Prevalence of multidrug-resistant Staphylococcus aureus isolates with strong biofilm formation ability among animal-based food in Shanghai

Food Control 112 (2020) 107106

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Prevalence of multidrug-resistant Staphylococcus aureus isolates with strong biofilm formation ability among animal-based food in Shanghai

T

Chujun Ou, Daiqi Shang, Jingxian Yang, Bo Chen, Jiang Chang, Fangning Jin, Chunlei Shi∗ MOST-USDA Joint Research Center for Food Safety, School of Agriculture and Biology, and State Key Laboratory of Microbial Metabolism, Shanghai Jiao Tong University, Shanghai, 200240, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Staphylococcus aureus Animal-based food Multidrug resistance Biofilm formation ability

Antimicrobial resistance has gradually become a serious problem threatening public health and food safety throughout the world. Biofilm is one of the important factors affecting the antimicrobial resistance of bacteria. Staphylococcus aureus usually has strong biofilm formation ability, and it is widely found in animal-based food. The purpose of this study is to determine the prevalence, antimicrobial resistance and biofilm formation of S. aureus in animal-based food. Total 959 samples representing eight types of animal-based foods were collected from randomly selected locations (21 supermarkets and 18 wet markets) throughout the Shanghai city. The overall isolation rate of S. aureus was 17.2% (165/959). For each food category, the isolation rate was 21.8% for chicken (45/206), 21.5% for pork (71/331), 15.2% for beef (16/105), 13.8% for duck (9/65), 12.1% for aquatic products (17/141), 8.6% for egg (5/58), and 7.1% for lamb (2/28), respectively. No isolate was found from pasteurized milk (n = 25). Antimicrobial susceptibility test showed that among all the S. aureus isolates, 90.3% were resistant to at least one antimicrobial, 39.4% were multi-drug resistant, and 23 isolates were methicillinresistant S. aureus (MRSA). Comparing the resistance rates to different antimicrobials, S. aureus had the highest resistance rate to penicillin, up to 82.4% (136/165); followed by erythromycin (57.6%, 95/165) and tetracycline (27.9%, 46/165). All isolates were sensitive to vancomycin. With the microtiter plate and crystal violet staining assay, 64.8% of all the 165 isolates had strong biofilm formation ability and 20.0% were moderate producers. Remarkably, significant difference was found in biofilm formation ability between those isolates from supermarkets and wet markets (p < 0.01). According to WGS analysis of 19 multi-drug resistant isolates with strong biofilm formation ability, ST7 was the dominant sequence type. Combined analysis showed that S. aureus isolates with drug resistance phenotypes usually had stronger ability to form biofilm.

1. Introduction In recent years, antimicrobial resistance (AMR) has gradually become the most important and serious global problem, threatening public health and food safety. According to O'Neill (2016), it predicts that the number of deaths due to AMR will reach 10 million a year by 2050 and will lead to an economic loss of about $100 trillion. If no action is taken, many major diseases will hardly be cured because of AMR in the future. Abuse of antimicrobials is an important cause of AMR and there is a problem of excessive use of antimicrobials in China's livestock and poultry industry. An average of 318 mg of antimicrobials used for every 1 kg of meat produced, which is the highest in the world (Van Boeckel et al., 2017). This may result in a large number of animalderived resistant bacteria that can be delivered to humans through meat and meat products. Therefore, animal-based food has become the most

∗

important AMR surveillance target. Biofilm is a multicellular consortium with three-dimensional structure formed on a biological or abiotic surface. When bacteria are exposed to environmental stress, they stick to each other and are coated with the extracellular matrix produced by themselves, then the biofilm is formed (Costerton, 1999; Costerton et al., 1987; Hall-Stoodley, Costerton, & Stoodley, 2004). The presence of biofilm contributes to the spread of AMR and has caused tremendous problems in food industry. In the vast majority of cases, Staphylococcus aureus was strong biofilm producer. The biofilm makes antimicrobial impenetrable to reach S. aureus, and it allows S. aureus to escape the killing of the host immune system and become persister cells (Moormeier & Bayles, 2017). More importantly, the biofilm can also promote the spontaneous mutation of S. aureus, accelerate the emergence of heritable AMR, and significantly increase the ability of S. aureus to obtain or spread the AMR

Corresponding author. E-mail address: [email protected] (C. Shi).

https://doi.org/10.1016/j.foodcont.2020.107106 Received 19 August 2019; Received in revised form 3 January 2020; Accepted 9 January 2020 Available online 11 January 2020 0956-7135/ © 2020 Elsevier Ltd. All rights reserved.

