- Email: [email protected]
Prevalence of severe fever with thrombocytopenia syndrome virus in black goats (Capra hircus coreanae) in the Republic of Korea
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Prevalence of severe fever with thrombocytopenia syndrome virus in black goats (Capra hircus coreanae) in the Republic of Korea Jun-Gu Kanga, Yoon-Kyoung Choa, Yong-Sun Joa, Jeong-Byoung Chaea, Sung-Suck Oha, Kye-Hyung Kimb, Mee-Kyung Koc, Jongyoun Yic, Kyoung-Seong Choid, Do-Hyeon Yue, Hyeon-Cheol Kimf, Jinho Parkg, Bae-Keun Parkh, Chang-Yong Choii, Young-Hun Jungi, ⁎ Joon-Seok Chaea, a Laboratory of Veterinary Internal Medicine, BK21 Plus Program for Creative for Veterinary Science Research, Research Institute of Veterinary Science and College of Veterinary Medicine, Seoul National University, Seoul 08826, Republic of Korea b Division of Infectious Diseases, Department of Internal Medicine, Pusan National University School of Medicine, Busan 49241, Republic of Korea c Department of Laboratory Medicine, Pusan National University School of Medicine, Busan 49241, Republic of Korea d College of Ecology and Environmental Science, Kyungpook National University, Sangju 37224, Republic of Korea e College of Veterinary Medicine, Gyeongsang National University, Jinju 52828, Korea f College of Veterinary Medicine, Gangwon National University, Chuncheon, Gangwon 24341, Republic of Korea g College of Veterinary Medicine, Chonbuk National University, Iksan 54596, Republic of Korea h Research Institute of Veterinary Medicine and College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Republic of Korea i National Institute of Animal Science, RDA, Jeonju 55365, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: Severe fever with thrombocytopenia syndrome virus Goat Prevalence RT-PCR IFA Republic of Korea
Severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging tick-borne pathogen in China, Japan, and the Republic of Korea (ROK). The aim of this study was to investigate the prevalence of SFTSV antigens and anti-SFTSV antibodies in black goats (Capra hircus coreanae) throughout the ROK. Sera were collected from 737 black goats in nine provinces in the ROK. Eighteen of 737 (2.4%) goat sera were positive for SFTSV on one-step reverse transcription nested polymerase chain reaction. The amplified 346-bp S segments of SFTSV sequences were classified into three genotypes (BG1, BG2, and BG3), and were included in the Japanese clade rather than the Chinese clade, based on phylogenetic analysis. Forty-three of 624 (6.9%) serum samples were seropositive for anti-SFTSV antibodies on enzyme-linked immunosorbent assay analysis. This study is the first to examine the molecular prevalence of SFTSV in goats and the first to perform serological detection of antiSFTSV antibodies in livestock in the ROK. Moreover, the results indicate that SFTSV is widely distributed in goats and that additional monitoring for SFTSV is needed in livestock in the ROK.
1. Introduction Severe fever with thrombocytopenia syndrome (SFTS) virus is a novel tick-borne Phlebovirus in the family of Bunyaviridae and a causative agent of an emerging infectious disease, SFTS, in China, Japan, and the Republic of Korea (ROK); this disease is mainly characterized by fever, leukopenia and thrombocytopenia (Yu et al., 2011; Kim et al., 2013; Takahashi et al., 2014). The SFTS virus (SFTSV) exhibits three single-stranded negative-sense RNA segments, which consist of S, M, and L segments (Yu et al., 2011). The S segment encodes non-structural and nucleocapsid proteins, which are essential for viral RNA encapsidation and replication; the M segment encodes glycoproteins C and N, essential viral envelope components; and the L segment encodes
⁎
an RNA-dependent RNA polymerase (Yu et al., 2011; Zhou et al., 2013). The RNA of SFTSV has been detected in Haemaphysalis longicornis, Haemaphysalis flava, Ixodes nipponensis, and Rhipicephalus microplus (Yu et al., 2011; Liu et al., 2014; Park et al., 2014; Oh et al., 2016; Yun et al., 2016). Recently, SFTSV was isolated from unfed H. longicornis that was collected by the dragging and flagging, rather than from fed ticks (Yun et al., 2016). Moreover, H. longicornis could transstadially survival and transovarially transmit SFTSV to ticks in other developmental stages; it could also transmit SFTSV to goat and mouse (Luo et al., 2015; Jiao et al., 2015). In the ROK, H. longicornis is a dominant tick species in the environment and on several mammals (Kim et al., 2006 and 2011; Park et al., 2014; Kang et al., 2016; Oh et al., 2016; Yun et al., 2016); most ROK residents have been exposed to this tick species
Corresponding author at: Veterinary Internal Medicine, College of Veterinary Medicine, Seoul National University, Seoul 08826, Republic of Korea. E-mail address: [email protected] (J.-S. Chae).
https://doi.org/10.1016/j.ttbdis.2018.04.018 Received 27 December 2017; Received in revised form 24 April 2018; Accepted 25 April 2018 1877-959X/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: Kang, J.-G., Ticks and Tick-borne Diseases (2018), https://doi.org/10.1016/j.ttbdis.2018.04.018
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
2.3. Nucleotide sequencing and phylogenetic analysis
(Yun et al., 2014). These studies indicate that H. longicornis serves as a main vector for SFTSV transmission. Many clinical cases of SFTS in humans have been documented in Japan, China, and the ROK; however, clinical cases of SFTS in animals have not yet been reported (Liu et al., 2015; Choi et al., 2016; Kato et al., 2016). However, molecular and serological surveys have been conducted to determine SFTSV exposure in various animals in China and Japan, including dogs, sheep, goats, chickens, wild boar, pigs, minks, and cattle (Niu et al., 2013; Ding et al., 2014; Li et al., 2014; Hayasaka et al., 2016; Wang et al., 2017). In addition, experimental studies have been conducted to investigate transmission and circulation of SFTSV in mice, dogs, and goats in China (Niu et al., 2013; Jiao et al., 2015; Ni et al., 2015). In the ROK, the RNA of SFTSV has been detected in dogs, cats, Korean water deer (Hydropotes inermis) and wild boar (Sus scrofa) (Oh et al., 2016; Hwang et al., 2017; Lee et al., 2017a). Moreover, the seroprevalence of anti-SFTSV antibodies in dogs, within the ROK, has been reported using indirect immunofluorescence assay (IFA) and virus neutralization (Lee et al., 2017b). The highest seroprevalence of anti-SFTSV antibodies among domestic mammals has been reported in goats raised in China (Jiao et al., 2012; Zhao et al., 2012), suggesting that goats experience significant exposure to SFTSV in their natural environment. In addition, several studies have shown that H. longicornis is a dominant tick species on goats (Kang et al., 2016; Zhang et al., 2017). However, to the best of our knowledge, there have been no published studies of the prevalence of SFTSV infection in livestock, or in goats, in the ROK. Therefore, the aim of this study was to determine the prevalence of SFTSV antigens and anti-SFTSV antibodies in black goats throughout the ROK.
Purified PCR products were cloned with pGEM-T Easy Vectors (Promega, USA), followed by transformation into Escherichia coli JM109, then plated onto LB agar containing 100 ug/mL of ampicillin. Plasmid DNA was purified using the Wizard® Plus SV Minipreps DNA Purification system (Promega) and was sequenced using an automatic sequencer (3730xl capillary DNA Analyzer; Applied Biosystems, USA). Sequence data were analyzed using Chromas software (Ver 2.44). To compare sequences from this study with sequences that had previously been deposited in GenBank, sequences were aligned using Clustal X (Ver 2.1) and analyzed with MEGA 7 (Kumar et al., 2016). Phylogenetic trees were constructed using a Maximum Likelihood method based on the Kimura 2-parameter model; the data set was resampled 1000 times to generate bootstrap values. 2.4. Double-antigen sandwich enzyme linked immunosorbent assay (ELISA) Double-antigen sandwich ELISA procedure was performed to detect total antibodies (including IgG and IgM) in serum samples, as described previously (Jiao et al., 2012). Recombinant nucleocapsid protein (rNP) of the first Korean SFTSV strain (GenBank accession no. KF358693) was adsorbed to the solid phase, and horseradish peroxidase-conjugated rNP was added after application of serum. Each serum sample was tested in duplicate, and the positive and negative controls were tested in quadruplicate. Optical density (OD) at 450 nm was measured after adding tetramethylbenzidine (Thermo Scientific, Waltham, MA, USA) and a stop solution. Each result was expressed as a percentage of the positive control serum, using the following formula: (OD of test serum/mean OD of positive-control serum) × 100. Cutoff value was determined as mean value plus three standard deviations (mean + (3 × SD), derived from a percentage of the positive control values in the negative-control serum.
