFV was detected in patients with ages that ranged from 11 days to 5 years. However, SAFV prevalence was highest among patients aged 1–2 years old. HCoSV prevalence was more evenly spread affecting patients whose ages ranged from 2 months to 14 years nearly equally. The ages of two HCoSV samples (CMH-N07314 and CMH-N080-14) were unknown. Across the three years 2014– 2016, SAFV infection took place in virtually every month. Similarly, HCoSV infection also took place across every month. Among 18 SAFV positive samples, double or triple infections together with other diarrhea-causing viruses was found in 10 samples (55.6%), whilst 8 positive samples (44.4%) were found to have mono-infection with just SAFV. For HCoSV, among 16 positive cases, mono-infection occurred in 9 positive samples (56.2%), whilst co-infection with other diarrhea-causing viruses was found in 7 samples (43.8%). The multi-
infection in both SAFV and HCoSV samples were found to be in combination with other viruses that cause diarrhea such as rotavirus, norovirus and enterovirus. Some other viruses, including salivirus, adenovirus and bocavirus were also found to be co-infected with SAFV and HCoSV. The viruses were detected by reverse transcription polymerase chain reaction (PCR), multiplex PCR, nested-PCR and nucleotide sequencing methods. (Tables 2 and 3). 3.1. Phylogenetic analysis of SAFV Nucleotide sequencing was then performed on the VP1 region of the SAFV positive samples for further analysis. The VP1 region (218 nucleotides) was compared to 11 other established SAFV genotypes (SAFV 1 – SAFV 11). Of 9 SAFV positive samples detected in 2014, 3 belonged to the SAFV 1 genotype and the remaining 6 belonged to SAFV 2. The single SAFV sample detected in 2015 was also a member of the SAFV 2 genotype. Interestingly, most of the SAFV infection found in 2016 (6 of 8) belonged to the SAFV 6 genotype, which is the first time this has been documented in Thailand. The remaining 2 samples in 2016 belonged to SAFV 2. The phylogenetic tree showed that 6 SAFV samples identified in 2016 (CMH-S155-16, CMH-S166-16, CMH-S176-16, CMH-ST144-16, CMH-ST162-16 and CMH-ST195-16) were most closely related to SAFV 6 reference strains previously circulating in Japan (AB614366) with a nucleotide sequence identity ranging from 89.2–93.8% (Fig. 1). It was observed that the SAFV 1 genotypes identified in 2014 were classified in to two lineages. Two SAFV 1 strains (CMH-S057-14 and CMH-
Table 3 HCoSV genotype, accession number and sample information detected in this study. HCoSV strains
Date of specimen collection
Gender
Age
Genotype
CMH-S003-14 CMH-S005-14 CMH-S010-14 CMH-S020-14 CMH-S025-14 CMH-N008-14 CMH-N062-14 CMH-N073-14 CMH-N080–14 CMH-S002-15 CMH-S098-15 CMH-S135–15 CMH-N010-15 CMH-ST098-16 CMH-ST107-16 CMH-ST112-16
06/05/2014 06/05/2014 06/05/2014 02/02/2014 02/02/2014 08/01/2014 28/02/2014 13/03/2014 13/03/2014 16/01/2015 05/06/2015 15/06/2015 09/07/2015 23/03/2016 10/04/2016 13/04/2016
male male male female male female male female male female male female male male male female
2Y 5 M 1Y3M 2Y5M 9Y2M 14 Y 3 M 2M 3 Y 10 M unknown unknown 7Y3M 1Y8M 8M 4Y9M 3Y 7 M 1Y8M 6M
HCoSV A HCoSV A HCoSV A HCoSV A HCoSV D HCoSV A HCoSV A HCoSV A HCoSV A HCoSV A HCoSV C HCoSV A HCoSV A HCoSV A HCoSV A HCoSV A
NoV = norovirus; EV = enterovirus; RVA = Group A rotavirus; BoV = bocavirus; AdV = adenovirus.
Co-infected viruses RVA
NoV RVA RVA, EV AdV, EV, BoV EV EV
Genbank accession no. KY780414 KY780417 KY780415 KY780419 KY780404 KY780418 KY780412 KY780416 KY780413 KY780410 KY780405 KY780411 KY780409 KY780407 KY780406 KY780408
4
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
N114-14) were most closely related to reference strains previously reported from China (FJ586240, KT934407, KT934411, KT934410, KT934406) with a nucleotide sequence identity of 95.0–96.5%. The remaining SAFV 1 strain (CMH-N015-14) formed a cluster with a different reference strain found also in China (JX122400) with a nucleotide sequence identity of 91.1% (Fig. 1).
In addition, 9 of SAFV 2 strains detected in the present study were also split into two main lineages. Five of the SAFV 2 (CMH-N058-14, CMH-N061-14, CMH-N081-14, CMH-N060-14 and CMH-N054-14) formed a cluster with two reference strains previously reported from Chiang Mai, Thailand in 2013 (KJ941329, KJ941328), with a nucleotide sequence identity of 99.6–100%. Moreover, the other 4 SAFV2 strains (CMH-S036-14, CMH-S080-15, CMH-ST165-16 and CMH-ST185-16) were most closely related to the reference strains reported from China in 2009 and 2010 (KJ944641, KJ944677, KJ944706) with a nucleotide sequence identity ranging from 94.6–98.8% (Fig. 1). 3.2. Phylogenetic analysis of HCoSV Nucleotide sequencing was also performed on the 5′UTR region (267 nucleotides) of the HCoSV positive samples and compared with those of other HCoSV genetic groups (A–F). The phylogenetic tree (Fig. 2) demonstrated that almost all of HCoSV strains (14 of 16) detected in the present study belonged to HCoSV-A whilst one each belonged to HCoSV-C and HCoSV-D strains. The HCoSV-A positive samples were found to form three separate lineages. Four of the samples (CMH-ST112-16, CMH-ST107-16, CMHST098-16 and CMH-N010-15) were clustered with three reference strains reported from Brazil in 2009 (JN228128, JN228157, JN228158) with a nucleotide sequence identity ranging from 97.4–97.7%. The second cluster of HCoSV-A positive samples (CMH-S002-15, CMH-S13515 and CMH-S020-14) were also most closely related to a reference strain reported from Brazil (JN228161) with a nucleotide sequence identity ranging from 97.4–97.7%. Finally, the remaining 7 samples (CMH-S005-14, CMH-N008-14, CMH-N073-14, CMH-N080-14, CMHS003-14, CMH-N062-14 and CMH-S010-14) were closely related to reference strains from the Netherlands (KJ437124, KJ437116, KJ437125) with a nucleotide sequence identity ranging from 97.0–98.1%. In addition, these strains were also similar to the HCoSV-A previously isolated in Chiang Mai, Thailand (CMH-N199-11) with nucleotide sequence identity ranging from 97.4–97.7% (Fig. 2). The sole HCoSV-C (CMH-S098-15) was found to cluster with a 2009 reference strain from China (GU968215) with a nucleotide sequence identity of 93.3% (Fig. 2). The HCoSV-D (CMH-S025-14) was most closely related to a reference strain found in the Netherlands (KJ437122) with a nucleotide sequence identity of 96.6%; this strain was also similar to the HCoSV-D previously isolated in Chiang Mai, Thailand (CMHA172) with a nucleotide sequence identity of 96.3%. 4. Discussion
Fig. 1. Phylogenetic tree of SAFV based on alignments of the VP1 region. The tree was constructed using the neighbour joining method via the Kimura 2-parameter model with a bootstrap value of 1000 using MEGA 6.0 software.
SAFV and HCoSV are newly discovered viruses of the Picornaviridae family (Jones et al., 2007; Kapoor et al., 2008). The present study demonstrated that the prevalence of SAFV in acute gastroenteritis patients detected during 2014–2016 is relatively low at 1.6% (18 of 1093) which is comparable with a previous study conducted in Thailand in 2012–2013 where the prevalence of SAFV was 1.5% (Yodmeeklin et al., 2015). Even though the prevalence of HCoSV observed in the present study is also low (1.5%), it is relatively higher than HCoSV prevalence detected in Thailand previously in 2008 of 0.6% and in 2010–2011 of 0.2% (Khamrin et al., 2012; Khamrin and Maneekarn, 2014). Co-infections were noted in about 55% of SAFV samples and 44% of HCoSV. There are a wide range of gastroenteritis-causing viruses found to be in conjunction with SAFV and HCoSV, with the appearance of double or triple infections. It cannot be ruled out, therefore, that SAFV or HCoSV are not the causative agents of acute gastroenteritis in these samples and that the symptoms could have been caused instead by one, or a combination of the viruses present in those samples. However, about 45% of SAFV samples and 56% of HCoSV samples are mono-infected with the respective viruses, suggesting that SAFV or HCoSV alone could establish acute gastroenteritis.
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
5
Fig. 2. Phylogenetic tree of HCoSV based on alignments of the 5′ UTR region. The tree was constructed using the neighbour joining method via the maximum likelihood composite model with a bootstrap value of 1000 using MEGA 6.0 software.
It must be noted, however, that other similar studies investigating the prevalence of SAFV and HCoSV have also established the presence of both viruses in healthy control samples (Khamrin et al., 2013; Dai et al., 2010). It is instead possible that these viruses could just form part of the healthy human virome and other viruses may have been causative of the acute gastroenteritis, this may be the case as 40% of gastroenteritis cases are still unknown etiology (Holtz et al., 2008; Chiu et al., 2008). In addition, acute gastroenteritis is associated with high viral shedding but low levels of both viruses are detected in this study and in previous research (Stocker et al., 2012). The limitation of our study, therefore, is the lack of SAFV and HCoSV prevalence in a healthy control group. Previous studies have indicated that HCoSV has a seasonality of infection. The first detection of HCoSV in India also noted HCoSV infection to be highest from May–November and lowest in winter (Maan et al., 2013). However, this opposes the studies conducted in the USA and Japan which indicate the highest abundance of HCoSV to be in winter months (Haramoto and Otagiri, 2014; Kitajima et al., 2015). However, the studies conducted in Japan and the USA were done on wastewater and so HCoSV shed from asymptomatic individuals, as well as symptomatic individuals, may have indicated a different pattern (Kitajima
et al., 2015; Haramoto and Otagiri, 2014). Furthermore, a study conducted in Tunisia found HCoSV infection to be almost the same across all four seasons, suggesting that climatic factors have no effect on HCoSV infection. The present study detected no seasonality of infection with the positive samples being detected year-round. Therefore, the results from Tunisia and the present study suggest a continuous circulation of HCoSV (Rezig et al., 2015). Although, the findings in the present study could be attributed to very low prevalence rates making it difficult to detect a pattern of infection; if healthy control samples were included, a clear seasonality of infection could possibly have been apparent. The HCoSV genetic groups A and D have both been detected in Thailand in preceding years (Khamrin et al., 2012; Khamrin and Maneekarn, 2014). These genotypes seem to also be the dominant strains in Japan and China (Dai et al., 2010; Haramoto and Otagiri, 2014). Whilst HCoSV E was detected in Italy, HCoSV A, B, C and D in India and HCoSV C, D, E and F has been found in Africa (Campanini et al., 2013; Maan et al., 2013; Rezig et al., 2015). Concordant with previous strains circulating in Thailand, this study also detected HCoSV A and D. However, 1 HCoSV is found to cluster with a member of HCoSV C. The genetic group C of HCoSV is still an unconfirmed genotype due to lack of
6
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
sequencing data (Kapusinszky et al., 2012). To our knowledge, this is the first time a HCoSV species other than A or D has been detected in Thailand. SAFV strains 1–3 are the most commonly occurring worldwide and are related to both gastrointestinal and respiratory symptoms, the remaining strains SAFV 4–11 are more rarely identified (Blinkova et al., 2009). Indeed, the SAFV strains previously circulating in Thailand have been found to be SAFV 1, 2, 3 and the less common, SAFV 4 (Khamrin et al., 2011; Yodmeeklin et al., 2015). Most recently, SAFV 6 has been reported to circulate in China (Li et al., 2017) as well as Japan in the past (Itagaki et al., 2010). SAFV 6 is also implicated in causing tonsillitis (Itagaki et al., 2010). The present study, therefore, documents the emergence of SAFV genotype 6 in Thailand and suggests SAFV as being the possible cause of acute gastroenteritis. Further, SAFV 2 was found in one child with monosynaptic ataxia and in the blood, myocardium and cerebrospinal fluid of another child who had died (Nielsen et al., 2012). This indicates, therefore, that it is important to conduct further research in to the prevalence of SAFV as well as other related clinical symptoms such as neurovirulence. In conclusion, this study presents the current epidemiological data regarding the two viruses, HCoSV and SAFV, circulating in pediatric patients admitted to hospital with acute gastroenteritis in Chiang Mai, Thailand. The data indicates the emergence of SAFV genotype 6 for the first time in Thailand. Further epidemiological surveillance of SAFV and HCoSV is required to monitor the prevalence of these viruses. However, a comprehensive study which includes the analysis of healthy control samples is also recommended to help establish the clinical significance of SAFV and HCoSV; whether they are harmless viruses, or if they can be causative agents in acute gastroenteritis. Acknowledgments This research was jointly supported by the Center of Excellence (Emerging and Re-emerging Diarrheal Viruses Research Center), Chiang Mai University, Chiang Mai Thailand (grant number CoE2560). References Adams, M.J., Lefkowitz, E.J., King, A.M.Q., Harrach, B., Harrison, R.L., Knowles, N.J., Kropinski, A.M., Krupovic, M., Kuhn, J.H., Mushegian, A.R., Nibert, M., Sabanadzovic, S., Sanfaçon, H., Siddell, S.G., Simmonds, P., Varsani, A., Zerbini, F.M., Gorbalenya, A.E., Davison, A.J., 2016. Ratification vote on taxonomic proposals to the international committee on taxonomy of viruses. Arch. Virol. 161, 2921–2949. Blinkova, O., Kapoor, A., Victoria, J., Jones, M., Wolfe, N., Naeem, A., Shaukat, S., Sharif, S., Alam, M.M., Angez, M., Zaidi, S., Delwart, E.L., 2009. Cardioviruses are genetically diverse and cause common enteric infections in south Asian children. J. Virol. 83, 4631–4641. Campanini, G., Rovida, F., Meloni, F., Cascina, A., Ciccocioppo, R., Piralla, A., Baldanti, F., 2013. Persistent human Cosavirus infection in lung transplant recipient Italy. Emerg. Infect. Dis. 19, 1667–1669. Chiu, C.Y., Greninger, A.L., Kanada, K., Kwok, T., Fischer, K.F., Runckel, C., Louie, J.K., Glaser, C.A., Yagi, S., Schnurr, D.P., Haggerty, T.D., Parsonnet, J., Ganem, D., DeRisi, J.L., 2008. Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections. Proc. Natl. Acad. Sci. U. S. A. 105, 14124–14129. Dai, X.Q., Hua, X.G., Shan, T.L., Delwart, E., Zhao, W., 2010. Human cosavirus infections in children in China. J. Clin. Virol. 48, 228–229. Dai, X.Q., Yuan, C.L., Yu, Y., Zhao, W., Yang, Z.B., Cui, L., Hua, X.G., 2011. Molecular detection of Saffold virus in children in Shanghai, China. J. Clin. Virol. 50, 186–187. Dennehy, P.H., 2011. Viral gastroenteritis in children. Pediatr. Infect. Dis. J. 30, 63–64. Drexler, J.F., Luna, L.K.D., Stocker, A., Almeida, P.S., Ribeiro, T.C.M., Petersen, N., Herzog, P., Pedroso, C., Huppertz, H.I., Ribeiro, H.D., Baumgarte, S., Drosten, C., 2008. Circulation of 3 lineages of a novel Saffold cardiovirus in humans. Emerg. Infect. Dis. 14, 1398–1405. Haramoto, E., Otagiri, M., 2014. Occurrence of human Cosavirus in wastewater and river water in Japan. Food Environ. Virol. 6, 62–66.
Holtz, L.R., Finkbeiner, S.R., Kirkwood, C.D., Wang, D., 2008. Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea. Virol. J. 5. http://dx.doi. org/10.1186/1743-422X-5-159. Itagaki, T., Abiko, C., Ikeda, T., Aoki, Y., Seto, J., Mizuta, K., Ahiko, T., Tsukagoshi, H., Nagano, M., Noda, M., Mizutani, T., Kimura, H., 2010. Sequence and phylogenetic analyses of Saffold cardiovirus from children with exudative tonsillitis in Yamagata Japan. Scand. J. Infect. Dis. 42, 950–952. Jones, M.S., Lukashov, V.V., Ganac, R.D., Schnurr, D.P., 2007. Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J. Clin. Microbiol. 45, 2144–2150. Kapoor, A., Victoria, J., Simmonds, P., Slikas, E., Chieochansin, T., Naeem, A., Shaukat, S., Sharif, S., Alam, M.M., Angez, M., Wang, C.L., Shafer, R.W., Zaidi, S., Delwart, E., 2008. A highly prevalent and genetically diversified Picornaviridae genus in South Asian children. Proc. Natl. Acd. Sci. U. S. A. 105, 20482–20487. Kapusinszky, B., Phan, T.G., Kapoor, A., Delwart, E., 2012. Genetic diversity of the genus Cosavirus in the family Picornaviridae: a new species, recombination, and 26 new genotypes. PLoS One 7, 5. Khamrin, P., Maneekarn, N., 2014. Detection and genetic characterization of cosavirus in a pediatric patient with diarrhea. Arch. Virol. 159, 2485–2489. Khamrin, P., Chaimongkol, N., Nantachit, N., Okitsu, S., Ushijima, H., Maneekarn, N., 2011. Saffold Cardioviruses in children with diarrhea Thailand. Emerg. Infect. Dis. 17, 1150–1152. Khamrin, P., Chaimongkol, N., Malasao, R., Suantai, B., Saikhruang, W., Kongsricharoern, T., Ukarapol, N., Okitsu, S., Shimizu, H., Hayakawa, S., Ushijima, H., Maneekarn, N., 2012. Detection and molecular characterization of cosavirus in adults with diarrhea Thailand. Virus Genes 44, 244–246. Khamrin, P., Thongprachum, A., Kikuta, H., Yamamoto, A., Nishimura, S., Sugita, K., Baba, T., Kobayashi, M., Okitsu, S., Hayakawa, S., Shimizu, H., Maneekarn, N., Ushijima, H., 2013. Three clusters of Saffold viruses circulating in children with diarrhea in Japan. Infect. Genet. Evol. 13, 339–343. Kitajima, M., Rachmadi, A.T., Iker, B.C., Haramoto, E., Pepper, I.L., Gerba, C.P., 2015. Occurrence and genetic diversity of human cosavirus in influent and effluent of wastewater treatment plants in Arizona, United States. Arch. Virol. 160, 1775–1779. Kotani, O., Naeem, A., Suzuki, T., Iwata-Yoshikawa, N., Sato, Y., Nakajima, N., Hosomi, T., Tsukagoshi, H., Kozawa, K., Hasegawa, H., Taguchi, F., Shmizu, H., Nagata, N., 2016. Neuropathogenicity of two saffold virus type 3 isolates in mouse models. PLoS One 11, e0148184. Li, L.-L., Liu, N., Yu, J.-M., Ao, Y.-Y., Li, S., Stine, O.C., Duan, Z.-J., 2017. Analysis of Aichi virus and Saffold virus association with pediatric acute gastroenteritis. J. Clin. Virol. 87, 37–42. Maan, H.S., Chowdhary, R., Shakya, A.K., Dhole, T.N., 2013. Genetic diversity of cosaviruses in nonpolio acute flaccid paralysis cases of undefined etiology, Northern India, 2010– 2011. J. Clin. Virol. 58, 183–187. Naeem, A., Hosomi, T., Nishimura, Y., Alam, M.M., Oka, T., Zaidi, S.S., Shimizu, H., 2014. Genetic diversity of circulating Saffold viruses in Pakistan and Afghanistan. J. Gen. Virol. 95, 1945–1957. Nielsen, A.C.Y., Bottiger, B., Banner, J., Hoffmann, T., Nielsen, L.P., 2012. Serious invasive Saffold virus infections in children, 2009. Emerg. Infect. Dis. 18, 7–12. Nielsen, A.C.Y., Gyhrs, M.L., Nielsen, L.P., Pedersen, C., Bottiger, B., 2013. Gastroenteritis and the novel picornaviruses aichi virus, cosavirus, saffold virus, and salivirus in young children. J. Clin. Virol. 57, 239–242. Okitsu, S., Khamrin, P., Thongprachum, A., Nishimura, S., Kalesaran, A.F.C., Takanashi, S., Shimizu, H., Hayakawa, S., Mizuguchi, M., Ushijima, H., 2014. Detection and molecular characterization of human cosavirus in a pediatric patient with acute gastroenteritis, Japan. Infect. Genet. Evol. 28, 125–129. Ren, L.L., Gonzalez, R., Xiao, Y., Xu, X.W., Chen, L., Vernet, G., Paranhos-Baccala, G., Jin, Q., Wang, J.W., 2009. Saffold Cardiovirus in children with acute gastroenteritis, Beijing China. Emerg. Infect. Dis. 15, 1509–1511. Rezig, D., Ben Farhat, E., Touzi, H., Meddeb, Z., Ben Salah, A., Triki, H., 2015. Prevalence of human Cosaviruses in Tunisia, North Africa. J. Med. Virol. 87, 940–943. Stocker, A., Souza, B., Ribeiro, T.C.M., Netto, E.M., Araujo, L.O., Correa, J.I., Almeida, P.S., de Mattos, A.P., Ribeiro, H.D., Pedral-Sampaio, D.B., Drosten, C., Drexler, J.F., 2012. Cosavirus infection in persons with and without gastroenteritis, Brazil. Emerg. Infect. Dis. 18, 656–659. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis Version 6.0. Mol. Biol. Evol. 30, 2725–2729. Thongprachum, A., Khamrin, P., Maneekarn, N., Hayakawa, S., Ushijima, H., 2016. Epidemiology of gastroenteritis viruses in Japan: prevalence, seasonality, and outbreak. J. Med. Virol. 88, 551–570. Yodmeeklin, A., Khamrin, P., Chuchaona, W., Saikruang, W., Malasao, R., Chaimongkol, N., Kongsricharoern, T., Ukarapol, N., Maneekarn, N., 2015. Saffold viruses in pediatric patients with diarrhea in Thailand. J. Med. Virol. 87, 702–707. Zhang, X.A., Lu, Q.B., Wo, Y., Zhao, J., Huang, D.D., Guo, C.T., Xu, H.M., Liu, E.M., Liu, W., Cao, W.C., 2015. Prevalence and genetic characteristics of Saffold cardiovirus in China from 2009 to 2012. Sci. Rep. 5, 7704.
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Research paper
Prevalence of human cosavirus and saffold virus with an emergence of saffold virus genotype 6 in patients hospitalized with acute gastroenteritis in Chiang Mai, Thailand, 2014–2016 Lucy Menage a,b, Arpaporn Yodmeeklin b, Pattara Khamrin b, Kattareeya Kumthip b, Niwat Maneekarn b,⁎ a b
Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand
a r t i c l e
i n f o
Article history: Received 20 March 2017 Received in revised form 2 May 2017 Accepted 7 May 2017 Available online 08 May 2017 Keywords: Cosavirus Saffold virus Gastroenteritis Saffold virus genotype 6 Thailand
a b s t r a c t Human cosavirus and saffold virus are both newly discovered members of the Picornaviridae family. It has been suggested that these viruses may be the causative agents of acute gastroenteritis. In this study, 1093 stool samples collected from patients with acute gastroenteritis between January 2014 and December 2016, were screened for cosavirus and saffold virus using reverse transcription-polymerase chain reaction. The viral genotypes were then established via nucleotide sequencing. Here, cosavirus was detected in 16 of 1093 stool samples (1.5%) and saffold virus was detected in 18 of 1093 stool samples (1.6%). The saffold virus genotypes 1 (16.7%), 2 (50%) and 6 (33.3%), and the cosavirus genetic groups A (87.5%), C (6.25%) and D (6.25%), were all identified across the three-year study period. Interestingly, saffold virus genotype 6 has now been detected for the first time in Thailand. The present study provides the prevalence of cosavirus and saffold virus with the emergence of saffold virus genotype 6 in Thailand. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Acute gastroenteritis is a common cause of morbidity and mortality worldwide and is responsible for an estimated 2.2 million deaths globally, which are most commonly occurring in infants aged 6–24 months (Dennehy, 2011). The cause of gastroenteritis can be from bacteria, but viruses are often the most common causative agents (Thongprachum et al., 2016). The viruses in the Picornaviridae family are comprised of 12 genera of both human and animal viruses (Adams et al., 2016). Cardiovirus is one genus of the Picornaviridae family that was previously believed to infect just rodents and pigs, but not humans (Blinkova et al., 2009). However, in 2007 a new member of the Cardiovirus genus, named saffold virus (SAFV), was isolated from an 8-month-old infant presenting with fever of unknown origin (FUO) in America (Jones et al., 2007). This suggests the existence of a human-specific Cardiovirus (Jones et al., 2007). Furthermore, in 2008 another member of the Picornaviridae family, human cosavirus, was identified (Kapoor et al., 2008). Human cosavirus (HCoSV), of the Cosavirus genus, was initially isolated from the stools of non-polio acute flaccid paralysis (AFP) cases and healthy children in Pakistan (Kapoor et al., 2008). Like all other members of the Picornaviridae family, HCoSV and SAFV both
⁎ Corresponding author. E-mail address: [email protected] (N. Maneekarn).
http://dx.doi.org/10.1016/j.meegid.2017.05.005 1567-1348/© 2017 Elsevier B.V. All rights reserved.
consist of a positive sense, single stranded ribonucleic acid (RNA) genome (Jones et al., 2007; Kapoor et al., 2008). The HCoSV genome is 7632 base pairs (bp) long and codes for seven non-structural proteins (2A, 2B, 2C,3A, 3B, 3C, 3D) and four structural proteins (VP1, VP2, VP3, VP4) (Kapoor et al., 2008). The SAFV genome is 7846 bp long with a single open reading frame (ORF) that also codes for four structural proteins (VP4, VP2, VP3, VP1) and seven non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C, 3D) (Jones et al., 2007). However, HCoSV has 6 genetic groups (A-F) and consists of more than 30 genotypes (Kapusinszky et al., 2012) whereas SAFV has 11 established genotypes (SAFV 1–11) (Naeem et al., 2014). HCoSV and SAFV both have a worldwide distribution. Both viruses have been detected in the stools of patients with acute gastroenteritis in several countries such as: Japan, China, Brazil, and Thailand; each reporting different prevalence rates and incidences of co-infection with other diarrhea-causing viruses (Chiu et al., 2008; Holtz et al., 2008; Ren et al., 2009; Dai et al., 2011; Khamrin et al., 2011; Stocker et al., 2012; Nielsen et al., 2013; Okitsu et al., 2014; Yodmeeklin et al., 2015). Previous studies have also found HCoSV in healthy controls (Dai et al., 2010). However, there have been instances of sole HCoSV and SAFV infection in acute gastroenteritis samples (Nielsen et al., 2013; Okitsu et al., 2014; Yodmeeklin et al., 2015). Therefore, it can be difficult to determine the pathogenicity of SAFV and HCoSV in acute gastroenteritis alone (Khamrin and Maneekarn, 2014; Khamrin et al., 2011). It is also important that the pathogenicity of HCoSV and SAFV
2
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
is established due to possible neurovirulence (Kotani et al., 2016; Zhang et al., 2015; Rezig et al., 2015). It is still crucial to screen for both viruses in order to gain a full understanding of their genetic diversity, the association with gastroenteritis and how the viruses are distributed globally. Therefore, the aim of this study is to screen for SAFV and HCoSV from pediatric patients who were admitted to hospitals with acute gastroenteritis in Chiang Mai, Thailand over the period of 2014–2016. Positive samples were further analyzed via genetic characterization to gain a deeper understanding of the different genotypes and prevalence of these two potentially harmful viruses.
conditions for multiplex PCR were as follows: 94 °C for 3 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min and followed by a final extension at 72 °C for 10 min. The second round of nested-PCR was then conducted separately for each virus. To detect SAFV, the primers CF204 and CR718 were used to amplify a 500 bp fragment. To detect HCoSV, the primers DKV-N5U-F2 and DKV-N5 U-R3 were used to amplify a 316 bp fragment. The thermal cycling conditions were the same as mentioned previously except for the annealing temperature for SAFV was 54 °C and the annealing temperature for HCoSV was 65 °C. All of the primer sequences are shown in Table 1.
2. Materials & methods
2.4. Sequence and phylogenetic analysis
2.1. Specimen collection
Amplification of HCoSV 5′UTR was achieved using the same primers and thermal cycling conditions as those for the HCoSV multiplex screening method mentioned above. The SAFV positive samples in this study were further analyzed via amplification of the partial viral protein 1 (VP1) via two rounds of nested-PCR using a combination of previously published primers (Itagaki et al., 2010). First round of amplification used the primers 315F and 738R and the second round of amplification used the primers 316F and 621R. The thermal cycling conditions for both rounds were as follows: 94 °C for 3 min followed by 40 cycles of 94 °C for 40 s, 50 °C for 40 s, 72 °C for 1 min, followed by a final extension at 72 °C for 10 min. All information for the primers used in amplification is shown in Table 1. All positive PCR products were purified using Geneaid Gel/PCR kit protocol (Geneaid, Tapei, Taiwan) and subsequently sequenced (First Base Laboratories SDNBHD Selangor Darul Ehsan, Malaysia). The sequences of HCoSV and SAFV were each separately compared with reference strains available in the NCBI GenBank database, using the BLAST server (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The selection of the reference sequences from the NCBI GenBank database was based on several criteria. Firstly, a few strains that were most closely related to our strain from BLAST results were selected as the reference strains. Secondly, the strains that were commonly used by other studies as the prototype strains for particular genotypes were also selected. Thirdly, the strains isolated from the same geographical area or from the countries in the same continent were included for our analysis. Multiple sequence alignment and sequence editing was performed by Clustal X (1.81) and Bioedit (v7.0.5.3). Phylogenetic trees were then constructed using the neighbour joining method via MEGA (v6.0) software (Tamura et al., 2013). The HCoSV phylogenetic tree was constructed using the maximum likelihood composite model with a bootstrap value of 1000. The SAFV phylogenetic tree was constructed using the Kimura 2-parameter model with a bootstrap value of 1000.
During the period of January 2014 to December 2016, a total of 1093 samples were collected from patients with acute gastroenteritis admitted to Nakhon Ping hospital, Maharaj Nakorn Chiang Mai hospital, and San Pa Tong hospital. Overall, 268 samples were collected in 2014, 335 samples were collected in 2015, and 490 samples were collected in 2016. The age of patients enrolled in this study ranged from neonate to 14 years old. The study was conducted with the approval of the Ethical Committee for Human Rights related to human experimentation, Faculty of Medicine, Chiang Mai University (MIC-2557-02710). The same set of fecal specimens were also screened for several other diarrhea-causing viruses, including rotavirus, adenovirus, norovirus, sapovirus, astrovirus, enterovirus, bocavirus, parechovirus, salivirus, and Aichivirus, using reverse transcription polymerase chain reaction (PCR), multiplex PCR, nested-PCR and nucleotide sequencing. 2.2. RNA extraction and reverse transcription The viral genome was extracted from the supernatant of 10% fecal suspension in phosphate buffered saline solution according to the manufacturer's instructions using the viral nucleic acid extraction kit II (Geneaid, Taipei, Taiwan). The RNA genome was then reverse transcribed into cDNA using the Thermo Scientific RevertAid Firststrand cDNA synthesis kit (Thermo Scientific, USA) and stored at −80 °C. 2.3. Multiplex PCR and nested PCR The cDNA was used as a template for PCR to detect both SAFV and HCoSV using a thermocycler machine (peqSTAR 96 universal, Isogen Life Science, Netherlands). The first round of PCR was multiplex and was for the screening of the SAFV and HCoSV 5′untranslated region (UTR) using a combination of previously published primers (Kapoor et al., 2008; Drexler et al., 2008). The primers DKV-N5U-F1 and DKVN5 U-R2 were used to detect HCoSV by amplifying a fragment size of 441 bp, whereas the primers CF188 and CR990 were used to detect SAFV by amplifying a fragment size of 800 bp. The thermal cycling
2.5. Accession numbers The nucleotide sequences of HCoSV and SAFV described in this study have been deposited in the GenBank database under the accession
Table 1 Description of primers used in this study for the screening and genotyping of SAFV and HCoSV. Virus
Primer Name
Primer nucleotide sequence
Orientation
Usage
Reference
HCoSV HCoSV SAFV SAFV SAFV SAFV HCoSV HCoSV SAFV SAFV SAFV SAFV
DKV-N5 U-F1 DKVN5 U-R2 CF188 CR990 CF204 CR718 DKV-N5 U-F2 DKV-N5 U-R3 315F 738R 316F 621R
CGTGCTTTACACGGTTTTTGA GTACCTTCAGGACATCTTTGG CTAATCAGAGGAAAGTCAGCAT GACCACTTGGTTTGGAGAAGCT CAGCATTTTCCGGCCCAGGCTAA GCTATTGTGAGGTCGCTACAGCTGT ACGGTTTTTGAACCCCACAC GTCCTTTCGGACAGGGCTTT HAARCARGRRYTGGARYTTYNTNATGTT DDGBCKDGGRCARUAVACYCTCAT AARCARGRYTGGARYTTYDTHATGTTYTC RRTRKKRAARTYNGMRDANCYRTTRAACCA
+ – + – + – + – + – + –
Multiplex PCR 1st round Multiplex PCR 1st round Multiplex PCR 1st round Multiplex PCR 1st round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 2nd round Nested PCR 1st round Nested PCR 1st round Nested PCR 2nd round Nested PCR 2nd round
Kapoor et al., 2008 Kapoor et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Drexler et al., 2008 Kapoor et al., 2008 Kapoor et al., 2008 Itagaki et al., 2010 Itagaki et al., 2010 Itagaki et al., 2010 Itagaki et al., 2010
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
3
Table 2 SAFV genotype, accession number and sample information detected in this study. SAFV strains
Date of specimen collection
Gender
Age
Genotype
Co-infected viruses
Genbank accession no.
CMH-S036-14 CMH-S057-14 CMH-N015-14 CMH-N054-14 CMH-N058-14 CMH-N060-14 CMH-N061-14 CMH-N081-14 CMH-N114-14 CMH-S080-15 CMH-S155-16 CMH-S166-16 CMH-S176-16 CMH-ST144-16 CMH-ST162-16 CMH-ST165-16 CMH-ST185-16 CMH-ST195-16
02/02/2014 16/05/2014 11/01/2014 16/01/2014 22/02/2014 26/02/2014 28/02/2014 13/03/2014 02/12/2014 23/04/2015 11/07/2016 11/07/2016 11/07/2016 18/06/2016 05/08/2016 13/08/2016 08/10/2016 23/11/2016
female male male male female female female female female male male male female female female male female male
1Y2M 2Y5M 1Y3M 1Y1M 9M 1Y2M 11 D 1Y 1Y4M 5Y2M 1Y3M 1Y3M 11 M 1Y8M 2Y8M 1 Y 11 M 1Y6M 2M
SAFV2 SAFV1 SAFV1 SAFV2 SAFV2 SAFV2 SAFV2 SAFV2 SAFV1 SAFV2 SAFV6 SAFV6 SAFV6 SAFV6 SAFV6 SAFV2 SAFV2 SAFV6
NoV EV
KY780428 KY780420 KY780422 KY780424 KY780427 KY780423 KY780426 KY780425 KY780421 KY780429 KY780434 KY780433 KY780435 KY780436 KY780432 KY780430 KY780431 KY780437
RVA RVA RVA RVA
EV NoV NoV, SaLV NoV
NoV = norovirus; EV = enterovirus; RVA = Group A rotavirus; SaLV = salivirus.
numbers: KY780404 - KY780419 for HCoSV, and KY780420 - KY780437 for SAFV. 3. Results Of 1093 stool samples tested, 18 (1.6%) were positive for SAFV (Table 2) and 16 (1.5%) were positive for HCoSV (Table 3). Prevalence of SAFV was found to be 3.4% (9 of 268) in 2014, 0.3% (1 of 335) in 2015, and 1.6% (8 of 490) in 2016. In addition, the prevalence of HCoSV was found to be 3.4% (9 of 268) in 2014, 1.2% (4 of 335) in 2015, and 0.6% (3 of 490) in 2016. SAFV positive cases were found in both males and females at a ratio of 4:5 and in HCoSV positive cases at a ratio of 5:3, respectively. SAFV was detected in patients with ages that ranged from 11 days to 5 years. However, SAFV prevalence was highest among patients aged 1–2 years old. HCoSV prevalence was more evenly spread affecting patients whose ages ranged from 2 months to 14 years nearly equally. The ages of two HCoSV samples (CMH-N07314 and CMH-N080-14) were unknown. Across the three years 2014– 2016, SAFV infection took place in virtually every month. Similarly, HCoSV infection also took place across every month. Among 18 SAFV positive samples, double or triple infections together with other diarrhea-causing viruses was found in 10 samples (55.6%), whilst 8 positive samples (44.4%) were found to have mono-infection with just SAFV. For HCoSV, among 16 positive cases, mono-infection occurred in 9 positive samples (56.2%), whilst co-infection with other diarrhea-causing viruses was found in 7 samples (43.8%). The multi-
infection in both SAFV and HCoSV samples were found to be in combination with other viruses that cause diarrhea such as rotavirus, norovirus and enterovirus. Some other viruses, including salivirus, adenovirus and bocavirus were also found to be co-infected with SAFV and HCoSV. The viruses were detected by reverse transcription polymerase chain reaction (PCR), multiplex PCR, nested-PCR and nucleotide sequencing methods. (Tables 2 and 3). 3.1. Phylogenetic analysis of SAFV Nucleotide sequencing was then performed on the VP1 region of the SAFV positive samples for further analysis. The VP1 region (218 nucleotides) was compared to 11 other established SAFV genotypes (SAFV 1 – SAFV 11). Of 9 SAFV positive samples detected in 2014, 3 belonged to the SAFV 1 genotype and the remaining 6 belonged to SAFV 2. The single SAFV sample detected in 2015 was also a member of the SAFV 2 genotype. Interestingly, most of the SAFV infection found in 2016 (6 of 8) belonged to the SAFV 6 genotype, which is the first time this has been documented in Thailand. The remaining 2 samples in 2016 belonged to SAFV 2. The phylogenetic tree showed that 6 SAFV samples identified in 2016 (CMH-S155-16, CMH-S166-16, CMH-S176-16, CMH-ST144-16, CMH-ST162-16 and CMH-ST195-16) were most closely related to SAFV 6 reference strains previously circulating in Japan (AB614366) with a nucleotide sequence identity ranging from 89.2–93.8% (Fig. 1). It was observed that the SAFV 1 genotypes identified in 2014 were classified in to two lineages. Two SAFV 1 strains (CMH-S057-14 and CMH-
Table 3 HCoSV genotype, accession number and sample information detected in this study. HCoSV strains
Date of specimen collection
Gender
Age
Genotype
CMH-S003-14 CMH-S005-14 CMH-S010-14 CMH-S020-14 CMH-S025-14 CMH-N008-14 CMH-N062-14 CMH-N073-14 CMH-N080–14 CMH-S002-15 CMH-S098-15 CMH-S135–15 CMH-N010-15 CMH-ST098-16 CMH-ST107-16 CMH-ST112-16
06/05/2014 06/05/2014 06/05/2014 02/02/2014 02/02/2014 08/01/2014 28/02/2014 13/03/2014 13/03/2014 16/01/2015 05/06/2015 15/06/2015 09/07/2015 23/03/2016 10/04/2016 13/04/2016
male male male female male female male female male female male female male male male female
2Y 5 M 1Y3M 2Y5M 9Y2M 14 Y 3 M 2M 3 Y 10 M unknown unknown 7Y3M 1Y8M 8M 4Y9M 3Y 7 M 1Y8M 6M
HCoSV A HCoSV A HCoSV A HCoSV A HCoSV D HCoSV A HCoSV A HCoSV A HCoSV A HCoSV A HCoSV C HCoSV A HCoSV A HCoSV A HCoSV A HCoSV A
NoV = norovirus; EV = enterovirus; RVA = Group A rotavirus; BoV = bocavirus; AdV = adenovirus.
Co-infected viruses RVA
NoV RVA RVA, EV AdV, EV, BoV EV EV
Genbank accession no. KY780414 KY780417 KY780415 KY780419 KY780404 KY780418 KY780412 KY780416 KY780413 KY780410 KY780405 KY780411 KY780409 KY780407 KY780406 KY780408
4
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
N114-14) were most closely related to reference strains previously reported from China (FJ586240, KT934407, KT934411, KT934410, KT934406) with a nucleotide sequence identity of 95.0–96.5%. The remaining SAFV 1 strain (CMH-N015-14) formed a cluster with a different reference strain found also in China (JX122400) with a nucleotide sequence identity of 91.1% (Fig. 1).
In addition, 9 of SAFV 2 strains detected in the present study were also split into two main lineages. Five of the SAFV 2 (CMH-N058-14, CMH-N061-14, CMH-N081-14, CMH-N060-14 and CMH-N054-14) formed a cluster with two reference strains previously reported from Chiang Mai, Thailand in 2013 (KJ941329, KJ941328), with a nucleotide sequence identity of 99.6–100%. Moreover, the other 4 SAFV2 strains (CMH-S036-14, CMH-S080-15, CMH-ST165-16 and CMH-ST185-16) were most closely related to the reference strains reported from China in 2009 and 2010 (KJ944641, KJ944677, KJ944706) with a nucleotide sequence identity ranging from 94.6–98.8% (Fig. 1). 3.2. Phylogenetic analysis of HCoSV Nucleotide sequencing was also performed on the 5′UTR region (267 nucleotides) of the HCoSV positive samples and compared with those of other HCoSV genetic groups (A–F). The phylogenetic tree (Fig. 2) demonstrated that almost all of HCoSV strains (14 of 16) detected in the present study belonged to HCoSV-A whilst one each belonged to HCoSV-C and HCoSV-D strains. The HCoSV-A positive samples were found to form three separate lineages. Four of the samples (CMH-ST112-16, CMH-ST107-16, CMHST098-16 and CMH-N010-15) were clustered with three reference strains reported from Brazil in 2009 (JN228128, JN228157, JN228158) with a nucleotide sequence identity ranging from 97.4–97.7%. The second cluster of HCoSV-A positive samples (CMH-S002-15, CMH-S13515 and CMH-S020-14) were also most closely related to a reference strain reported from Brazil (JN228161) with a nucleotide sequence identity ranging from 97.4–97.7%. Finally, the remaining 7 samples (CMH-S005-14, CMH-N008-14, CMH-N073-14, CMH-N080-14, CMHS003-14, CMH-N062-14 and CMH-S010-14) were closely related to reference strains from the Netherlands (KJ437124, KJ437116, KJ437125) with a nucleotide sequence identity ranging from 97.0–98.1%. In addition, these strains were also similar to the HCoSV-A previously isolated in Chiang Mai, Thailand (CMH-N199-11) with nucleotide sequence identity ranging from 97.4–97.7% (Fig. 2). The sole HCoSV-C (CMH-S098-15) was found to cluster with a 2009 reference strain from China (GU968215) with a nucleotide sequence identity of 93.3% (Fig. 2). The HCoSV-D (CMH-S025-14) was most closely related to a reference strain found in the Netherlands (KJ437122) with a nucleotide sequence identity of 96.6%; this strain was also similar to the HCoSV-D previously isolated in Chiang Mai, Thailand (CMHA172) with a nucleotide sequence identity of 96.3%. 4. Discussion
Fig. 1. Phylogenetic tree of SAFV based on alignments of the VP1 region. The tree was constructed using the neighbour joining method via the Kimura 2-parameter model with a bootstrap value of 1000 using MEGA 6.0 software.
SAFV and HCoSV are newly discovered viruses of the Picornaviridae family (Jones et al., 2007; Kapoor et al., 2008). The present study demonstrated that the prevalence of SAFV in acute gastroenteritis patients detected during 2014–2016 is relatively low at 1.6% (18 of 1093) which is comparable with a previous study conducted in Thailand in 2012–2013 where the prevalence of SAFV was 1.5% (Yodmeeklin et al., 2015). Even though the prevalence of HCoSV observed in the present study is also low (1.5%), it is relatively higher than HCoSV prevalence detected in Thailand previously in 2008 of 0.6% and in 2010–2011 of 0.2% (Khamrin et al., 2012; Khamrin and Maneekarn, 2014). Co-infections were noted in about 55% of SAFV samples and 44% of HCoSV. There are a wide range of gastroenteritis-causing viruses found to be in conjunction with SAFV and HCoSV, with the appearance of double or triple infections. It cannot be ruled out, therefore, that SAFV or HCoSV are not the causative agents of acute gastroenteritis in these samples and that the symptoms could have been caused instead by one, or a combination of the viruses present in those samples. However, about 45% of SAFV samples and 56% of HCoSV samples are mono-infected with the respective viruses, suggesting that SAFV or HCoSV alone could establish acute gastroenteritis.
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
5
Fig. 2. Phylogenetic tree of HCoSV based on alignments of the 5′ UTR region. The tree was constructed using the neighbour joining method via the maximum likelihood composite model with a bootstrap value of 1000 using MEGA 6.0 software.
It must be noted, however, that other similar studies investigating the prevalence of SAFV and HCoSV have also established the presence of both viruses in healthy control samples (Khamrin et al., 2013; Dai et al., 2010). It is instead possible that these viruses could just form part of the healthy human virome and other viruses may have been causative of the acute gastroenteritis, this may be the case as 40% of gastroenteritis cases are still unknown etiology (Holtz et al., 2008; Chiu et al., 2008). In addition, acute gastroenteritis is associated with high viral shedding but low levels of both viruses are detected in this study and in previous research (Stocker et al., 2012). The limitation of our study, therefore, is the lack of SAFV and HCoSV prevalence in a healthy control group. Previous studies have indicated that HCoSV has a seasonality of infection. The first detection of HCoSV in India also noted HCoSV infection to be highest from May–November and lowest in winter (Maan et al., 2013). However, this opposes the studies conducted in the USA and Japan which indicate the highest abundance of HCoSV to be in winter months (Haramoto and Otagiri, 2014; Kitajima et al., 2015). However, the studies conducted in Japan and the USA were done on wastewater and so HCoSV shed from asymptomatic individuals, as well as symptomatic individuals, may have indicated a different pattern (Kitajima
et al., 2015; Haramoto and Otagiri, 2014). Furthermore, a study conducted in Tunisia found HCoSV infection to be almost the same across all four seasons, suggesting that climatic factors have no effect on HCoSV infection. The present study detected no seasonality of infection with the positive samples being detected year-round. Therefore, the results from Tunisia and the present study suggest a continuous circulation of HCoSV (Rezig et al., 2015). Although, the findings in the present study could be attributed to very low prevalence rates making it difficult to detect a pattern of infection; if healthy control samples were included, a clear seasonality of infection could possibly have been apparent. The HCoSV genetic groups A and D have both been detected in Thailand in preceding years (Khamrin et al., 2012; Khamrin and Maneekarn, 2014). These genotypes seem to also be the dominant strains in Japan and China (Dai et al., 2010; Haramoto and Otagiri, 2014). Whilst HCoSV E was detected in Italy, HCoSV A, B, C and D in India and HCoSV C, D, E and F has been found in Africa (Campanini et al., 2013; Maan et al., 2013; Rezig et al., 2015). Concordant with previous strains circulating in Thailand, this study also detected HCoSV A and D. However, 1 HCoSV is found to cluster with a member of HCoSV C. The genetic group C of HCoSV is still an unconfirmed genotype due to lack of
6
L. Menage et al. / Infection, Genetics and Evolution 53 (2017) 1–6
sequencing data (Kapusinszky et al., 2012). To our knowledge, this is the first time a HCoSV species other than A or D has been detected in Thailand. SAFV strains 1–3 are the most commonly occurring worldwide and are related to both gastrointestinal and respiratory symptoms, the remaining strains SAFV 4–11 are more rarely identified (Blinkova et al., 2009). Indeed, the SAFV strains previously circulating in Thailand have been found to be SAFV 1, 2, 3 and the less common, SAFV 4 (Khamrin et al., 2011; Yodmeeklin et al., 2015). Most recently, SAFV 6 has been reported to circulate in China (Li et al., 2017) as well as Japan in the past (Itagaki et al., 2010). SAFV 6 is also implicated in causing tonsillitis (Itagaki et al., 2010). The present study, therefore, documents the emergence of SAFV genotype 6 in Thailand and suggests SAFV as being the possible cause of acute gastroenteritis. Further, SAFV 2 was found in one child with monosynaptic ataxia and in the blood, myocardium and cerebrospinal fluid of another child who had died (Nielsen et al., 2012). This indicates, therefore, that it is important to conduct further research in to the prevalence of SAFV as well as other related clinical symptoms such as neurovirulence. In conclusion, this study presents the current epidemiological data regarding the two viruses, HCoSV and SAFV, circulating in pediatric patients admitted to hospital with acute gastroenteritis in Chiang Mai, Thailand. The data indicates the emergence of SAFV genotype 6 for the first time in Thailand. Further epidemiological surveillance of SAFV and HCoSV is required to monitor the prevalence of these viruses. However, a comprehensive study which includes the analysis of healthy control samples is also recommended to help establish the clinical significance of SAFV and HCoSV; whether they are harmless viruses, or if they can be causative agents in acute gastroenteritis. Acknowledgments This research was jointly supported by the Center of Excellence (Emerging and Re-emerging Diarrheal Viruses Research Center), Chiang Mai University, Chiang Mai Thailand (grant number CoE2560). References Adams, M.J., Lefkowitz, E.J., King, A.M.Q., Harrach, B., Harrison, R.L., Knowles, N.J., Kropinski, A.M., Krupovic, M., Kuhn, J.H., Mushegian, A.R., Nibert, M., Sabanadzovic, S., Sanfaçon, H., Siddell, S.G., Simmonds, P., Varsani, A., Zerbini, F.M., Gorbalenya, A.E., Davison, A.J., 2016. Ratification vote on taxonomic proposals to the international committee on taxonomy of viruses. Arch. Virol. 161, 2921–2949. Blinkova, O., Kapoor, A., Victoria, J., Jones, M., Wolfe, N., Naeem, A., Shaukat, S., Sharif, S., Alam, M.M., Angez, M., Zaidi, S., Delwart, E.L., 2009. Cardioviruses are genetically diverse and cause common enteric infections in south Asian children. J. Virol. 83, 4631–4641. Campanini, G., Rovida, F., Meloni, F., Cascina, A., Ciccocioppo, R., Piralla, A., Baldanti, F., 2013. Persistent human Cosavirus infection in lung transplant recipient Italy. Emerg. Infect. Dis. 19, 1667–1669. Chiu, C.Y., Greninger, A.L., Kanada, K., Kwok, T., Fischer, K.F., Runckel, C., Louie, J.K., Glaser, C.A., Yagi, S., Schnurr, D.P., Haggerty, T.D., Parsonnet, J., Ganem, D., DeRisi, J.L., 2008. Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections. Proc. Natl. Acad. Sci. U. S. A. 105, 14124–14129. Dai, X.Q., Hua, X.G., Shan, T.L., Delwart, E., Zhao, W., 2010. Human cosavirus infections in children in China. J. Clin. Virol. 48, 228–229. Dai, X.Q., Yuan, C.L., Yu, Y., Zhao, W., Yang, Z.B., Cui, L., Hua, X.G., 2011. Molecular detection of Saffold virus in children in Shanghai, China. J. Clin. Virol. 50, 186–187. Dennehy, P.H., 2011. Viral gastroenteritis in children. Pediatr. Infect. Dis. J. 30, 63–64. Drexler, J.F., Luna, L.K.D., Stocker, A., Almeida, P.S., Ribeiro, T.C.M., Petersen, N., Herzog, P., Pedroso, C., Huppertz, H.I., Ribeiro, H.D., Baumgarte, S., Drosten, C., 2008. Circulation of 3 lineages of a novel Saffold cardiovirus in humans. Emerg. Infect. Dis. 14, 1398–1405. Haramoto, E., Otagiri, M., 2014. Occurrence of human Cosavirus in wastewater and river water in Japan. Food Environ. Virol. 6, 62–66.
Holtz, L.R., Finkbeiner, S.R., Kirkwood, C.D., Wang, D., 2008. Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea. Virol. J. 5. http://dx.doi. org/10.1186/1743-422X-5-159. Itagaki, T., Abiko, C., Ikeda, T., Aoki, Y., Seto, J., Mizuta, K., Ahiko, T., Tsukagoshi, H., Nagano, M., Noda, M., Mizutani, T., Kimura, H., 2010. Sequence and phylogenetic analyses of Saffold cardiovirus from children with exudative tonsillitis in Yamagata Japan. Scand. J. Infect. Dis. 42, 950–952. Jones, M.S., Lukashov, V.V., Ganac, R.D., Schnurr, D.P., 2007. Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J. Clin. Microbiol. 45, 2144–2150. Kapoor, A., Victoria, J., Simmonds, P., Slikas, E., Chieochansin, T., Naeem, A., Shaukat, S., Sharif, S., Alam, M.M., Angez, M., Wang, C.L., Shafer, R.W., Zaidi, S., Delwart, E., 2008. A highly prevalent and genetically diversified Picornaviridae genus in South Asian children. Proc. Natl. Acd. Sci. U. S. A. 105, 20482–20487. Kapusinszky, B., Phan, T.G., Kapoor, A., Delwart, E., 2012. Genetic diversity of the genus Cosavirus in the family Picornaviridae: a new species, recombination, and 26 new genotypes. PLoS One 7, 5. Khamrin, P., Maneekarn, N., 2014. Detection and genetic characterization of cosavirus in a pediatric patient with diarrhea. Arch. Virol. 159, 2485–2489. Khamrin, P., Chaimongkol, N., Nantachit, N., Okitsu, S., Ushijima, H., Maneekarn, N., 2011. Saffold Cardioviruses in children with diarrhea Thailand. Emerg. Infect. Dis. 17, 1150–1152. Khamrin, P., Chaimongkol, N., Malasao, R., Suantai, B., Saikhruang, W., Kongsricharoern, T., Ukarapol, N., Okitsu, S., Shimizu, H., Hayakawa, S., Ushijima, H., Maneekarn, N., 2012. Detection and molecular characterization of cosavirus in adults with diarrhea Thailand. Virus Genes 44, 244–246. Khamrin, P., Thongprachum, A., Kikuta, H., Yamamoto, A., Nishimura, S., Sugita, K., Baba, T., Kobayashi, M., Okitsu, S., Hayakawa, S., Shimizu, H., Maneekarn, N., Ushijima, H., 2013. Three clusters of Saffold viruses circulating in children with diarrhea in Japan. Infect. Genet. Evol. 13, 339–343. Kitajima, M., Rachmadi, A.T., Iker, B.C., Haramoto, E., Pepper, I.L., Gerba, C.P., 2015. Occurrence and genetic diversity of human cosavirus in influent and effluent of wastewater treatment plants in Arizona, United States. Arch. Virol. 160, 1775–1779. Kotani, O., Naeem, A., Suzuki, T., Iwata-Yoshikawa, N., Sato, Y., Nakajima, N., Hosomi, T., Tsukagoshi, H., Kozawa, K., Hasegawa, H., Taguchi, F., Shmizu, H., Nagata, N., 2016. Neuropathogenicity of two saffold virus type 3 isolates in mouse models. PLoS One 11, e0148184. Li, L.-L., Liu, N., Yu, J.-M., Ao, Y.-Y., Li, S., Stine, O.C., Duan, Z.-J., 2017. Analysis of Aichi virus and Saffold virus association with pediatric acute gastroenteritis. J. Clin. Virol. 87, 37–42. Maan, H.S., Chowdhary, R., Shakya, A.K., Dhole, T.N., 2013. Genetic diversity of cosaviruses in nonpolio acute flaccid paralysis cases of undefined etiology, Northern India, 2010– 2011. J. Clin. Virol. 58, 183–187. Naeem, A., Hosomi, T., Nishimura, Y., Alam, M.M., Oka, T., Zaidi, S.S., Shimizu, H., 2014. Genetic diversity of circulating Saffold viruses in Pakistan and Afghanistan. J. Gen. Virol. 95, 1945–1957. Nielsen, A.C.Y., Bottiger, B., Banner, J., Hoffmann, T., Nielsen, L.P., 2012. Serious invasive Saffold virus infections in children, 2009. Emerg. Infect. Dis. 18, 7–12. Nielsen, A.C.Y., Gyhrs, M.L., Nielsen, L.P., Pedersen, C., Bottiger, B., 2013. Gastroenteritis and the novel picornaviruses aichi virus, cosavirus, saffold virus, and salivirus in young children. J. Clin. Virol. 57, 239–242. Okitsu, S., Khamrin, P., Thongprachum, A., Nishimura, S., Kalesaran, A.F.C., Takanashi, S., Shimizu, H., Hayakawa, S., Mizuguchi, M., Ushijima, H., 2014. Detection and molecular characterization of human cosavirus in a pediatric patient with acute gastroenteritis, Japan. Infect. Genet. Evol. 28, 125–129. Ren, L.L., Gonzalez, R., Xiao, Y., Xu, X.W., Chen, L., Vernet, G., Paranhos-Baccala, G., Jin, Q., Wang, J.W., 2009. Saffold Cardiovirus in children with acute gastroenteritis, Beijing China. Emerg. Infect. Dis. 15, 1509–1511. Rezig, D., Ben Farhat, E., Touzi, H., Meddeb, Z., Ben Salah, A., Triki, H., 2015. Prevalence of human Cosaviruses in Tunisia, North Africa. J. Med. Virol. 87, 940–943. Stocker, A., Souza, B., Ribeiro, T.C.M., Netto, E.M., Araujo, L.O., Correa, J.I., Almeida, P.S., de Mattos, A.P., Ribeiro, H.D., Pedral-Sampaio, D.B., Drosten, C., Drexler, J.F., 2012. Cosavirus infection in persons with and without gastroenteritis, Brazil. Emerg. Infect. Dis. 18, 656–659. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis Version 6.0. Mol. Biol. Evol. 30, 2725–2729. Thongprachum, A., Khamrin, P., Maneekarn, N., Hayakawa, S., Ushijima, H., 2016. Epidemiology of gastroenteritis viruses in Japan: prevalence, seasonality, and outbreak. J. Med. Virol. 88, 551–570. Yodmeeklin, A., Khamrin, P., Chuchaona, W., Saikruang, W., Malasao, R., Chaimongkol, N., Kongsricharoern, T., Ukarapol, N., Maneekarn, N., 2015. Saffold viruses in pediatric patients with diarrhea in Thailand. J. Med. Virol. 87, 702–707. Zhang, X.A., Lu, Q.B., Wo, Y., Zhao, J., Huang, D.D., Guo, C.T., Xu, H.M., Liu, E.M., Liu, W., Cao, W.C., 2015. Prevalence and genetic characteristics of Saffold cardiovirus in China from 2009 to 2012. Sci. Rep. 5, 7704.