Food Control 112 (2020) 107106

C. Ou, et al.

AGG - 3′, mecA-R 5’ - TGTCTGCCAGTTTCTCCTTG - 3′) in this study with the software Primer Premier 5.0. S. aureus ATCC 29213 and S. aureus ATCC 43300 were used as quality control.

determinants carried by the plasmid through horizontal gene transfer (Savage, Chopra, & O'Neill, 2013). Thus, the formation of biofilm may be an important factor in the resistance formation of S. aureus to antimicrobials (Bhattacharya et al., 2018; Drenkard & Ausubel, 2002). Meanwhile, the China national bacterial resistance surveillance report in 2018 showed that the isolation rate of S. aureus is the highest among Gram-positive bacteria (32.5%) (CARSS, 2019). Based on the severity of the hazard, the World Health Organization listed S. aureus as a “high priority” surveillance object in 2017 (Tacconelli et al., 2018). At present, reports on the AMR and ability of biofilm formation of S. aureus are more common in the clinic, but fairly rare in food. Therefore, it is necessary to monitor the prevalence, AMR and biofilm formation of S. aureus in animal-based food. The purpose of this study is to investigate the prevalence of multidrug-resistant S. aureus among retailed animal-based food in Shanghai. Meanwhile, the biofilm formation ability of these isolates will also be evaluated. The correlationship between biofilm formation ability and antimicrobial resistance will be preliminarily established.

2.3. Biofilm formation ability assay in vitro The microliter plate method was used to assay the biofilm formation ability (BFA), and the method was modified as previously described (Ohadian Moghadam, Pourmand, & Aminharati, 2014). Briefly, after twice activations of the strains, S. aureus suspension was adjusted to OD600 = 0.8000 ± 0.0200. Two microliters of diluent were inoculated into the wells of sterile flat-bottomed 96-well polystyrene tissue culture plates (Falcon®, Corning, United States) with 198 μL TSB. The rest of wells were added 200 μL TSB as negative control. The plate was placed at 37 °C for 72 h (mature biofilm) without shaking. At the end of the incubation period, the plates were emptied and washed twice with 200 μL of phosphate-buffered saline (PBS, pH 7.2) to remove non-adhered cells. Next, the fixation step was done by air-drying at 55 °C for 15 min. The adherent biofilm layer at the surface of wells was stained by 200 μL of crystal violet (0.1% g/L) for 15 min at room temperature and then washed three times with 200 μL of PBS. When the plate was dried, each well was dissolved by 95% ethanol and the OD595 value was measured by microplate reader (Sunrise, Tecan, Switzerland). The amount of biofilm formation is characterized by the OD595 value, and the biofilm formation ability (BFA) level is obtained by the following formula: cut-off value (ODc) = average OD of negative control + 3 × standard deviation (SD) of negative control; BFA ≤ ODc: negative biofilm producer; ODc ≤ BFA ≤ 2 × ODc: weak biofilm producer; 2 × ODc ≤ BFA ≤ 4 × ODc: moderate biofilm producer; 4 × ODc ≤ BFA: strong biofilm producer. S. aureus ATCC 25923 was used as positive control.

2. Materials and methods 2.1. Sample collection and bacteria isolation From July 2018 to August 2019, animal-based food samples representing eight types of animal-based foods (pork, chicken, beef, duck, lamb, aquatic products, egg, and milk) were collected from randomly selected local markets (including 21 supermarkets and 18 wet markets) from seven districts in the Shanghai city, China. Each sample was purchased in a weight range of 250–500 g without replication. Isolation of S. aureus was performed as described by China's National Food Safety Standard-Food Microbiological Examination of S. aureus (GB4789.10–2016), and the method was slightly modified. In brief, samples were suspended in 7.5% Sodium Chloride Broth (Beijing Land Bridge Tech Co., Ltd., China) with a final adjusted concentration of NaCl to 10%, incubated at 37 °C for 18–24 h. Homogenates was streaked onto Baird-Parker agar with 5% egg yolk (Beijing Land Bridge Tech Co., Ltd., China) plate and these plates were incubated at 37 °C for 24–48 h. Then 2–5 typical colonies on each plate were selected to streak onto Tryptic Soy Agar (TSA; Beijing Land Bridge Tech Co., Ltd., China) with 2% ethanol and 4% agar to inhibit interference of other bacteria. Single presumptive colony was picked to inoculate tryptic soy broth (TSB; Beijing Land Bridge Tech Co., Ltd., China) for overnight culture at 37 °C with 200 rpm shaking. Bacteria DNA extraction and purification kit (Tiangen Biotech Co., Ltd., China) was used to extract genomic DNA. Extracellular thermo-stable nuclease 1 gene (nuc1 –F 5′- AGTATATAG TGCAACTTCAACTAA - 3′ and nuc1 –R 5′- ATCAGCGTTGTCTTCGCTC CAAAT - 3′) was amplified by a PCR-based method to carry out the molecular identification of S. aureus. And S. aureus ATCC 25923 was used as positive control.

2.4. Whole genome sequencing (WGS) of multidrug resistant isolates Nineteen multidrug resistant isolates with strong biofilm formation ability were subjected to whole genome sequencing. After activation of all the strains, they were inoculated into a PA bottle containing 5 mL of TSB medium and cultured at 37 °C for 12 h. Then, the culture was centrifuged at 10,000 rpm for 1 min, and the normal saline (0.85%) was added to transfer the cells to a new 2 mL centrifuge tube. Suspension was centrifuged again to precipitate the cells and the sediment was stored at 20 °C. The prepared cells were sent to Shanghai Meiji Biomedical Technology Co., Ltd. for whole genome sequencing. A DNA fragment of ~400 bp was constructed on a qualitatively qualified DNA sample using an Illumina Hiseq × 10 platform, and subjected to PE150 (pair-end) sequencing. Each sample provided no less than the genome 100 × coverage depth of raw sequencing data. Finally, raw reads were assembled using SOAPdenovo v2.04 (http://soap.genomics.org.cn/). Then the assembly result was optimized to form scaffold. AMR genes were identified based on the comprehensive antibiotic resistance database (CARD), using assembly data obtained. Multilocus sequence typing (MLST) was completed by the Center for Genomic Epidemiology (https://cge.cbs.dtu.dk/services/MLST/).

2.2. Antimicrobial susceptibility test Thirteen antimicrobials were selected for antimicrobial susceptibility test. They are listed as follow: oxacillin (OXA), vancomycin (VAN), penicillin (PEN), daptomycin (DAP), gentamicin (GEN), erythromycin (ERY), tetracycline (TCY), ciprofloxacin (CIP), clindamycin (CLI), trimethoprim-sulfamethoxazole (SXT), chloramphenicol (CHL), rifampin (RIF), and linezolid (LNZ). According to the Clinical Laboratory Standards Institute (CLSI), susceptibility of isolates against DAP was tested by broth dilution method (agar dilution method has not been validated for DAP), and the other antimicrobials selected in this study were tested by agar dilution method. Multi-drug resistant (MDR) S. aureus were defined as which isolates were resistant to at least three classes of antimicrobials (Falagas, Koletsi, & Bliziotis, 2006). The existence of mecA gene was detected by the PCR-based method with the newly designed primer pair (mecA-F 5′- ATCATAGCGTCATTATTCC

2.5. Statistical analysis Three replicates were used in all assays. The results of each assay were calculated as average ± standard deviation of experiment data. Statistical analysis was carried out by SPSS 22.0 (SPSS Inc., Chicago, IL, United States) to determine the significant difference of data, using Chisquared test, one-way ANOVA and T-test method. Figures were performed with GraphPad Prism 7.

2

Food Control 112 (2020) 107106

C. Ou, et al.

Table 1 The overall contamination of animal-based food (n = 959) in Shanghai by S. aureus. Location

Pork

Chicken

Beef

Lamb

Duck

Aquatic products

Egg

Milk

Total

Supermarket Wet market Total

19.9% (34/171) 23.1% (37/160) 21.5% (71/331)

29.5% (31/105) 13.9% (14/101) 21.8% (45/206)

14.3% (7/49) 16.1% (9/56) 15.2% (16/105)

25.0% (2/8) 0 (0/20) 7.1% (2/28)

17.9% (7/39) 7.7% (2/26) 13.8% (9/65)

9.0% (8/89) 17.3% (9/52) 12.1% (17/141)

12.5% (4/32) 3.8% (1/26) 8.6% (5/58)

0 (0/23) 0 (0/2) 0 (0/25)

18.0% (93/516) 16.3% (72/443) 17.2% (165/959)

3. Results and discussion

Table 3 Isolation rate of S. aureus in chicken samples from different parts.

3.1. Prevalence of S. aureus among animal-based foods in Shanghai

Part Chicken Chicken Chicken Chicken Chicken

Total 959 samples representing eight types of animal-based foods (Table 1) were collected from randomly selected locations (21 supermarkets and 18 wet markets). The overall isolation rate of S. aureus was 17.2% (165/959). For each food category, the isolation rate was 21.8% for chicken (45/206), 21.5% for pork (71/331), 15.2% for beef (16/ 105), 13.8% for duck (9/65), 12.1% for aquatic products (17/141), 8.6% for egg (5/58), and 7.1% for lamb (2/28), respectively. No isolate was found from pasteurized milk (n = 25). There is no significantly difference (p > 0.05) between the overall prevalence of S. aureus from supermarkets (93/524) and from wet markets (72/435) by using a Chisquared test of independence. The sample collection lasted four seasons from July 2018 to August 2019. Based on the sampling seasons, the isolation rate of S. aureus was calculated (Table 2). It is out of our expectation that the animal-based food in Shanghai had the highest contamination rate in autumn, and the following was in winter, while the lowest was in summer. It may be due to stricter refrigeration storage of animal-based food during the hot season. In this study, chicken had the highest contamination rate of S. aureus. Then the isolation rate from different parts of chicken was analyzed (Table 3). Chicken wings were the most contaminated (60.0%) by S. aureus, followed by chicken breast and chicken feet. Chicken offal was free of contamination. Here, only the samples, which were the whole chicken, were involved in this analysis. With the China national standard method to isolate and identify S. aureus, it was hard to differentiate Proteus mirabilis that commonly exists in frozen meat products. In the study, an optimized method with the addition of more NaCl in pre-enrichment broth, and ethanol and more agars to TSA plate was established (data not shown). This method increased the isolation rate of S. aureus in chicken (21.8%), which was higher than Wang et al. with the isolation rate at 11.5% (Wang, Wang, Liang, Xu, & Zhou, 2018). The current isolation rate in pork (21.5%) was lower than Zhang et al. at 26% (Zhang et al., 2018).

Table 2 S. aureus isolation rate in samples collected at different seasons. Sample number

Isolate number

Isolation rate

Spring Summer Autumn Winter

Mar–May Jun–Sep Oct–Nov Dec–Feb

244 318 161 197

29 31 57 47

11.9% 9.7% 35.4% 23.9%

Isolation rate

20 24 7 17 11

12 11 3 2 0

60.0% 45.8% 42.9% 11.8% 0.0%

respectively. The isolates with PEN, ERY or CLI resistance can be found in all the food categories except milk. There were 23 isolates resistant to oxacillin among the 165 isolates (13.9%), being considered as methicillin-resistant S. aureus (MRSA) (Table 4). Among them, 15 were isolated from pork. In the 23 MRSA isolates, one was negative for the detection of mecA gene. Its oxacillin resistance may come from the harboring of other mec genes such as mecB or mecC. Among these MRSA isolates, 19 (82.6%) were multidrug resistant. In our previous report (Song et al., 2015), the isolation rate of MRSA in Shanghai was 5.6%. It has an increasing trend these years, which should draw more attention. There was excessive use of antimicrobials in livestock and poultry farming in China (Ben, Qiang, Adams, Zhang, & Chen, 2008; Lam, Remais, Fung, Xu, & Sun, 2013; Van Boeckel et al., 2017). Large amounts of AMR bacteria were generated in animals due to this abuse. These resistant bacteria then entered food chain by adhering to animalderived raw materials, implying food as a potential pathway for AMR dissemination (Oniciuc, Nicolau, Hernández, & Rodríguez-Lázaro, 2017). Therefore, it is vital to investigate the contamination of S. aureus from diverse animal-based food samples. For antimicrobial susceptibility analysis, similar to previous reports, the isolates were the most resistant to PEN, which was closely related to the most widespread use of this antimicrobial (Wang et al., 2018). The 15 isolates from pork products were defined as MRSA. Swine was the most important host for MRSA in previous reports (Bi et al., 2018). It is worth noting that there may be great risk for MRSA dissemination through pork since pork is the main animal-based food in China.

The AMR profile of S. aureus isolates associated with seven food types excluding milk was shown in Fig. 1. It demonstrated that 90.3% (149/165) of S. aureus isolates were drug-resistant. Most of the isolates were resistant to PEN (82.4%, 136/165), followed by ERY (57.6%, 95/ 165), TCY (27.9%, 46/165), CLI (21.2%, 35/165) and SXT (10.3%, 17/ 165). All the S. aureus isolates were susceptible to VAN. Total 65 isolates (39.4%) were multidrug resistant, including 44.4% (20/45), 43.8% (7/16) and 43.7% (31/71) isolates from chicken, beef and pork,

Duration

Isolate number

Fig. 1. The AMR profile of S. aureus isolates. PEN, penicillin; ERY, erythromycin; TCY, tetracycline; CLI, clindamycin; SXT, trimethoprim-sulfamethoxazole; OXA, oxacillin; CIP, ciproflfloxacin; DAP, daptomycin; CHL, chloramphenicol; LNZ, linezolid; RIF, rifampin; GEN, gentamicin.

3.2. Antimicrobial susceptibility of S. aureus isolates

Season

wing breast foot thigh offal

Sample number

3

Food Control 112 (2020) 107106

C. Ou, et al.

Table 4 Information of 23 MRSA isolates.

Note, “+” means mecA-positive, “-” means mecA-negative, black square means resistance to the corresponding antimicrobial.

3.3. Biofilm formation ability of S. aureus isolates

Table 5 Information of 18 extremely strong biofilm producers.

The ODc of biofilm formation in this study was about 0.08. It turned out that 64.8% (107/165) of the S. aureus isolates had strong biofilm formation ability ( > 0.33), 20.0% (33/165) were moderate biofilm producers (0.16–0.33), and the rest (15.2%, 25/165) had weak BFA (0.08–0.16). No one was negative biofilm producer. Among them, 18 isolates had extremely strong BFA (> 3, Table 5). Remarkably, 13 (72.2%) of them were isolated from wet markets. The further analysis indicated that significant difference (p＜0.01) was found in biofilm formation ability between those isolates from supermarkets and wet markets (Fig. 2). The possible reason is that the incomplete implementation of Good Manufacturing Practices (GMP) in wet markets generated fluctuating environments, especially temperature. Then the S. aureus strains shedding in wet markets had to form biofilm for their survival. Surface properties of food samples can be an important factor to determine the colonization of S. aureus strains (Hamadi et al., 2014; Vázquez-Sánchez, Habimana, & Holck, 2012). Theoretically, the bacterial BFA from different food categories should be diverse. Therefore, the biofilm formation ability of those isolates from different types of food samples was compared and analyzed. As shown in Fig. 3, S. aureus with different levels of biofilm forming ability can be isolated from all

Location

Sample

Isolate

Supermarket

pork pork chicken chicken beef duck aquatic product aquatic product aquatic product aquatic product pork pork pork pork pork chicken chicken chicken

SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF SJTUF

Wet market

4

BFA 21500 21404 21362 21462 21360 21476 21478 21402 21401 21395 21368 21370 21495 21369 21376 21400 21399 21394

6.0282 3.0428 3.0946 3.0232 3.0920 5.9806 5.9520 3.4021 3.3638 3.2796 3.4210 3.3272 3.2427 3.1996 3.0485 3.2118 3.1908 3.0810

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.0429 0.0483 0.2118 0.1390 0.1528 0.0439 0.0407 0.1160 0.0903 0.1005 0.0470 0.0861 0.1999 0.1857 0.2549 0.1007 0.2395 0.0386

Food Control 112 (2020) 107106

C. Ou, et al.

and ST1 and ST2315 were grouped into CC1920, but ST5, ST25, ST59 and ST4513 were even founded by different clonal complex. In this study, ST7 is the dominant sequence type, while STs such as ST398 prevalent in livestock were not found. ST7 was also found to be the predominant STs in previous studies. It has been reported as the fourth prevalent clone isolated from human invasive infections in Europe (Gu et al., 2015; Hajo et al., 2010; Wu et al., 2018; Yu et al., 2015). This indicated that the main source of pollution may come from human hands and food cross-contamination. As shown in Fig. 4, for those PEN and ERY resistant isolates, their AMR gene composition was completely consistent with their AMR phenotype; however, for other antimicrobial resistant isolates, it was inconsistent between their AMR phenotypes and AMR gene compositions. For instance, AMR genes such as mgrA or rpoB may lead potential resistance to CIP/TCY/PEN/OXA/VAN/DAP/RIF, but the isolates containing these AMR genes in the study did not pose such AMR phenotypes. OXA resistance is a criterion to determine MRSA, however, when the antimicrobial susceptibility results are borderlined, it is an alternative method for MRSA classification to detect the existence of mecA gene by PCR. Among the 19 genome-sequenced isolates, 5 isolates resistant to OXA were harboring mecA gene. Additionally, one isolate was oxacillin-susceptible but mecA-positive.

Fig. 2. Comparison of biofilm formation ability at different sampling places. W and S represent collected from wet market and supermarket, respectively. “**” represents statistical significance on biofilm formation ability of isolates between different sampling places (p < 0.01).

kinds of animal-based foods. The mean value of biofilm forming ability (OD595) of S. aureus from different sources is at the similar level. It seems that the common characteristics of food substrate (such as viscosity) play a more vital role in the successful colonization of S. aureus than the difference of food surface properties and bacterial species. In other words, food can be a very good adhesive medium and reservoir for S. aureus.

3.5. Correlation between biofilm formation ability and antimicrobial resistance Combining all the data in this study, the correlation between biofilm formation ability and antimicrobial resistance was analyzed. The biofilm formation ability was divided into three grades: weak (W), moderate (M) and strong (S). The antimicrobial resistance was also divided into three grades: sensitive (sensitive to all antimicrobials), drug resistance (resistant to 1–2 antimicrobials), and multidrug resistance (resistant to 3 or more antimicrobials), corresponding to 1, 2 and 3, respectively. The plot was drawn by converting the isolate number falling into each grade into percentage. The darker the color is, the higher the proportion is. As shown in Fig. 5, most of the isolates with drug-resistance characteristics have a high level of biofilm formation ability (the upper right corner is darker in color). It shows that there is a certain correlationship between the biofilm formation ability and antimicrobial resistance. Interestingly, the biofilm formation ability of multidrug resistant isolates was a little weaker than those drug resistant isolates. On the other hand, it is hard to presume that the isolates with strong biofilm formation ability have a high level of drug-resistance.

3.4. WGS analysis on multidrug resistant isolates Nineteen multidrug resistant isolates with strong biofilm formation ability were subjected to whole genome sequencing (Fig. 4). Eleven were from pork, 6 were from chicken, and 2 were from beef. These isolates were performed to whole genome sequencing and the data was analyzed. Upload the assembled. fasfa file to database of the website “CGE Server” for BLAST. The results showed that there were eight sequence types (STs), and the most prevalent one was ST7 (7/19), followed by ST59 (3/19), ST1 (2/19), and ST25 (2/19). Each sequence type from ST5, ST943, ST4513 and ST2315 contains only one isolate. SJTUF 21381 cannot fall into any sequence type but is nearer to ST943. According to eBURST analysis, ST7 and ST943 were grouped into CC7,

Fig. 3. Comparison of the ability of S. aureus biofilm formation from different types of food. The thick horizontal line in this figure represents the average level, and each point corresponds to the biofilm formation ability (OD595) of isolate. The distribution of the same type of points can show the degree of data dispersion. 5

Food Control 112 (2020) 107106

C. Ou, et al.

Fig. 4. Phylogenetic tree of 19 genome-sequenced S. aureus isolates with antimicrobial resistant phenotype and corresponding genes.

References Ben, W., Qiang, Z., Adams, C., Zhang, H., & Chen, L. (2008). Simultaneous determination of sulfonamides, tetracyclines and tiamulin in swine wastewater by solid-phase extraction and liquid chromatography-mass spectrometry. Journal of Chromatography A, 1202(2), 173–180. https://doi.org/10.1016/j.chroma.2008.07.014. Bhattacharya, M., Berends, E. T. M., Chan, R., Schwab, E., Roy, S., Sen, C. K., et al. (2018). Staphylococcus aureus biofilms release leukocidins to elicit extracellular trap formation and evade neutrophil-mediated killing. Proceedings of the National Academy of Sciences, 115(28), 7416–7421. https://doi.org/10.1073/pnas.1721949115. Bi, Z., Sun, C., Borjesson, S., Chen, B., Ji, X., Berglund, B., et al. (2018). Identical genotypes of community-associated MRSA (ST59) and livestock-associated MRSA (ST9) in humans and pigs in rural China. Zoonoses Public Health, 65(3), 367–371. https://doi. org/10.1111/zph.12443. CARSS (China Antimicrobial Resistance Surveillance System). (2019). China national bacterial resistance surveillance report in 2018. Retrieved from http://www.carss. cn/Report/Details?aId=648. Costerton, J. W. (1999). Bacterial biofilms: A common cause of persistent infections. Science, 284(5418), 1318–1322. https://doi.org/10.1126/science.284.5418.1318. Costerton, J. W., Cheng, K. J., Geesey, G. G., Ladd, T. I., Nickel, J. C., Dasgupta, M., et al. (1987). Bacterial biofilms in nature and disease. Annual Review of Microbiology, 41(1), 435–464. https://doi.org/10.1146/annurev.mi.41.100187.002251. Drenkard, E., & Ausubel, F. M. (2002). Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature, 416(6882), 740–743. https:// doi.org/10.1038/416740a. Falagas, M. E., Koletsi, P. K., & Bliziotis, I. A. (2006). The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. Journal of Medical Microbiology, 55(12), 1619–1629. https://doi.org/10.1099/jmm.0.46747-0. Gu, F. F., Hou, Q., Yang, H. H., Zhu, Y. Q., Guo, X. K., Ni, Y. X., et al. (2015). Characterization of Staphylococcus aureus isolated from non-native patients with skin and soft tissue infections in Shanghai. PLoS One, 10(4), e0123557. https://doi. org/10.1371/journal.pone.0123557. Hajo, G., Aanensen, D. M., Wijngaard, C. C., Van Den, Spratt, B. G., Dag, H., et al. (2010). Geographic distribution of Staphylococcus aureus causing invasive infections in Europe: A molecular-epidemiological analysis. PLoS Medicine, 7(1), e1000215. https://doi.org/10.1371/journal.pmed.1000215. Hall-Stoodley, L., Costerton, J. W., & Stoodley, P. (2004). Bacterial biofilms: From the natural environment to infectious diseases. Nature Reviews Microbiology, 2(2), 95–108. https://doi.org/10.1038/nrmicro821. Hamadi, F., Asserne, F., Elabed, S., Bensouda, S., Mabrouki, M., & Latrache, H. (2014). Adhesion of Staphylococcus aureus on stainless steel treated with three types of milk. Food Control, 38, 104–108. https://doi.org/10.1016/j.foodcont.2013.10.006. Lam, H.-M., Remais, J., Fung, M.-C., Xu, L., & Sun, S. S.-M. (2013). Food supply and food safety issues in China. The Lancet, 381(9882), 2044–2053. https://doi.org/10.1016/ s0140-6736(13)60776-x. Moormeier, D. E., & Bayles, K. W. (2017). Staphylococcus aureus biofilm: A complex developmental organism. Molecular Microbiology, 104(3), 365–376. https://doi.org/ 10.1111/mmi.13634. Ohadian Moghadam, S., Pourmand, M. R., & Aminharati, F. (2014). Biofilm formation and antimicrobial resistance in methicillin-resistant Staphylococcus aureus isolated from burn patients, Iran. The Journal of Infection in Developing Countries, 8(12), 1511–1517. https://doi.org/10.3855/jidc.5514. Oniciuc, E.-A., Nicolau, A. I., Hernández, M., & Rodríguez-Lázaro, D. (2017). Presence of methicillin-resistant Staphylococcus aureus in the food chain. Trends in Food Science & Technology, 61, 49–59. https://doi.org/10.1016/j.tifs.2016.12.002. O'Neill, J. (2016). Antimicrobial resistance: Tackling a crisis for the health and wealth of

Fig. 5. The relationship between biofilm formation ability and antimicrobial resistance of S. aureus isolates. The abscissa indicates antimicrobial resistance, which was divided into 3 categories. 1 represents sensitive (sensitive to all antimicrobials), 2 represents drug resistant (resistant to 1–2 antimicrobials), 3 represents MDR (resistant to 3 or more antimicrobials). The ordinate represents the biofilm formation ability, which was divided into three levels, W represents weak, M represents moderate, and S represents strong.

4. Conclusion In summary, this study investigated the prevalence, antimicrobial resistance and biofilm formation of S. aureus among animal-based food in Shanghai. The overall contamination rate was 17.2% among 959 food samples. Among the 165 isolates, 90.3% were resistant toat least one antimicrobial, and 64.8% had strong biofilm formation ability. Indeed, the drug resistant isolates tend to be stronger biofilm producers.

Acknowledgements This study was supported by the National Key R&D program of China (No. 2017YFC1600100) and the National Natural Science Foundation of China (No. 31671943). 6

Food Control 112 (2020) 107106

C. Ou, et al.

Staphylococcus aureus isolates. Current Microbiology, 66. https://doi.org/10.1007/ s00284-012-0247-8. Wang, H., Wang, H., Liang, L., Xu, X., & Zhou, G. (2018). Prevalence, genetic characterization and biofilm formation in vitro of staphylococcus aureus isolated from raw chicken meat at retail level in Nanjing, China. Food Control, 86, 11–18. https:// doi.org/10.1016/j.foodcont.2017.10.028. Wu, S., Huang, J., Wu, Q., Zhang, J., Zhang, F., Yang, X., et al. (2018). Staphylococcus aureus isolated from retail meat and meat products in China: Incidence, antibiotic resistance and genetic diversity. Frontiers in Microbiology, 9, 2767. https://doi.org/10. 3389/fmicb.2018.02767. Yu, F., Liu, Y., Lv, J., Qi, X., Lu, C., Ding, Y., et al. (2015). Antimicrobial susceptibility, virulence determinant carriage and molecular characteristics of Staphylococcus aureus isolates associated with skin and soft tissue infections. Brazilian Journal of Infectious Diseases, 19(6), 614–622. https://doi.org/10.1016/j.bjid.2015.08.006. Zhang, Y., Xu, D., Shi, L., Cai, R., Li, C., & Yan, H. (2018). Association between agr type, virulence factors, biofilm formation and antibiotic resistance of Staphylococcus aureus isolates from pork production. Frontiers in Microbiology, 9, 1876. https://doi. org/10.3389/fmicb.2018.01876.

nations. Review on Antimicrobial Resistance, 12, 1–16. Retrieved from http://amrreview.org. Savage, V. J., Chopra, I., & O'Neill, A. J. (2013). Staphylococcus aureus biofilms promote horizontal transfer of antibiotic resistance. Antimicrobial Agents and Chemotherapy, 57(4), 1968–1970. https://doi.org/10.1128/aac.02008-12. Song, M. H., Bai, Y. L., Xu, J., Carter, M. Q., Shi, C. L., & Shi, X. M. (2015). Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. International Journal of Food Microbiology, 195, 1–8. https://doi.org/10.1016/j.ijfoodmicro.2014.11.020. Tacconelli, E., Carrara, E., Savoldi, A., Harbarth, S., Mendelson, M., Monnet, D. L., et al. (2018). Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. The Lancet Infectious Diseases, 18(3), 318–327. https://doi.org/10.1016/S1473-3099(17)30753-3. Van Boeckel, T. P., Glennon, E. E., Chen, D., Gilbert, M., Robinson, T. P., Grenfell, B. T., et al. (2017). Reducing antimicrobial use in food animals. Science, 357(6358), 1350–1352. https://doi.org/10.1126/science.aao1495. Vázquez-Sánchez, D., Habimana, O., & Holck, A. (2012). Impact of food-related environmental factors on the adherence and biofilm formation of natural

7