2. Materials and methods 2.1. Sample collection All procedures with animals were performed in accordance with the guidelines of the National Research Council for Care of Laboratory Animals. Whole-blood samples were collected from black goats (Capra hircus coreanae) in 2014–2015, throughout the ROK. Sera were separated from whole-blood samples by centrifugation, then stored at −80 °C until use. A total of 200 μL serum was used for RNA extraction via the Gene-spin™ Viral DNA/RNA Extraction Kit (Intron Biotechnology, Korea), according to the manufacturer’s protocol. Resultant RNA samples were stored at −80 °C deep freezer until assayed.
3. Results A total of 737 goat sera were collected from Gwangwon-do (n = 20), Gyeonggi-do (n = 31), Gyengsangbuk-do (n = 25), Gyengsangnam-do (n = 13), Chungcheongbuk-do (n = 115), Chungcheongnam-do (n = 24), Jeollabuk-do (n = 375), Jeollanam-do (n = 130), and Jeju-do (n = 4) provinces (Table 1, Fig. 1). Eighteen of 737 (2.4%) goat sera were positive for SFTSV on RT-PCR. The amplified 346-bp S segments of SFTSV sequences were classified into three genotypes including BG1 (KX672013), BG2 (KX672014), and BG3 (KX672015). The BG1 genotype was detected in nine different samples and was identical to the sequence identified in a cat in the ROK (KP994430). The BG2 genotype was detected in two goat sera and exhibited 99.4% identity to the KP994430 sequence (the BG1 genotype). In contrast, the BG3 genotype, detected in seven goat sera, was included in a different sub-clade from BG1 and BG2 (Fig. 1), and was
2.2. One-step reverse transcriptase-nested polymerase chain reaction (RTnested PCR) One-step RT-nested PCR was performed to amplify the S segment of the SFTS viral RNA genome, using SFTSV genome-specific primer sets for PCR. The first set of PCR primers used were forward primer (NP-2F: CATCATTGTCTTTGCCCTGA) and reverse primer (NP-2R: AGAAGACA GAGTTCACAGCA). The nested PCR primers used were forward primer (NP-2F: AAYAAGATCGTCAAGGCATCA) and reverse primer (NP-2R: TAGTCTTGGTGAAGGCATCTT) (Yoshikawa et al., 2014; Oh et al., 2016). The SFTSV used for positive control was kindly provided by Dr. Park (Gachon University of Medicine and Science, Inchon, Korea). PCR amplifications were performed in a reaction mixture (30 μL) containing 1.5 μL (10 pmol) of each forward and reverse primer, 4 μL of extracted RNA, 8 μL of TE buffer and 15 μL of one-step RT-PCR premix (Solgent, Korea). Reverse transcription (RT) reactions were incubated at 50 °C for 30 min, followed by 94 °C for 5 min. The amplification was performed according to the following conditions: 20 s at 94 °C, 40 s at 52 °C, and 30 s at 72 °C, for 40 cycles (first PCR) and 25 cycles (nested PCR), followed by a final extension step at 72 °C for 5 min. PCR products were visualized by gel electrophoresis using a 1.5% agarose gel, then purified using QIAquick Gel Extraction Kits (Qiagen, Germany).
Table 1 Prevalence of severe fever with thrombocytopenia syndrome virus in RT-PCR and ELISA assay of goat sera from the Republic of Korea.
2
Province
No. of samples
No. of PCR positive/ Tested samples (Positive rates, %)
Gwangwon-do Gyeonggi-do Gyengsangbuk-do Gyengsangnam-do Chungcheongbuk-do Chungcheongnam-do Jeollabuk-do Jeollanam-do Jeju-do Total
20 31 25 13 115 24 130 375 4 737
0/20 (0) 2/31 (6.5) 2/25 (8.0) 0/13 (0) 2/115 (1.7) 0/24 (0) 5/130 (3.9) 7/375 (1.9) 0/4 (0) 18/737 (2.4)
No. of ELISA positive/Tested samples (Positive rates, %) 3/20 (15.0) 2/31 (6.5) 1/25 (4.0) 1/13 (7.7) 4/114 (3.5) 6/24 (25.0) 0/30 (0) 25/363 (6.9) 1/4 (25.0) 43/624 (6.9)
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
Fig. 1. Map of the Republic of Korea, showing the nine provinces. GG, Gyeonggi-do; GW, Gangwon-do; CB, Chungcheongbuk-do; CN, Chungcheongnam-do; JB, Jeollabuk-do; JN, Jeollanam-do; GB, Gyeongsangbuk-do; GN, Gyeongsangnam-do; JJ, Jeju-do.
conducted in an area limited to SFTS-endemic regions, while our samples were collected throughout the ROK; 2) Our studies differed in the reference virus strains used for ELISA assay, based on available rNP sequence data; 3) The goats included in Chinese studies were raised by the free-range method, while most of goats included in this study were raised by the confined-range method. Free-ranging livestock may have a higher exposure risk to tick bite, thereby increasing the likelihood of being bitten by SFTSV-infected ticks; this could contribute to the high seroprevalence. The prevalences of SFTSV RNA in animals (except feral cats) have been reported as between 0.2%–5.3% in China and the ROK (Niu et al., 2013; Liu et al., 2014; Oh et al., 2016; Lee et al., 2017a). Our prevalence rate of SFTSV RNA in goats was 2.4%, which was higher than the rate in shelter animals and chicken, but lower than the rate in cattle, sheep, dogs, pigs, and wild animals. These different rates may be associated with their habitats, body sizes, and environments. Moreover, the molecular prevalence of SFTSV is lower than the seroprevalence of anti-SFTSV antibodies in animals, which suggests that the infected animals may experience a short period of viremia, a low level of viremia, or a rapid production of antibodies against SFTSV. Indeed, some studies have shown that goats infected with SFTSV exhibit a transient viremia lasting for < 24 h, and that dogs infected with SFTSV demonstrate detectable viral RNA on days 8 and 10 post-infection (Niu et al., 2013; Jiao et al., 2015). However, neither transmission nor persistent infection of SFTSV in animals has been proven, and further studies are needed to understand SFTSV transmission in nature. In recent phylogenetic studies of SFTSV, this virus has been classified into two clades: a Chinese clad and a Japanese clade (Yoshikawa et al., 2014). The 18 sequences obtained from this study were classified into three genotypes, included in the Japanese clade (Fig. 2). Moreover, BG1 and BG2 genotypes were clustered with many Korean strains, while the BG3 genotype was clustered with Korean and Japanese strains (Fig. 2). These findings are consistent with previous studies, which indicate that Korean SFTSV strains are more related to the Japanese clade than the Chinese clade, and that various sub-clades of SFTSV exist in the ROK. In conclusion, the present study is the first to report molecular and serological detection of SFTSV in goats in the ROK; further, it indicates that SFTSV is widely distributed in goats throughout the ROK. Moreover, these results suggest that continuous and large-scale surveillance is needed to monitor SFTSV distribution and incidence in the ROK. Therefore, further studies, such as whole genome analysis of various animal-derived SFTSV isolates, and mapping of environmental
99.7% identical to sequences that were identified in humans in the ROK (KP663739) and Japan (AB817995) (Fig. 2). Of 624 serum samples (113 of the original sera could not be tested for ELISA), 43 (6.9%) were positive for anti-SFTSV antibodies, on ELISA analysis. SFTSV prevalence for each province is described in Table 1. SFTSV genomes were detected in five out of nine provinces. However, SFTSV antibodies were detected in eight provinces, except Jeollabuk-do province, in the ROK. No sample exhibited dual positivity for both SFTSV antigen and anti-SFTSV antibody. 4. Discussion To date in the ROK, there have been four SFTSV studies in animals: 0.2% (1/426) of shelter dogs, 0.5% (1/215) of shelter cats, 17.5% (22/ 126) of feral cats, 4.8% (1/21) of Korean water deer, and 3.7% (2/54) of wild boar were positive for SFTSV by RT-PCR; 13.9% (59/426) of shelter dogs were positive for anti-SFTSV antibodies by IFA (Oh et al., 2016; Hwang et al., 2017; Lee et al., 2017a,b). In the present study, 2.4% (18/737) of goats were positive for SFTSV by RT-nested PCR; 6.9% (43/624) of goats were positive for anti-SFTSV antibody on ELISA analysis. Although SFTSV RNA was detected in goats in a previous study (Jiao et al., 2015), to our knowledge, this study is the first to estimate molecular prevalence of SFTSV in goats, and the first to perform serological detection of anti-SFTSV antibodies in livestock, in the ROK. Although SFTSV is mainly transmitted to humans through tick biting (Yu et al., 2011; Kim et al., 2013; Yun et al., 2014), accidental person-to-person transmission of SFTSV, via contact with blood and body fluid, has been reported (Bao et al., 2011; Liu et al., 2012; Kim et al., 2015; Huang et al., 2017). However, there have been no reports of animal-to-animal, or animal-to-human, transmission of SFTSV without ticks. Recently, a study was published regarding the natural infection rate in goats, as they demonstrate higher seroprevalence for SFTSV exposure. In that study, goats that were inoculated with SFTSV did not shed SFTSV, either through the digestive or respiratory routes, and exhibited no clinical signs of disease; further, they had a very short viremic period (Jiao et al., 2015). On the other hand, other studies in SFTS-endemic regions (Shandong and Jiangsu Province) of China found anti-SFTSV antibody positivity at rates of 66.8–82.8% in goats (Jiao et al., 2012; Zhao et al., 2012; Li et al., 2014). However, our results indicate lower seroprevalence, compared with the previous studies in China. This difference between the Chinese studies and our results could be explained by several factors: 1) Chinese studies were 3
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
Fig. 2. Phylogenetic analysis of SFTSV based on the partial S segment (346 bp). The sequences identified in this study are indicated by bold letters. Evolutionary history was inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model (1000 bootstrap replicates). The percentage of trees in which associated taxa clustered together is shown next to the branches. Scale bar indicates number of nucleotide substitutions per position.
Acknowledgments
virus circulation routes in nature, are necessary to understand the genetic diversity and evolution of SFTSV.
This research was supported by a fund (no. Z-1543085-2014-140102) from Research of Animal and Plant Quarantine Agency and was partially supported fund from the “Cooperative Research Program for Agriculture Science & Technology Development (project no. PJ010092)”, Rural Development Administration, the Republic of Korea. This research was also partially contributed funding from the Basic Science Research Program through the National Research Foundation
Conflict of interest The authors have no conflict of interest.
4
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
of Korea funded by 2015R1C1A1A01054518).
the
Ministry
of
Education
(NRF-
2012. Person-to-person transmission of severe fever with thrombocytopenia syndrome virus. Vector Borne Zoon. Dis. 12, 156–160. Liu, Q., He, B., Huang, S.Y., Wei, F., Zhu, X.Q., 2014. Severe fever with thrombocytopenia syndrome, an emerging tick-borne zoonosis. Lancet Infect. Dis. 14, 763–772. Liu, K., Zhou, H., Sun, R.X., Yao, H.W., Li, Y., Wang, L.P., Mu, D., Li, X.L., Yang, Y., Gray, G.C., Cui, N., Yin, W.W., Fang, L.Q., Yu, H.J., Cao, W.C., 2015. A national assessment of the epidemiology of severe fever with thrombocytopenia syndrome. China Sci. Rep. 5, 9679. Luo, L.M., Zhao, L., Wen, H.L., Zhang, Z.T., Liu, J.W., Fang, L.Z., Xue, Z.F., Ma, D.Q., Zhang, X.S., Ding, S.J., Lei, X.Y., Yu, X.J., 2015. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg. Infect. Dis. 21, 1770–1776. Ni, H., Yang, F., Li, Y., Liu, W., Jiao, S., Li, Z., Yi, B., Chen, Y., Hou, X., Hu, F., Ding, Y., Bian, G., Du, Y., Xu, G., Cao, G., 2015. Apodemus agrarius is a potential natural host of severe fever with thrombocytopenia syndrome (SFTS)-causing novel bunyavirus. J. Clin. Virol. 71, 82–88. Niu, G., Li, J., Liang, M., Jiang, X., Jiang, M., Yin, H., Wang, Z., Li, C., Zhang, Q., Jin, C., Wang, X., Ding, S., Xing, Z., Wang, S., Bi, Z., Li, D., 2013. Severe fever with thrombocytopenia syndrome virus among domesticated animals, China. Emerg. Infect. Dis. 19, 756–763. Oh, S.S., Chae, J.B., Kang, J.G., Kim, H.C., Chong, S.T., Shin, J.H., Hur, M.S., Suh, J.H., Oh, M.D., Jeong, S.M., Shin, N.S., Choi, K.S., Chae, J.S., 2016. Detection of severe fever with thrombocytopenia syndrome virus from wild animals and Ixodidae ticks in the Republic of Korea. Vector Borne Zoon. Dis. 16, 408–414. Park, S.W., Song, B.G., Shin, E.H., Yun, S.M., Han, M.G., Park, M.Y., Park, C., Ryou, J., 2014. Prevalence of severe fever with thrombocytopenia syndrome virus in Haemaphysalis longicornis ticks in South Korea. Ticks Tick Borne Dis. 5, 975–977. Takahashi, T., Maeda, K., Suzuki, T., Ishido, A., Shigeoka, T., Tominaga, T., Kamei, T., Honda, M., Ninomiya, D., Sakai, T., Senba, T., Kaneyuki, S., Sakaguchi, S., Satoh, A., Hosokawa, T., Kawabe, Y., Kurihara, S., Izumikawa, K., Kohno, S., Azuma, T., Suemori, K., Yasukawa, M., Mizutani, T., Omatsu, T., Katayama, Y., Miyahara, M., Ijuin, M., Doi, K., Okuda, M., Umeki, K., Saito, T., Fukushima, K., Nakajima, K., Yoshikawa, T., Tani, H., Fukushi, S., Fukuma, A., Ogata, M., Shimojima, M., Nakajima, N., Nagata, N., Katano, H., Fukumoto, H., Sato, Y., Hasegawa, H., Yamagishi, T., Oishi, K., Kurane, I., Morikawa, S., Saijo, M., 2014. The first identification and retrospective study of severe fever with thrombocytopenia syndrome in Japan. J. Infect. Dis. 209, 816–827. Wang, G.S., Wang, J.B., Tian, F.L., Zhang, H.J., Yin, F.F., Xu, C., Xu, D., Huang, Y.T., Yu, X.J., 2017. Severe fever with thrombocytopenia syndrome virus infection in minks in China. Vector Borne Zoon. Dis. 17, 596–598. Yoshikawa, T., Fukushi, S., Tani, H., Fukuma, A., Taniguchi, S., Toda, S., Shimazu, Y., Yano, K., Morimitsu, T., Ando, K., Yoshikawa, A., Kan, M., Kato, N., Motaya, T., Kuzuguchi, T., Nishino, Y., Osako, H., Yumisashi, T., Kida, K., Suzuki, F., Takimoto, H., Kitamoto, H., Maeda, K., Takahashi, T., Yamagishi, T., Oishi, K., Morikawa, S., Saijo, M., Shimojima, M., 2014. Sensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load. J. Clin. Microbiol. 52, 3325–3333. Yu, X.J., Liang, M.F., Zhang, S.Y., Liu, Y., Li, J.D., Sun, Y.L., Zhang, L., Zhang, Q.F., Popov, V.L., Li, C., Qu, J., Li, Q., Zhang, Y.P., Hai, R., Wu, W., Wang, Q., Zhan, F.X., Wang, X.J., Kan, B., Wang, S.W., Wan, K.L., Jing, H.Q., Lu, J.X., Yin, W.W., Zhou, H., Guan, X.H., Liu, J.F., Bi, Z.Q., Liu, G.H., Ren, J., Wang, H., Zhao, Z., Song, J.D., He, J.R., Wan, T., Zhang, J.S., Fu, X.P., Sun, L.N., Dong, X.P., Feng, Z.J., Yang, W.Z., Hong, T., Zhang, Y., Walker, D.H., Wang, Y., Li, D.X., 2011. Fever with thrombocytopenia associated with a novel bunyavirus in China. N. Engl. J. Med. 364, 1523–1532. Yun, S.M., Lee, W.G., Ryou, J., Yang, S.C., Park, S.W., Roh, J.Y., Lee, Y.J., Park, C., Han, M.G., 2014. Severe fever with thrombocytopenia syndrome virus in ticks collected from humans, South Korea, 2013. Emerg. Infect. Dis. 20, 1358–1361. Yun, S.M., Song, B.G., Choi, W., Roh, J.Y., Lee, Y.J., Park, W.I., Han, M.G., Ju, Y.R., Lee, W.J., 2016. First isolation of severe fever with thrombocytopenia syndrome virus from Haemaphysalis longicornis ticks collected in severe fever with thrombocytopenia syndrome outbreak areas in the Republic of Korea. Vector Borne Zoon. Dis. 16, 66–70. Zhang, R., Zhao, A., Wang, X., Zhang, Z., 2017. Diversity of tick species on domestic animals in Shandong Province, China, using DNA barcoding. Exp. Appl. Acarol. 73, 79–89. Zhao, L., Zhai, S., Wen, H., Cui, F., Chi, Y., Wang, L., Xue, F., Wang, Q., Wang, Z., Zhang, S., Song, Y., Du, J., Yu, X.J., 2012. Severe fever with thrombocytopenia syndrome virus, Shandong Province, China. Emerg. Infect. Dis. 18, 963–965. Zhou, H., Sun, Y., Wang, Y., Liu, M., Liu, C., Wang, W., Liu, X., Li, L., Deng, F., Wang, H., Guo, Y., Lou, Z., 2013. The nucleoprotein of severe fever with thrombocytopenia syndrome virus processes a stable hexameric ring to facilitate RNA encapsidation. Protein Cell 4 (6), 445–455.
References Bao, C.J., Guo, X.L., Qi, X., Hu, J.L., Zhou, M.H., Varma, J.K., Cui, L.B., Yang, H.T., Jiao, Y.J., Klena, J.D., Li, L.X., Tao, W.Y., Li, X., Chen, Y., Zhu, Z., Xu, K., Shen, A.H., Wu, T., Peng, H.Y., Li, Z.F., Shan, J., Shi, Z.Y., Wang, H., 2011. A family cluster of infections by a newly recognized bunyavirus in eastern China, 2007: further evidence of person-to-person transmission. Clin. Infect. Dis. 53, 1208–1214. Choi, S.J., Park, S.W., Bae, I.G., Kim, S.H., Ryu, S.Y., Kim, H.A., Jang, H.C., Hur, J., Jun, J.B., Jung, Y., Chang, H.H., Kim, Y.K., Yi, J., Kim, K.H., Hwang, J.H., Kim, Y.S., Jeong, H.W., Song, K.H., Park, W.B., Kim, E.S., Oh, M.D., 2016. Severe fever with thrombocytopenia syndrome in South Korea, 2013–2015. PLoS Negl. Trop. Dis. 10, e0005264. Ding, S., Yin, H., Xu, X., Liu, G., Jiang, S., Wang, W., Han, X., Liu, J., Niu, G., Zhang, X., Yu, X.J., Wang, X., 2014. A cross-sectional survey of severe fever with thrombocytopenia syndrome virus infection of domestic animals in Laizhou City, Shandong Province, China. Jpn. J. Infect. Dis. 67, 1–4. Hayasaka, D., Fuxun, Y., Yoshikawa, A., Posadas-Herrera, G., Shimada, S., Tun, M.M., Agoh, M., Morita, K., 2016. Seroepidemiological evidence of severe fever with thrombocytopenia syndrome virus infections in wild boars in Nagasaki. Japan. Trop. Med. Health 44, 6. Huang, D., Jiang, Y., Liu, X., Wang, B., Shi, J., Su, Z., Wang, H., Wang, T., Tang, S., Liu, H., Hu, Z., Deng, F., Shen, S., 2017. A cluster of symptomatic and asymptomatic infections of severe fever with thrombocytopenia syndrome caused by person-toperson transmission. Am. J. Trop. Med. Hyg. 97, 396–402. Hwang, J., Kang, J.G., Oh, S.S., Chae, J.B., Cho, Y.K., Cho, Y.S., Lee, H., Chae, J.S., 2017. Molecular detection of severe fever with thrombocytopenia syndrome virus (SFTSV) in feral cats from Seoul, Korea. Ticks Tick Borne Dis. 8, 9–12. Jiao, Y., Zeng, X., Guo, X., Qi, X., Zhang, X., Shi, Z., Zhou, M., Bao, C., Zhang, W., Xu, Y., Wang, H., 2012. Preparation and evaluation of recombinant severe fever with thrombocytopenia syndrome virus nucleocapsid protein for detection of total antibodies in human and animal sera by double-antigen sandwich enzyme-linked immunosorbent assay. J. Clin. Microbiol 50, 372–377. Jiao, Y., Qi, X., Liu, D., Zeng, X., Han, Y., Guo, X., Shi, Z., Wang, H., Zhou, M., 2015. Experimental and natural infections of goats with severe fever with thrombocytopenia syndrome virus: evidence for ticks as viral vector. PLoS Negl. Trop. Dis. 9, e0004092. Kang, J.G., Ko, S., Smith, W.B., Kim, H.C., Lee, I.Y., Chae, J.S., 2016. Prevalence of anaplasma, bartonella and borrelia species in haemaphysalis longicornis collected from goats in North Korea. J. Vet. Sci. 17, 207–216. Kato, H., Yamagishi, T., Shimada, T., Matsui, T., Shimojima, M., Saijo, M., Oishi, K., 2016. Epidemiological and clinical features of severe fever with thrombocytopenia syndrome in Japan, 2013–2014. PLoS One 11, e0165207. Kim, C.M., Yi, Y.H., Yu, D.H., Lee, M.J., Cho, M.R., Desai, A.R., Shringi, S., Klein, T.A., Kim, H.C., Song, J.W., Baek, L.J., Chong, S.T., O'guinn, M.L., Lee, J.S., Lee, I.Y., Park, J.H., Foley, J., Chae, J.S., 2006. Tick-borne rickettsial pathogens in ticks and small mammals in Korea. Appl. Environ. Microbiol. 72, 5766–5776. Kim, H.C., Han, S.H., Chong, S.T., Klein, T.A., Choi, C.Y., Nam, H.Y., Chae, H.Y., Lee, H., Ko, S., Kang, J.G., Chae, J.S., 2011. Ticks collected from selected mammalian hosts surveyed in the Republic of Korea during 2008–2009. Korean J. Parasitol. 49, 331–335. Kim, K.H., Yi, J., Kim, G., Choi, S.J., Jun, K.I., Kim, N.H., Choe, P.G., Kim, N.J., Lee, J.K., Oh, M.D., 2013. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg. Infect. Dis. 19, 1892–1894. Kim, W.Y., Choi, W., Park, S.W., Wang, E.B., Lee, W.J., Jee, Y., Lim, K.S., Lee, H.J., Kim, S.M., Lee, S.O., Choi, S.H., Kim, Y.S., Woo, J.H., Kim, S.H., 2015. Nosocomial transmission of severe fever with thrombocytopenia syndrome in Korea. Clin. Infect. Dis. 60, 1681–1683. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lee, S.H., Kim, H.J., Byun, J.W., Lee, M.J., Kim, N.H., Kim, D.H., Kang, H.E., Nam, H.M., 2017a. Molecular detection and phylogenetic analysis of severe fever with thrombocytopenia syndrome virus in shelter dogs and cats in the Republic of Korea. Ticks Tick Borne Dis. 8, 626–630. Lee, S.H., Kim, H.J., Lee, M.J., Byun, J.W., Kim, D.Y., Kim, N.H., Kim, D.H., Kwak, D., Kang, H.E., Nam, H.M., 2017b. 2017. Prevalence of antibodies against severe fever with thrombocytopenia syndrome virus in shelter dogs in the Republic of Korea. Ticks Tick Borne Dis (Epub ahead of print). Li, Z., Hu, J., Bao, C., Li, P., Qi, X., Qin, Y., Wang, S., Tan, Z., Zhu, Y., Tang, F., Zhou, M., 2014. Seroprevalence of antibodies against SFTS virus infection in farmers and animals, Jiangsu, China. J. Clin. Virol. 60, 185–189. Liu, Y., Li, Q., Hu, W., Wu, J., Wang, Y., Mei, L., Walker, D.H., Ren, J., Wang, Y., Yu, X.J.,
5
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Prevalence of severe fever with thrombocytopenia syndrome virus in black goats (Capra hircus coreanae) in the Republic of Korea Jun-Gu Kanga, Yoon-Kyoung Choa, Yong-Sun Joa, Jeong-Byoung Chaea, Sung-Suck Oha, Kye-Hyung Kimb, Mee-Kyung Koc, Jongyoun Yic, Kyoung-Seong Choid, Do-Hyeon Yue, Hyeon-Cheol Kimf, Jinho Parkg, Bae-Keun Parkh, Chang-Yong Choii, Young-Hun Jungi, ⁎ Joon-Seok Chaea, a Laboratory of Veterinary Internal Medicine, BK21 Plus Program for Creative for Veterinary Science Research, Research Institute of Veterinary Science and College of Veterinary Medicine, Seoul National University, Seoul 08826, Republic of Korea b Division of Infectious Diseases, Department of Internal Medicine, Pusan National University School of Medicine, Busan 49241, Republic of Korea c Department of Laboratory Medicine, Pusan National University School of Medicine, Busan 49241, Republic of Korea d College of Ecology and Environmental Science, Kyungpook National University, Sangju 37224, Republic of Korea e College of Veterinary Medicine, Gyeongsang National University, Jinju 52828, Korea f College of Veterinary Medicine, Gangwon National University, Chuncheon, Gangwon 24341, Republic of Korea g College of Veterinary Medicine, Chonbuk National University, Iksan 54596, Republic of Korea h Research Institute of Veterinary Medicine and College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Republic of Korea i National Institute of Animal Science, RDA, Jeonju 55365, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: Severe fever with thrombocytopenia syndrome virus Goat Prevalence RT-PCR IFA Republic of Korea
Severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging tick-borne pathogen in China, Japan, and the Republic of Korea (ROK). The aim of this study was to investigate the prevalence of SFTSV antigens and anti-SFTSV antibodies in black goats (Capra hircus coreanae) throughout the ROK. Sera were collected from 737 black goats in nine provinces in the ROK. Eighteen of 737 (2.4%) goat sera were positive for SFTSV on one-step reverse transcription nested polymerase chain reaction. The amplified 346-bp S segments of SFTSV sequences were classified into three genotypes (BG1, BG2, and BG3), and were included in the Japanese clade rather than the Chinese clade, based on phylogenetic analysis. Forty-three of 624 (6.9%) serum samples were seropositive for anti-SFTSV antibodies on enzyme-linked immunosorbent assay analysis. This study is the first to examine the molecular prevalence of SFTSV in goats and the first to perform serological detection of antiSFTSV antibodies in livestock in the ROK. Moreover, the results indicate that SFTSV is widely distributed in goats and that additional monitoring for SFTSV is needed in livestock in the ROK.
1. Introduction Severe fever with thrombocytopenia syndrome (SFTS) virus is a novel tick-borne Phlebovirus in the family of Bunyaviridae and a causative agent of an emerging infectious disease, SFTS, in China, Japan, and the Republic of Korea (ROK); this disease is mainly characterized by fever, leukopenia and thrombocytopenia (Yu et al., 2011; Kim et al., 2013; Takahashi et al., 2014). The SFTS virus (SFTSV) exhibits three single-stranded negative-sense RNA segments, which consist of S, M, and L segments (Yu et al., 2011). The S segment encodes non-structural and nucleocapsid proteins, which are essential for viral RNA encapsidation and replication; the M segment encodes glycoproteins C and N, essential viral envelope components; and the L segment encodes
⁎
an RNA-dependent RNA polymerase (Yu et al., 2011; Zhou et al., 2013). The RNA of SFTSV has been detected in Haemaphysalis longicornis, Haemaphysalis flava, Ixodes nipponensis, and Rhipicephalus microplus (Yu et al., 2011; Liu et al., 2014; Park et al., 2014; Oh et al., 2016; Yun et al., 2016). Recently, SFTSV was isolated from unfed H. longicornis that was collected by the dragging and flagging, rather than from fed ticks (Yun et al., 2016). Moreover, H. longicornis could transstadially survival and transovarially transmit SFTSV to ticks in other developmental stages; it could also transmit SFTSV to goat and mouse (Luo et al., 2015; Jiao et al., 2015). In the ROK, H. longicornis is a dominant tick species in the environment and on several mammals (Kim et al., 2006 and 2011; Park et al., 2014; Kang et al., 2016; Oh et al., 2016; Yun et al., 2016); most ROK residents have been exposed to this tick species
Corresponding author at: Veterinary Internal Medicine, College of Veterinary Medicine, Seoul National University, Seoul 08826, Republic of Korea. E-mail address: [email protected] (J.-S. Chae).
https://doi.org/10.1016/j.ttbdis.2018.04.018 Received 27 December 2017; Received in revised form 24 April 2018; Accepted 25 April 2018 1877-959X/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: Kang, J.-G., Ticks and Tick-borne Diseases (2018), https://doi.org/10.1016/j.ttbdis.2018.04.018
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
2.3. Nucleotide sequencing and phylogenetic analysis
(Yun et al., 2014). These studies indicate that H. longicornis serves as a main vector for SFTSV transmission. Many clinical cases of SFTS in humans have been documented in Japan, China, and the ROK; however, clinical cases of SFTS in animals have not yet been reported (Liu et al., 2015; Choi et al., 2016; Kato et al., 2016). However, molecular and serological surveys have been conducted to determine SFTSV exposure in various animals in China and Japan, including dogs, sheep, goats, chickens, wild boar, pigs, minks, and cattle (Niu et al., 2013; Ding et al., 2014; Li et al., 2014; Hayasaka et al., 2016; Wang et al., 2017). In addition, experimental studies have been conducted to investigate transmission and circulation of SFTSV in mice, dogs, and goats in China (Niu et al., 2013; Jiao et al., 2015; Ni et al., 2015). In the ROK, the RNA of SFTSV has been detected in dogs, cats, Korean water deer (Hydropotes inermis) and wild boar (Sus scrofa) (Oh et al., 2016; Hwang et al., 2017; Lee et al., 2017a). Moreover, the seroprevalence of anti-SFTSV antibodies in dogs, within the ROK, has been reported using indirect immunofluorescence assay (IFA) and virus neutralization (Lee et al., 2017b). The highest seroprevalence of anti-SFTSV antibodies among domestic mammals has been reported in goats raised in China (Jiao et al., 2012; Zhao et al., 2012), suggesting that goats experience significant exposure to SFTSV in their natural environment. In addition, several studies have shown that H. longicornis is a dominant tick species on goats (Kang et al., 2016; Zhang et al., 2017). However, to the best of our knowledge, there have been no published studies of the prevalence of SFTSV infection in livestock, or in goats, in the ROK. Therefore, the aim of this study was to determine the prevalence of SFTSV antigens and anti-SFTSV antibodies in black goats throughout the ROK.
Purified PCR products were cloned with pGEM-T Easy Vectors (Promega, USA), followed by transformation into Escherichia coli JM109, then plated onto LB agar containing 100 ug/mL of ampicillin. Plasmid DNA was purified using the Wizard® Plus SV Minipreps DNA Purification system (Promega) and was sequenced using an automatic sequencer (3730xl capillary DNA Analyzer; Applied Biosystems, USA). Sequence data were analyzed using Chromas software (Ver 2.44). To compare sequences from this study with sequences that had previously been deposited in GenBank, sequences were aligned using Clustal X (Ver 2.1) and analyzed with MEGA 7 (Kumar et al., 2016). Phylogenetic trees were constructed using a Maximum Likelihood method based on the Kimura 2-parameter model; the data set was resampled 1000 times to generate bootstrap values. 2.4. Double-antigen sandwich enzyme linked immunosorbent assay (ELISA) Double-antigen sandwich ELISA procedure was performed to detect total antibodies (including IgG and IgM) in serum samples, as described previously (Jiao et al., 2012). Recombinant nucleocapsid protein (rNP) of the first Korean SFTSV strain (GenBank accession no. KF358693) was adsorbed to the solid phase, and horseradish peroxidase-conjugated rNP was added after application of serum. Each serum sample was tested in duplicate, and the positive and negative controls were tested in quadruplicate. Optical density (OD) at 450 nm was measured after adding tetramethylbenzidine (Thermo Scientific, Waltham, MA, USA) and a stop solution. Each result was expressed as a percentage of the positive control serum, using the following formula: (OD of test serum/mean OD of positive-control serum) × 100. Cutoff value was determined as mean value plus three standard deviations (mean + (3 × SD), derived from a percentage of the positive control values in the negative-control serum.
2. Materials and methods 2.1. Sample collection All procedures with animals were performed in accordance with the guidelines of the National Research Council for Care of Laboratory Animals. Whole-blood samples were collected from black goats (Capra hircus coreanae) in 2014–2015, throughout the ROK. Sera were separated from whole-blood samples by centrifugation, then stored at −80 °C until use. A total of 200 μL serum was used for RNA extraction via the Gene-spin™ Viral DNA/RNA Extraction Kit (Intron Biotechnology, Korea), according to the manufacturer’s protocol. Resultant RNA samples were stored at −80 °C deep freezer until assayed.
3. Results A total of 737 goat sera were collected from Gwangwon-do (n = 20), Gyeonggi-do (n = 31), Gyengsangbuk-do (n = 25), Gyengsangnam-do (n = 13), Chungcheongbuk-do (n = 115), Chungcheongnam-do (n = 24), Jeollabuk-do (n = 375), Jeollanam-do (n = 130), and Jeju-do (n = 4) provinces (Table 1, Fig. 1). Eighteen of 737 (2.4%) goat sera were positive for SFTSV on RT-PCR. The amplified 346-bp S segments of SFTSV sequences were classified into three genotypes including BG1 (KX672013), BG2 (KX672014), and BG3 (KX672015). The BG1 genotype was detected in nine different samples and was identical to the sequence identified in a cat in the ROK (KP994430). The BG2 genotype was detected in two goat sera and exhibited 99.4% identity to the KP994430 sequence (the BG1 genotype). In contrast, the BG3 genotype, detected in seven goat sera, was included in a different sub-clade from BG1 and BG2 (Fig. 1), and was
2.2. One-step reverse transcriptase-nested polymerase chain reaction (RTnested PCR) One-step RT-nested PCR was performed to amplify the S segment of the SFTS viral RNA genome, using SFTSV genome-specific primer sets for PCR. The first set of PCR primers used were forward primer (NP-2F: CATCATTGTCTTTGCCCTGA) and reverse primer (NP-2R: AGAAGACA GAGTTCACAGCA). The nested PCR primers used were forward primer (NP-2F: AAYAAGATCGTCAAGGCATCA) and reverse primer (NP-2R: TAGTCTTGGTGAAGGCATCTT) (Yoshikawa et al., 2014; Oh et al., 2016). The SFTSV used for positive control was kindly provided by Dr. Park (Gachon University of Medicine and Science, Inchon, Korea). PCR amplifications were performed in a reaction mixture (30 μL) containing 1.5 μL (10 pmol) of each forward and reverse primer, 4 μL of extracted RNA, 8 μL of TE buffer and 15 μL of one-step RT-PCR premix (Solgent, Korea). Reverse transcription (RT) reactions were incubated at 50 °C for 30 min, followed by 94 °C for 5 min. The amplification was performed according to the following conditions: 20 s at 94 °C, 40 s at 52 °C, and 30 s at 72 °C, for 40 cycles (first PCR) and 25 cycles (nested PCR), followed by a final extension step at 72 °C for 5 min. PCR products were visualized by gel electrophoresis using a 1.5% agarose gel, then purified using QIAquick Gel Extraction Kits (Qiagen, Germany).
Table 1 Prevalence of severe fever with thrombocytopenia syndrome virus in RT-PCR and ELISA assay of goat sera from the Republic of Korea.
2
Province
No. of samples
No. of PCR positive/ Tested samples (Positive rates, %)
Gwangwon-do Gyeonggi-do Gyengsangbuk-do Gyengsangnam-do Chungcheongbuk-do Chungcheongnam-do Jeollabuk-do Jeollanam-do Jeju-do Total
20 31 25 13 115 24 130 375 4 737
0/20 (0) 2/31 (6.5) 2/25 (8.0) 0/13 (0) 2/115 (1.7) 0/24 (0) 5/130 (3.9) 7/375 (1.9) 0/4 (0) 18/737 (2.4)
No. of ELISA positive/Tested samples (Positive rates, %) 3/20 (15.0) 2/31 (6.5) 1/25 (4.0) 1/13 (7.7) 4/114 (3.5) 6/24 (25.0) 0/30 (0) 25/363 (6.9) 1/4 (25.0) 43/624 (6.9)
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
Fig. 1. Map of the Republic of Korea, showing the nine provinces. GG, Gyeonggi-do; GW, Gangwon-do; CB, Chungcheongbuk-do; CN, Chungcheongnam-do; JB, Jeollabuk-do; JN, Jeollanam-do; GB, Gyeongsangbuk-do; GN, Gyeongsangnam-do; JJ, Jeju-do.
conducted in an area limited to SFTS-endemic regions, while our samples were collected throughout the ROK; 2) Our studies differed in the reference virus strains used for ELISA assay, based on available rNP sequence data; 3) The goats included in Chinese studies were raised by the free-range method, while most of goats included in this study were raised by the confined-range method. Free-ranging livestock may have a higher exposure risk to tick bite, thereby increasing the likelihood of being bitten by SFTSV-infected ticks; this could contribute to the high seroprevalence. The prevalences of SFTSV RNA in animals (except feral cats) have been reported as between 0.2%–5.3% in China and the ROK (Niu et al., 2013; Liu et al., 2014; Oh et al., 2016; Lee et al., 2017a). Our prevalence rate of SFTSV RNA in goats was 2.4%, which was higher than the rate in shelter animals and chicken, but lower than the rate in cattle, sheep, dogs, pigs, and wild animals. These different rates may be associated with their habitats, body sizes, and environments. Moreover, the molecular prevalence of SFTSV is lower than the seroprevalence of anti-SFTSV antibodies in animals, which suggests that the infected animals may experience a short period of viremia, a low level of viremia, or a rapid production of antibodies against SFTSV. Indeed, some studies have shown that goats infected with SFTSV exhibit a transient viremia lasting for < 24 h, and that dogs infected with SFTSV demonstrate detectable viral RNA on days 8 and 10 post-infection (Niu et al., 2013; Jiao et al., 2015). However, neither transmission nor persistent infection of SFTSV in animals has been proven, and further studies are needed to understand SFTSV transmission in nature. In recent phylogenetic studies of SFTSV, this virus has been classified into two clades: a Chinese clad and a Japanese clade (Yoshikawa et al., 2014). The 18 sequences obtained from this study were classified into three genotypes, included in the Japanese clade (Fig. 2). Moreover, BG1 and BG2 genotypes were clustered with many Korean strains, while the BG3 genotype was clustered with Korean and Japanese strains (Fig. 2). These findings are consistent with previous studies, which indicate that Korean SFTSV strains are more related to the Japanese clade than the Chinese clade, and that various sub-clades of SFTSV exist in the ROK. In conclusion, the present study is the first to report molecular and serological detection of SFTSV in goats in the ROK; further, it indicates that SFTSV is widely distributed in goats throughout the ROK. Moreover, these results suggest that continuous and large-scale surveillance is needed to monitor SFTSV distribution and incidence in the ROK. Therefore, further studies, such as whole genome analysis of various animal-derived SFTSV isolates, and mapping of environmental
99.7% identical to sequences that were identified in humans in the ROK (KP663739) and Japan (AB817995) (Fig. 2). Of 624 serum samples (113 of the original sera could not be tested for ELISA), 43 (6.9%) were positive for anti-SFTSV antibodies, on ELISA analysis. SFTSV prevalence for each province is described in Table 1. SFTSV genomes were detected in five out of nine provinces. However, SFTSV antibodies were detected in eight provinces, except Jeollabuk-do province, in the ROK. No sample exhibited dual positivity for both SFTSV antigen and anti-SFTSV antibody. 4. Discussion To date in the ROK, there have been four SFTSV studies in animals: 0.2% (1/426) of shelter dogs, 0.5% (1/215) of shelter cats, 17.5% (22/ 126) of feral cats, 4.8% (1/21) of Korean water deer, and 3.7% (2/54) of wild boar were positive for SFTSV by RT-PCR; 13.9% (59/426) of shelter dogs were positive for anti-SFTSV antibodies by IFA (Oh et al., 2016; Hwang et al., 2017; Lee et al., 2017a,b). In the present study, 2.4% (18/737) of goats were positive for SFTSV by RT-nested PCR; 6.9% (43/624) of goats were positive for anti-SFTSV antibody on ELISA analysis. Although SFTSV RNA was detected in goats in a previous study (Jiao et al., 2015), to our knowledge, this study is the first to estimate molecular prevalence of SFTSV in goats, and the first to perform serological detection of anti-SFTSV antibodies in livestock, in the ROK. Although SFTSV is mainly transmitted to humans through tick biting (Yu et al., 2011; Kim et al., 2013; Yun et al., 2014), accidental person-to-person transmission of SFTSV, via contact with blood and body fluid, has been reported (Bao et al., 2011; Liu et al., 2012; Kim et al., 2015; Huang et al., 2017). However, there have been no reports of animal-to-animal, or animal-to-human, transmission of SFTSV without ticks. Recently, a study was published regarding the natural infection rate in goats, as they demonstrate higher seroprevalence for SFTSV exposure. In that study, goats that were inoculated with SFTSV did not shed SFTSV, either through the digestive or respiratory routes, and exhibited no clinical signs of disease; further, they had a very short viremic period (Jiao et al., 2015). On the other hand, other studies in SFTS-endemic regions (Shandong and Jiangsu Province) of China found anti-SFTSV antibody positivity at rates of 66.8–82.8% in goats (Jiao et al., 2012; Zhao et al., 2012; Li et al., 2014). However, our results indicate lower seroprevalence, compared with the previous studies in China. This difference between the Chinese studies and our results could be explained by several factors: 1) Chinese studies were 3
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
Fig. 2. Phylogenetic analysis of SFTSV based on the partial S segment (346 bp). The sequences identified in this study are indicated by bold letters. Evolutionary history was inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model (1000 bootstrap replicates). The percentage of trees in which associated taxa clustered together is shown next to the branches. Scale bar indicates number of nucleotide substitutions per position.
Acknowledgments
virus circulation routes in nature, are necessary to understand the genetic diversity and evolution of SFTSV.
This research was supported by a fund (no. Z-1543085-2014-140102) from Research of Animal and Plant Quarantine Agency and was partially supported fund from the “Cooperative Research Program for Agriculture Science & Technology Development (project no. PJ010092)”, Rural Development Administration, the Republic of Korea. This research was also partially contributed funding from the Basic Science Research Program through the National Research Foundation
Conflict of interest The authors have no conflict of interest.
4
Ticks and Tick-borne Diseases xxx (xxxx) xxx–xxx
J.-G. Kang et al.
of Korea funded by 2015R1C1A1A01054518).
the
Ministry
of
Education
(NRF-
2012. Person-to-person transmission of severe fever with thrombocytopenia syndrome virus. Vector Borne Zoon. Dis. 12, 156–160. Liu, Q., He, B., Huang, S.Y., Wei, F., Zhu, X.Q., 2014. Severe fever with thrombocytopenia syndrome, an emerging tick-borne zoonosis. Lancet Infect. Dis. 14, 763–772. Liu, K., Zhou, H., Sun, R.X., Yao, H.W., Li, Y., Wang, L.P., Mu, D., Li, X.L., Yang, Y., Gray, G.C., Cui, N., Yin, W.W., Fang, L.Q., Yu, H.J., Cao, W.C., 2015. A national assessment of the epidemiology of severe fever with thrombocytopenia syndrome. China Sci. Rep. 5, 9679. Luo, L.M., Zhao, L., Wen, H.L., Zhang, Z.T., Liu, J.W., Fang, L.Z., Xue, Z.F., Ma, D.Q., Zhang, X.S., Ding, S.J., Lei, X.Y., Yu, X.J., 2015. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg. Infect. Dis. 21, 1770–1776. Ni, H., Yang, F., Li, Y., Liu, W., Jiao, S., Li, Z., Yi, B., Chen, Y., Hou, X., Hu, F., Ding, Y., Bian, G., Du, Y., Xu, G., Cao, G., 2015. Apodemus agrarius is a potential natural host of severe fever with thrombocytopenia syndrome (SFTS)-causing novel bunyavirus. J. Clin. Virol. 71, 82–88. Niu, G., Li, J., Liang, M., Jiang, X., Jiang, M., Yin, H., Wang, Z., Li, C., Zhang, Q., Jin, C., Wang, X., Ding, S., Xing, Z., Wang, S., Bi, Z., Li, D., 2013. Severe fever with thrombocytopenia syndrome virus among domesticated animals, China. Emerg. Infect. Dis. 19, 756–763. Oh, S.S., Chae, J.B., Kang, J.G., Kim, H.C., Chong, S.T., Shin, J.H., Hur, M.S., Suh, J.H., Oh, M.D., Jeong, S.M., Shin, N.S., Choi, K.S., Chae, J.S., 2016. Detection of severe fever with thrombocytopenia syndrome virus from wild animals and Ixodidae ticks in the Republic of Korea. Vector Borne Zoon. Dis. 16, 408–414. Park, S.W., Song, B.G., Shin, E.H., Yun, S.M., Han, M.G., Park, M.Y., Park, C., Ryou, J., 2014. Prevalence of severe fever with thrombocytopenia syndrome virus in Haemaphysalis longicornis ticks in South Korea. Ticks Tick Borne Dis. 5, 975–977. Takahashi, T., Maeda, K., Suzuki, T., Ishido, A., Shigeoka, T., Tominaga, T., Kamei, T., Honda, M., Ninomiya, D., Sakai, T., Senba, T., Kaneyuki, S., Sakaguchi, S., Satoh, A., Hosokawa, T., Kawabe, Y., Kurihara, S., Izumikawa, K., Kohno, S., Azuma, T., Suemori, K., Yasukawa, M., Mizutani, T., Omatsu, T., Katayama, Y., Miyahara, M., Ijuin, M., Doi, K., Okuda, M., Umeki, K., Saito, T., Fukushima, K., Nakajima, K., Yoshikawa, T., Tani, H., Fukushi, S., Fukuma, A., Ogata, M., Shimojima, M., Nakajima, N., Nagata, N., Katano, H., Fukumoto, H., Sato, Y., Hasegawa, H., Yamagishi, T., Oishi, K., Kurane, I., Morikawa, S., Saijo, M., 2014. The first identification and retrospective study of severe fever with thrombocytopenia syndrome in Japan. J. Infect. Dis. 209, 816–827. Wang, G.S., Wang, J.B., Tian, F.L., Zhang, H.J., Yin, F.F., Xu, C., Xu, D., Huang, Y.T., Yu, X.J., 2017. Severe fever with thrombocytopenia syndrome virus infection in minks in China. Vector Borne Zoon. Dis. 17, 596–598. Yoshikawa, T., Fukushi, S., Tani, H., Fukuma, A., Taniguchi, S., Toda, S., Shimazu, Y., Yano, K., Morimitsu, T., Ando, K., Yoshikawa, A., Kan, M., Kato, N., Motaya, T., Kuzuguchi, T., Nishino, Y., Osako, H., Yumisashi, T., Kida, K., Suzuki, F., Takimoto, H., Kitamoto, H., Maeda, K., Takahashi, T., Yamagishi, T., Oishi, K., Morikawa, S., Saijo, M., Shimojima, M., 2014. Sensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load. J. Clin. Microbiol. 52, 3325–3333. Yu, X.J., Liang, M.F., Zhang, S.Y., Liu, Y., Li, J.D., Sun, Y.L., Zhang, L., Zhang, Q.F., Popov, V.L., Li, C., Qu, J., Li, Q., Zhang, Y.P., Hai, R., Wu, W., Wang, Q., Zhan, F.X., Wang, X.J., Kan, B., Wang, S.W., Wan, K.L., Jing, H.Q., Lu, J.X., Yin, W.W., Zhou, H., Guan, X.H., Liu, J.F., Bi, Z.Q., Liu, G.H., Ren, J., Wang, H., Zhao, Z., Song, J.D., He, J.R., Wan, T., Zhang, J.S., Fu, X.P., Sun, L.N., Dong, X.P., Feng, Z.J., Yang, W.Z., Hong, T., Zhang, Y., Walker, D.H., Wang, Y., Li, D.X., 2011. Fever with thrombocytopenia associated with a novel bunyavirus in China. N. Engl. J. Med. 364, 1523–1532. Yun, S.M., Lee, W.G., Ryou, J., Yang, S.C., Park, S.W., Roh, J.Y., Lee, Y.J., Park, C., Han, M.G., 2014. Severe fever with thrombocytopenia syndrome virus in ticks collected from humans, South Korea, 2013. Emerg. Infect. Dis. 20, 1358–1361. Yun, S.M., Song, B.G., Choi, W., Roh, J.Y., Lee, Y.J., Park, W.I., Han, M.G., Ju, Y.R., Lee, W.J., 2016. First isolation of severe fever with thrombocytopenia syndrome virus from Haemaphysalis longicornis ticks collected in severe fever with thrombocytopenia syndrome outbreak areas in the Republic of Korea. Vector Borne Zoon. Dis. 16, 66–70. Zhang, R., Zhao, A., Wang, X., Zhang, Z., 2017. Diversity of tick species on domestic animals in Shandong Province, China, using DNA barcoding. Exp. Appl. Acarol. 73, 79–89. Zhao, L., Zhai, S., Wen, H., Cui, F., Chi, Y., Wang, L., Xue, F., Wang, Q., Wang, Z., Zhang, S., Song, Y., Du, J., Yu, X.J., 2012. Severe fever with thrombocytopenia syndrome virus, Shandong Province, China. Emerg. Infect. Dis. 18, 963–965. Zhou, H., Sun, Y., Wang, Y., Liu, M., Liu, C., Wang, W., Liu, X., Li, L., Deng, F., Wang, H., Guo, Y., Lou, Z., 2013. The nucleoprotein of severe fever with thrombocytopenia syndrome virus processes a stable hexameric ring to facilitate RNA encapsidation. Protein Cell 4 (6), 445–455.
References Bao, C.J., Guo, X.L., Qi, X., Hu, J.L., Zhou, M.H., Varma, J.K., Cui, L.B., Yang, H.T., Jiao, Y.J., Klena, J.D., Li, L.X., Tao, W.Y., Li, X., Chen, Y., Zhu, Z., Xu, K., Shen, A.H., Wu, T., Peng, H.Y., Li, Z.F., Shan, J., Shi, Z.Y., Wang, H., 2011. A family cluster of infections by a newly recognized bunyavirus in eastern China, 2007: further evidence of person-to-person transmission. Clin. Infect. Dis. 53, 1208–1214. Choi, S.J., Park, S.W., Bae, I.G., Kim, S.H., Ryu, S.Y., Kim, H.A., Jang, H.C., Hur, J., Jun, J.B., Jung, Y., Chang, H.H., Kim, Y.K., Yi, J., Kim, K.H., Hwang, J.H., Kim, Y.S., Jeong, H.W., Song, K.H., Park, W.B., Kim, E.S., Oh, M.D., 2016. Severe fever with thrombocytopenia syndrome in South Korea, 2013–2015. PLoS Negl. Trop. Dis. 10, e0005264. Ding, S., Yin, H., Xu, X., Liu, G., Jiang, S., Wang, W., Han, X., Liu, J., Niu, G., Zhang, X., Yu, X.J., Wang, X., 2014. A cross-sectional survey of severe fever with thrombocytopenia syndrome virus infection of domestic animals in Laizhou City, Shandong Province, China. Jpn. J. Infect. Dis. 67, 1–4. Hayasaka, D., Fuxun, Y., Yoshikawa, A., Posadas-Herrera, G., Shimada, S., Tun, M.M., Agoh, M., Morita, K., 2016. Seroepidemiological evidence of severe fever with thrombocytopenia syndrome virus infections in wild boars in Nagasaki. Japan. Trop. Med. Health 44, 6. Huang, D., Jiang, Y., Liu, X., Wang, B., Shi, J., Su, Z., Wang, H., Wang, T., Tang, S., Liu, H., Hu, Z., Deng, F., Shen, S., 2017. A cluster of symptomatic and asymptomatic infections of severe fever with thrombocytopenia syndrome caused by person-toperson transmission. Am. J. Trop. Med. Hyg. 97, 396–402. Hwang, J., Kang, J.G., Oh, S.S., Chae, J.B., Cho, Y.K., Cho, Y.S., Lee, H., Chae, J.S., 2017. Molecular detection of severe fever with thrombocytopenia syndrome virus (SFTSV) in feral cats from Seoul, Korea. Ticks Tick Borne Dis. 8, 9–12. Jiao, Y., Zeng, X., Guo, X., Qi, X., Zhang, X., Shi, Z., Zhou, M., Bao, C., Zhang, W., Xu, Y., Wang, H., 2012. Preparation and evaluation of recombinant severe fever with thrombocytopenia syndrome virus nucleocapsid protein for detection of total antibodies in human and animal sera by double-antigen sandwich enzyme-linked immunosorbent assay. J. Clin. Microbiol 50, 372–377. Jiao, Y., Qi, X., Liu, D., Zeng, X., Han, Y., Guo, X., Shi, Z., Wang, H., Zhou, M., 2015. Experimental and natural infections of goats with severe fever with thrombocytopenia syndrome virus: evidence for ticks as viral vector. PLoS Negl. Trop. Dis. 9, e0004092. Kang, J.G., Ko, S., Smith, W.B., Kim, H.C., Lee, I.Y., Chae, J.S., 2016. Prevalence of anaplasma, bartonella and borrelia species in haemaphysalis longicornis collected from goats in North Korea. J. Vet. Sci. 17, 207–216. Kato, H., Yamagishi, T., Shimada, T., Matsui, T., Shimojima, M., Saijo, M., Oishi, K., 2016. Epidemiological and clinical features of severe fever with thrombocytopenia syndrome in Japan, 2013–2014. PLoS One 11, e0165207. Kim, C.M., Yi, Y.H., Yu, D.H., Lee, M.J., Cho, M.R., Desai, A.R., Shringi, S., Klein, T.A., Kim, H.C., Song, J.W., Baek, L.J., Chong, S.T., O'guinn, M.L., Lee, J.S., Lee, I.Y., Park, J.H., Foley, J., Chae, J.S., 2006. Tick-borne rickettsial pathogens in ticks and small mammals in Korea. Appl. Environ. Microbiol. 72, 5766–5776. Kim, H.C., Han, S.H., Chong, S.T., Klein, T.A., Choi, C.Y., Nam, H.Y., Chae, H.Y., Lee, H., Ko, S., Kang, J.G., Chae, J.S., 2011. Ticks collected from selected mammalian hosts surveyed in the Republic of Korea during 2008–2009. Korean J. Parasitol. 49, 331–335. Kim, K.H., Yi, J., Kim, G., Choi, S.J., Jun, K.I., Kim, N.H., Choe, P.G., Kim, N.J., Lee, J.K., Oh, M.D., 2013. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg. Infect. Dis. 19, 1892–1894. Kim, W.Y., Choi, W., Park, S.W., Wang, E.B., Lee, W.J., Jee, Y., Lim, K.S., Lee, H.J., Kim, S.M., Lee, S.O., Choi, S.H., Kim, Y.S., Woo, J.H., Kim, S.H., 2015. Nosocomial transmission of severe fever with thrombocytopenia syndrome in Korea. Clin. Infect. Dis. 60, 1681–1683. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lee, S.H., Kim, H.J., Byun, J.W., Lee, M.J., Kim, N.H., Kim, D.H., Kang, H.E., Nam, H.M., 2017a. Molecular detection and phylogenetic analysis of severe fever with thrombocytopenia syndrome virus in shelter dogs and cats in the Republic of Korea. Ticks Tick Borne Dis. 8, 626–630. Lee, S.H., Kim, H.J., Lee, M.J., Byun, J.W., Kim, D.Y., Kim, N.H., Kim, D.H., Kwak, D., Kang, H.E., Nam, H.M., 2017b. 2017. Prevalence of antibodies against severe fever with thrombocytopenia syndrome virus in shelter dogs in the Republic of Korea. Ticks Tick Borne Dis (Epub ahead of print). Li, Z., Hu, J., Bao, C., Li, P., Qi, X., Qin, Y., Wang, S., Tan, Z., Zhu, Y., Tang, F., Zhou, M., 2014. Seroprevalence of antibodies against SFTS virus infection in farmers and animals, Jiangsu, China. J. Clin. Virol. 60, 185–189. Liu, Y., Li, Q., Hu, W., Wu, J., Wang, Y., Mei, L., Walker, D.H., Ren, J., