Prevalence of mixed infection by different hepatitis C virus genotypes in patients with hepatitis C virus–related chronic liver disease

Prevalence, of mixed infection by different hepatitis C virus genotypes in patients with hepatitis C virus-related chronic liver disease CARLO GIANNINI, FRANCESCA GIANNELLI, MONICA MONTI, GRAZIA CARECCIA, MARIA EUGENIA MARROCCHI, GIACOMO LAFFI, PAOLO GENTILINI, and ANNA LINDA ZIGNEGO FLORENCE, ITALY

Multiple infection by different hepatitis C virus (HCV) genotypes may be of great clinico-pathologic interest. In this study we determined the effective prevalence of coinfections by two or more HCV genotypes in 213 subjects with HCV-positive chronic hepatitis by using genotype-specific polymerase chain reaction (PCR), genotype-specific probe hybridization, and direct sequencing. The most prevalent genotype was HCV-Ib (54%). HCV-2 (a/c) was also prevalent (27%), and types la and 3a were found in 5% and 3% of patients, respectively. A mixed infection was detected in 23 patients (10.8%): 4 out of 23 were coinfected by types la + I b, while the remaining 19 patients had a Ib + 2 (a/c) mixed infection. Further analysis based on restriction fragment length polymorphism (RFLP) on type-specific PCR products was used to verify genotyping results. Only four coinfections ( l a + Ib in 2 patients and I b + 2 (a/c) in the remaining 2 patients, respectively) were confirmed by enzyme cleavage. All patients with true coinfection had long-lasting infection and liver cirrhosis. Both true and false mixed infections resulting from RFLPanalysis were confirmed by direct sequencing of type-specific amplification products. We also determined a recurrent C/T transversion at position 618 in all sequenced samples. In 4 cases another point mutation (G/A at position 626) was found, reducing the number of mismatches between HCV-2 and HCV-Ib from 4 to 3 (or 2). Interestingly, all HCV-2 isolates sequenced showed the highest degree of nucleotide homology with HCV-2 subtype c, confirming the relatively high prevalence of this subtype in Italy. In conclusion, we showed the possibility of multiple infection by different HCV types in the general population of chronically infected patients without particular risk factors, even if in a low percentage of cases. Further studies are needed to assess the clinical relevance of chronic HCV infection with multiple genotypes. (J Lab Clin Med 1999;134:68-73)

Abbreviations: cDNA = complementary deoxyribonucleic acid; HCV = hepatitis C virus; IVDA = intravenous drug abuse; PCR = polymerase chain reQction; RFLP = restriction fragment length polymorphism

From the Institute of Internal Medicine, University of Florence School of Medicine. Supported by the Istituto Superiore di SanitY,the Research Project on Viral Hepatitis, MURST,AIRC, the Italian Liver Foundation,and the FondazioneIstituto di RicercaVirologicaO.B. Corsi. Submitted for publicationMarch 9, 1998; revision submittedFebruary 15, 1999; accepted March 11, 1999. Reprint requests: Anna Linda Zignego, MD, PhD, Department of Internal Medicine, University of Florence, Viale Morgagni, 85, 150134, Florence,Italy. Copyright © 1999 by Mosby, Inc. 0022-2143/99 $8.00 + 0 5/1/98445 68

A

fter performing molecular cloning and sequencing of HCV, several authors reported a significant genetic heterogeneity among isolates from different geographic areas and even within isolates from the same subject. On the basis of sequence homology, HCV isolates worldwide have been classified into genotypes and subtypes, and the existence of clinically relevant differences between infections by different HCV types has been suggested. 1,2 After initial confusion caused by several classifications presented by different groups, 3-6 a consensus nomenclature has

J Lab Clin Med Volume 134, Number 1

been p r o p o s e d to unify into at least six m a j o r classes the several isolates collected worldwide. 7 Several techniques for H C V genotype determination have been proposed to bypass sequencing, which is still c o n s i d e r e d the gold standard but at the same time is expensive, time-consuming, and inconvenient for routine use. Genotype-specific primer PCR, first described by Okamoto et al, 8 is one of the most popular genotyping methods and has been demonstrated to be effective and reliable in detecting the five most represented H C V types. This method, when separate PCR reactions are carried out for each type-specific p r i m e r - - a s we did in the current i n v e s t i g a t i o n - - i s also sensitive in detecting coinfections or superinfections by heterogeneous HCV strains in the same sample, whereas other c o m m o n l y used techniques, based on universal primer PCR, could define only the dominant circulating viral population. The p o s s i b i l i t y that m o r e than one H C V g e n o t y p e m a y coinfect the same patient has been described. 9,to This m a y have i m p o r t a n t pathogenetic and clinical implications, e s p e c i a l l y b e c a u s e coinfected patients seem to experience increased liver d a m a g e 10 and b e c a u s e multiple infection b y more than one viral strand could be an important factor in acute exacerbation of chronic type C hepatitis.11 However, discordant data exist concerning the real prevalence and meaning o f this finding, especially in the general population of chronically infected patients without particular risk factors (IVDA, hemodialysis, polytransfusion), which suggests that methodologic factors may influence results. The aim of this study was to p e r f o r m a virologic analysis o f m i x e d infections by m o r e than one H C V genotype detected in a large population o f chronically infected patients to assess the real prevalence of coinfections in individuals without particular risk factors. METHODS Patients. Two hundred and thirteen Italian patients with HCV-related chronic liver disease (121 men, 32 women, mean age 52.3 + 11 years, range 43 to 70 years) with detectable HCV-specific antibody and HCV-RNA were analyzed. The patients were anti-HIV negative, and they had no history of IVDA, dialysis, or repetitive episodes of hemotransfusion. One hundred and seventy patients had histologic evidence of chronic hepatitis, 31 had liver cirrhosis, and 12 had hepatocellular carcinoma complicating a liver cirrhosis. Serum samples were separated into aliquots and then stored at -80°C until the test. Extraction of RNA and cDNA synthesis. Viral RNA was extracted from 150 gL of serum with a modification of the guanidium isothiocyanate method of Chomczynsky 12 (RNAzol B; Biotech) and resuspended after isopropanol precipitation in 30 gL of H20 diethyl pyrocarbouate with 40 U RNAguard (Pharmacia Biotech). A 10 gL sample of RNA solution was incubated at 65°C for 10 minutes with 10 pmol of down-

Giannini et al

69

stream primer, cDNA was synthesized at 37°C for 45 minutes with 100 U of M-MLV reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, MD) in a 30-gL reaction mixture containing 50 mmol/L Tris-HC1 (pH 7.5), 75 mmol/L KC1, 6 mmol/L MgC12, and 1 mmol/L deoxyribonucleoside triphosphate, cDNA was stored at -20°C. Nested-PCR for HCV-RNA detection. For HCV-RNA detection, one-tube nested PCR that used two couples of primers spanning the well-conserved 5" untranslated region13,14 was performed. To avoid false-positive results by PCR product carryover, further precautions, in addition to the ones already described in the literature, 15 were used as follows: (1) a "one-tube" nested PCR method was used, which consisted of carrying out two amplification steps without reopening the tube between the first step and the second step; (2) deoxyuridine triphosphate was incorporated instead of deoxythymidine triphosphate in the PCR reaction mixtures to generate amplicons degradable by Uracil-N-Glycosilase (Perkin-Elmer Cetus, Norwalk, CT), which was added to both reaction mixtures before PCR amplification. HCV genotyping. Serum samples were genotyped by PCR with genotype-specific primers according to the method of OkamotoS; PCR amplification was performed with only one specific primer at a time. For HCV genotype 2 (a/c) detection, a different primer, synthesized on the basis of a large sequence analysis of European HCV isolates, was used following the method reported by Giannini et al, 1995. In the first PCR step, conserved primers Cap316 and #1868 were used. Type-specific amplicons of 69, 164, 106, and 194 bp for type la, lb, 2 (a/c), and 2b, respectively, were obtained by using primer 23ou 17 as an upstream universal primer and primers #296, #133, CRIIIa and #135 s-16 as type-specific ones. For genotype 3a detection, type-specific PCR was performed as previously described. 18 The samples were tested at least two times for each genotype. In the case of indeterminate or untypable samples with type-specific primer PCR, genotype-specific probe hybridization (Line Probe Assay; Innogenetics) was also used. 19 PCR for direct sequencing. Universal primers were selected to amplify a part of the capsid gene conserved in all HCV types and subtypes. Outer primers (Cap 3 sensO 6 and #186 antisense s) produced a 303-bp PCR fragment, while inner primers (#256 sense 8 and #185bio antisense 16) generated a 250-bp product with a biotinylated strand for solid phase direct sequencing. RFI.P analysis. On the basis of large HCV nucleotide sequence comparison, which was derived from previous studies, 16-20 type-specific restriction endonucleases were identified. In particular, AccI was used to selectively cleave type la-specific amplicons (nt 558) as described.21 HCV genotype 2(a/c)-amplicons were cleaved by Hae II (nt 523) and divided into 56-bp and 50-bp fragments (Fig 1). In brief, in a 40 gL reaction mixture, 10 U of specific restriction endonucleases (AccI for type la or Hae II for type 2 [a/c]) and 10 gL of PCR product were added to an appropriate buffer. Samples were incubated for 2 hours at 37°C and then subjected to electrophoresis on a 12% acrylamide gel, stained with ethidium bromide, and observed under ultraviolet light. The type specificity of the RFLP assay was tested on several sequence-con-

70

J Lab Clin Med July 1999

Gianninietal

A 1

2

B 3

4

M

5

6

7

8

164 bp

108bp

106 bp

56 bp

56 bp ,50 bp

Fig 1. RFLP analysis of type-specific PCR products to verify mixed infections. A, Example of lb + 2(a/c) apparent coinfection. The amplicon obtained by using lb-specific primer (164 bp; lane 1) is cleaved in two fragments (108 and 56 bp; lane 2) after digestion by Hae II enzyme, showing a nonspecific annealing on an HCV-2. In lane 3, type 2 (a/c) amplicon (106 bp) correctly cleaved by Hae II (lane 4; 56 and 50 bp). B, Example of authentic lb + 2 (a/c) coinfection. Lanes 5 and 6, lb-specific amplicon before and after Hae II digestion. Lanes 7 and 8, 2 (a/c)-specific amplicon before and after Hae lI digestion.

firmed HCV-positive samples of the five most represented genotypes (data not shown). Direct sequencing of PeR products. For HCV nucleotide sequence determination, both cycle sequencing and solid phase sequencing techniques were used. The cycle sequencing protocol, which used a thermostable DNA polymerase (AmpliTaq CS; Perkin-Elmer, Norwalk, CT), was used for direct sequencing of type-specific amplicons. After rapid purification by Microcon-30 microconcentrators (Amicon), 1 to 3 HL purified type-specific amplicon was added to the reaction mixture according to the manufacturer's instructions. Primer 23ou 17 was chosen as a sequencing primer. After a denaturation step of 2 minutes at 95°C, 25 PCR cycles consisting of annealing for 1 minute at 60°C, extension for 1 minute at 72°C, and denaturation for 1 minute at 95°C were performed. A 2-HL sample was run in a denaturing acrylamide sequencing gel, then fixed with 10% methanol and 10% acetic acid for 15 minutes, dried, and finally exposed overnight to Kodak BioMax film. Solid-phase sequencing was carried out on biotinylated amplicons generated by PCR amplification with universal primers spanning a 250-bp region in the capsid gene of HCV as previously reported. 16 RESULTS

HCV genotype distribution in our population was as follows. H C V lb was the most prevalent genotype in these patients (115/213, 54%); type 2 (a/c) was also prevalent (58/213, 27.2%). Genotype la and 3a were found in 10 (4.7%) and 7 (3.3%) patients, respectively. A mixed infection by two genotypes was detected in 23

patients. Genotype lb was always present when a coinfection was found; in particular, 4 out of 23 were infected by type la + lb, while the remaining 19 were infected by type lb + 2 (a/c). RFLP analysis was performed in the 23 patients with coinfection to confirm the specificity of type-specific primer PCR. Half of la + lb coinfections (2 of 4) were confirmed by RFLP analysis, and only 2 out of the 19 lb + 2 (a/c) coinfections were validated by endonuclease cleavage. In particular, in case of "false" mixed infection, amplicons obtained with the lb-specific primer (#133) were digested by la-specific and 2-specific endonucleases. This result was consistent with the nucleotide sequence analysis of type-specific amplicons performed in patients with a suspected coinfection (Fig 2). In fact, in considering la + l b coinfections, all la-specific amplicons showed an H C V - l a nucleotide sequence, while in 2 cases (patients 1 and 4, whose coinfection was not confirmed by RFLP), lbspecific amplicons revealed an H C V - l a sequence. This discrepancy was more evident in the case of lb + 2 (a/c) multiple infection, where all type-2 (a/c) amplicons showed an HCV-2 (subtype c) sequence, while only in 2 cases (patients 10 and 14) PCR products obtained with lb-specific primer (#133) showed an H C V - l b sequence, revealing, in the other 17 cases, a nonspecific annealing of this primer on an H C V genotype-2. In 10 of these latter cases, the nucleotide sequence of a larger region of the core gene was determined to verify whether any mutation in the HCV-2 sequence of these isolates could have permitted the lb-specific primer to cross-anneal. As shown in Fig 3, a C/T point mutation at position 618 was present in all samples sequenced and a G / A transversion (nt 626) was present in 4 cases (patients 6, 7, 9, and 17), reducing the number of mismatches between HCV-2 and H C V - l b sequences from 4 to 3 (or 2). The four patients (3 men) with a true coinfection were not clinically different from the remaining population of HCV-infected patients. In particular, their ages were 46, 51, 57, and 63 years (54.2 _+7.36, mean __.SD). All had HCV infection for at least 3 years (6 + 1.3, mean _+SD; range 3 to 9 years) and histologic evidence of cirrhosis (with ascites in 1 patient). No patient had either any identified risk factor for infection or evidence of acute exacerbation of the disease. ALT (normal value in our laboratory <40 IU/L) ranged between 45 and 90 UUL in all cases. DISCUSSION

This study indicates that infections by more than one HCV genotype actually occur in the same patient, despite the absence of any particular risk factor (IVDA, hemophilia, hemodialysis). However, the prevalence of

J Lab Clin M e d Volume 134, N u m b e r I

HCV-Ia

170 180 |90 500 " 510 520 530 510 550 560 570 580 590 6011 6111 6211 A G A T T G G G T G T C , CC.C~U-CGACGAGAAAGACT T C C G A C ` C G G T C G ~ A A ~ C T C G A G G T A G A C G T ~ A G C C T A T C ~ C A A G G C T C G T ~ C ~ A ~ C ~ A C ~ T ~ C C U C T A T ~ T G A ~ T ~ A T ~ T ~

(i)

............................................................................

(4) HCV-lb

71

Giannini et al

,G ...................................................................

'1'(3 . . . . . . . . A . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

AGG TTGGGTGTGCC~CU.CGACTAGGAAGACT~CGAGCGGTCC.CAAC~TCGTGGAAGGCGACAACCTATCC~CA~C`GCTCC~CCGC`C~T~A¢~T~ G ............................

C ................

C

~

C

~

A

C

~

A

~

T

A

~

A

T

~

C

(2)

................................

(3)

...................................

(1111 (14) HCV-2c

............................................................. C ................ A ......... C...G ..................................... T ........ CC ........................ .................... C ........................................ C ..................... AA ..... T ...... O ................................................................... AGGT T G G G T G T G C ~ C C . C G A C A / % G G A A A A C T T ~ G G A A C G G T C C C A G C C A C G T G G G ~ F ~ C . C U ~ C C A G C C C A T C C C T ~ G A T ~ A C C A ~ T ~ ~ A T A ~ T ~ G T A ~ ~ T ~ C

(5)

..........................................................................

(6)

..........................................................................

G ...............................

(7)

..........................................................................

G ................

A ............................

A ......... C...G ............................

6J8

TG ........ A .........

T ...........................

T ........... T ...............................

G ........................................

G ......................

T ..... C .........................

A ........ AA ........... C ....... A ..................

G..G ...............

A .......................................

T ........................... T ...............

G..G ...............

C ........................

A.G..G ...............

11))

.......................................................................................................

(9) (111

.......................... G ................................................................................ A ........... C ...................... . . . .G..G ............... ............................... G ................................. T ..... C ............ G ................................................... . ......... G..G ...............

C ..........................

G..G ...............

112)

.......................................................................................................

(131 (15)

............................................................ .-. . . . . . . . . . . . . . . . . . . . . . . T ..................... ..........................................................................................................

T ..........................................

G..G ...............

AA ........ T ........................ *....G..G ............... A ............. T ......................... G..S ...............

(16)

................................

C .............................

A ........ C ........ C ..........................

(171

................................

C .............................

C ........ C ..................................

(18) (191

................................ C ........ G .............. ..............................................................

(20) (21)

.......................... G .................................. ~ ...................... S ................................................. A ........... ................................... G ................................... G.G ................................ AA ........... C ..........................

G..G ............... G..G ...... . ........

(22)

.......... : ..................... ...................................

G..G ...............

(23)

c

A ........... C ........... C..; ........... G..G ............... C ..........................

G..G ...............

A ........................... T ...................... A ........... C .......................... C ...................................................................................

A ............

G..G ............... G..G ...............

A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G..G

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

S ...................................................................................

C ......

G...................

...............

Fig 2. Sequence alignment of amplicons obtained with lb-specific primer (#133) from 23 patients with suspected coinfection. HCV isolates have been aligned on the closestrepresentativepublished sequences of HCVsubtypes accordingto Bukh et al.2° Dots indicate sequencehomology. 570 HCV-2C

590

600

610

620 630 l" ~ ' r - ~ e A e ' e ' A ~ ' : " ~ l

640

650

660

670

GGGG~GGCCAGGATACCCTTGGCCCCTGTATGGG;u~-TGAGGGCCTCGGC~GGGCAGGGTGGCTCCTGTCCCCCCGCGGTTCTCGCCCTTCATGGGGCCCCAC

(5)

.......

(6)

......

( 7 1

(9) (111

sso

A ........ A

T..C

.............................

................................

TT

.........................

T..C..C

A ..............

..................................................

T .......

A .........................................

.......

T .......

A .................

T .................................

.............................................

(13) (151 (161 (17)

......

(181

.......

......

• ....

A ...........................................

................ .......

A A

...........

............ A

...........

T ................................ C ...........

C ..................

T ................

T .....

....................

T .......

A ........

C ..........

T..C

C ........

T .............. T.

• ..............

...G

......

T ...................................... TT

C ..............................

T .......

A .........

C ..............................

T .................

...

........

A .............

............................

C ....

T .........................

•

.......................

A..C

A ......

..........

G ..........

C..C

.......

G ..........

C ........

T .....

T .....

AT

........

AT

...........

C.AT

T..

...........

Fig 3. Sequence alignmentof PCR products obtained with conservedprimers spanning a 303-bp region of the HCV core gene from 10 patients with "false" lb + 2 (a/c) coinfection. Nucleotide sequence of lb-specific primer (#133) is boxed.

this phenomenon is remarkably lower than that observed when using the currently employed genotyping techniques. For the rapid and sensitive analysis of mixed infections we used an RFLP assay on type-specific PCR products with both previously and newly described restriction endonucleases, demonstrating the specificity and sensitivity of the assay by comparing results with direct sequencing of type-specific amplicons. The possibility that more than one HCV genotype may persist in the same host has been described both in primates and in human subjects (especially in subjects with evident risk of multiple exposure to infection).9,10, n-25 The clinical and pathogenetic significance of mixed infections is still unclear. Studies in primates showed an increase in transaminase levels in the case of superinfection by another HCV type.2223 Similar behavior has been reported in human subjects, 9 where superinfection seems to be a relevant factor in the pathogenesis of reactivation of chronic hepatitis. Widell et al, 1° in a study performed in HCV-infected patients transplanted with HCV-infected kidneys, showed an initial improvement in patient conditions,

but increased liver damage developed in several superinfected subjects after a short period of time. In addition, infection by different HCV genotypes is considered to be an important factor in the acute exacerbation of HCV-related chronic hepatitis, contributing to progressive and severe disease, as reported by Kao et al. u The prevalence of mixed infections varies widely depending on the population studied and the techniques used for genotype determination. In fact, genotyping methods based on PCR amplification of conserved regions with universal primers (such as line probe assay and RFLP) may fail to detect sequences present in very low concentrations. Type-specific primer PCR is sensitive in detecting coinfections or superinfections by heterogeneous HCV strains in the same sample, even though several authors have reported ambiguous results caused by lack of primer specificity. To increase the specificity for HCV isolates present in geographically distant regions from those where the original method was developed, many groups have proposed their own primers. 16,17,21,25 In our study, which was performed in patients with chronic HCV infection who were without particular

72

J Lab Clin Med July 1999

Gianniniet al

risk factors such as I V D U or hemophilia, the distribution of HCV genotypes was not significantly different from the ones already shown by other Italian authors,26, 27 with a relatively high prevalence of mixed infections in our patients, especially involving genotype lb. The RFLP assay using restriction endonucleases allowed rapid analysis of type-specific PCR results in the case of mixed infection, as shown by sequencing data of samples with a suspected coinfection that are consistent with RFLP results in all cases. The few patients with true HCV type coinfections had long-lasting disease and liver cirrhosis. Whether HCV coinfection influences the clinical course of the disease remains to be established. The high prevalence of lb + 2 (a/c) "false" coinfection (17/19) induced us to more clearly elucidate whether a particular mutation pattern in the HCV-2 genome, allowing a nonspecific annealing of lb-specific primer, occurred in those patients. We amplified a larger part of the core gene with universal primers and then determined the nucleotide sequence with interest in the region spanned by primer #133. In all 10 samples tested, a recurrent C/T transversion at position 618 and a G/A transversion (nt 626) in 4 cases was evident, reducing the number of mismatches between HCV-2 sequence and lb-specific primer from 4 to 3 (or 2). Those changes in the viral genome were also found in several samples belonging to a previous study 16 that did not show any sign of multiple infection, suggesting that these point mutations could not fully explain the phenomenon. In addition, PCR stringency does not seem to play a primary role in determining these results. In fact, several attempts to increase specificity--such as raising the annealing temperature or adding glycerol, dimethyl sulfoxide, or other cosolvents to reaction mixtures--did not result in any remarkable improvement. To bypass this problem, other authors have proposed personally synthesized lb-specific primers and have obtained encouraging r esults, 17 even if further amplification is required. For rapid and reliable analysis of multiple infections we used an R F L P assay whose specificity was confirmed by nucleotide sequence analysis in all cases that were tested. It is interesting that all type 2 sequences from socalled true and false lb + 2 coinfections were closely related to HCV subtype 2c (from 90.6% to 97.3% nucleotide homology), in relation to the part of the core gene analyzed. This is in agreement with previous epidemiologic data showing a relatively high prevalence of this subtype in Italy. 28 In conclusion, this study shows that coinfection by different HCV types is not a rare event and that it may have clinical consequences that should be clarified in further studies. It is possible, for example, that coinfec-

tion by different HCV types may worsen the response to interferon therapy, as recently shown for coinfection by H C V and HBV, although in a silent manner, 29 and may substantially modify the natural course of HCVrelated hepatic or extrahepatic manifestations. In addition, this study shows a constant attribution to subtype 2c of H C V isolates previously classified as 2a, thus confirming the high prevalence of this viral variant in Italy. We thank Mrs Mary Diamond for preparing the manuscript. REFERENCES

1. Pozzato G, Moretti M, Franzin F, Croce MS, Tiribelli C, Masayu T, et al. Severity of liver disease with different hepatitis C viral clones [letter]. Lancet 1991;338:509. 2. Yoshioka K, Kakumu S, Wakita T, Ishikawa T, Itoh Y, Takayanagi M, et al. Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus. Hepatology 1992;16:293-9. 3. Enomoto N, Takada A, Nakao T, Date T. There are two major types of HCV in Japan. Biochem Biophys Res Commun 1990;170:1021-5. 4. Cha TA, Beall E, Irvine B, Kolberg DCJ, Kuo G, Urdea MS. At least five related, but distinct, hepatitis C viral genotypes exist. Proc Natl Acad Sci USA 1992;89:71448. 5. Chan W, McOmish E Holmes EC, Dow B, Peutherer JR Follet E, et al. Analysis of a new HCV type and its phylogenetic relationship to existing variants. J Gen Virol 1992;273:1131-41. 6. Simmonds R Holmes EC, Cha TA, Chan SW, Irvine B, Beall E, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS5 region. J Gen Virol 1993;74:2391-9. 7. Simmonds R Alberti A, Alter H, Bonino F, Bradley DV, Brechot C, et al. A proposed system of nomenclature of hepatitis C viral genotypes. Hepatology 1994;19:1321-4. 8. Okamoto H, Sugiyama Y, Okata S, Kuray K, Akahane Y, Sugay Y, et al. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-9. 9. Kao JH, Chen PJ, Lai YM, Chen DS. Superinfection of heterologous HCV in a patient with chronic type C hepatitis. Gastroenterology 1993;105:583-7. 10. Widell A, Mansson S, Persson NH, Thysell H, Hermodsson S, Blohme I. Hepatitis C superinfection in HCV infected patients transplanted with an HCVqnfected kidney. Transplantation 1995;60:642-7. 11. Kao JH, Chert PJ, Lai YM, Yang PM, Sheu JC, Wang TH, et al. Mixed infections of HCV as a factor in acute exacerbation of chronic type C hepatitis. J Infect Dis 1994;170:1128-33. 12. Chomczynski R Sacchi N. Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-9. 13. Ferri C, Monti M, La Civita L, Longombardo G, Greco F, Pasero G, et al. Infection of peripheral blood mononuclear cells by hepatitis C virus in mixed cryoglobulinemia. Blood 1993;82:3701-4.

J Lab Clin Med Volume 134, Number 1

14. Zignego AL, Ferri C, Giannini C, Monti M, La Civita L, Careccia G, et al. Hepatitis C virus genotype isolates by PCR. J Clin Microbiol 1996;32:2031-4. 15. Kwok S, Higuchi R. Avoiding false positive results with PCR. Nature 1989;339:237-8. 16. Giannini C, Thiers V, Nousbaum JB, Stuyver L, Maertens G, Brechot C. Comparative analysis of two assays for genotyping hepatitis C virus (HCV) based on genotypespecific primers or probes. J Hepatol 1995;23:246-53. 17. Widell A, Shev S, Mansson S, Zhang YY, Foberg U, Norkrans G, et al. Genotyping of hepatitis C virus isolates by a modified polymerase chain reaction assay using type specific primers: epidemiological applications. J Med Virol 1994;44:272-9. 18. Okamoto H, Tokita H, Sakamoto M, Horikita M, Kojima M, Iizuka H, et al. Characterization of the genomic sequence of type-V (or 3a) hepatitis C virus isolates and PCR primers for specific detection. J Gen Virol 1993;74:2385-90. 19. Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H, et al. Typing of HCV isolates and characterization of new subtypes using a line probe assay. J Gen Virol 1993;74:1093-102. 20. Bukh J, Purcell RH, Miller RH. Sequence analysis of the core gene of 14 hepatitis C virus genotypes. Proc Natl Acad Sci USA 1994;91:8239-43. 21. Andonov A, Channdhary RK. Genotyping Canadian isolates of hepatitis C virus isolates by PCR. J Clin Microbiol 1994;32:2031-4. 22. Farci R Alter HJ, Govindarajan S, Wong DC, Engle R,

Giannini et al

23.

24.

25.

26.

27.

28.

29.

73

Lesniewski RR, et al. Lack of protective immunity against reinfection with hepatitis C virus. Science 1992;258:135. Okamoto H, Mishiro S, Tokita H, Tsuda F, Miyakawa Y, Mayumi M. Superinfection of chimpanzees carrying HCV of genotype II/lb with that of genotype III/2a or I/la. Hepatology 1994;20:1131-6. Preston FE, Jarvis ML, Makris M, Philp L, Underwood JCE, Ludlam CA, et al. Heterogeneity of HCV genotypes in hemophilia: relationship with chronic liver disease. Blood 1995;85:1259-62. Silini E, Bono F, Cerino A, Piazza V, Solcia E, Mondelli M. Virological features of hepatitis C virus infection in hemodialysis patients. J Clin Microbiol 1993;31:2913-7. Pontisso P, Ruvoletto MG, Nicoletti M, Tsiminetzky S, Gerotto M, Levrero M, et al. Distribution of three major HCV genotypes in Italy: a multicentre study of 495 patients with chronic hepatitis. J Viral Hepatitis 1995;2:338. Pistello M, Maggi F, Vatteroni L, Cecconi N, Panicucci F, Bresci GP, et al. Prevalence of hepatitis C genotypes in Italy. J Clin Microbiol 1994;32:232-4. Cammarota G, Maggi F, Vatteroni L, Da Prato L, Barsanti L, Bendinelli M, et al. Partial nucleotide sequencing of six subtype 2c hepatitis C viruses detected in Italy. J Clin Microbiol 1995;33:2781-4. Zignego AL, Fontana R, Puliti S, Barbagli S, Monti M, Careccia G, et al. Relevance of inapparent coinfection by hepatitis B virus in alpha interferon treated patients with hepatitis C virus positive chronic hepatitis. J Med Virol 1997;51:313-8,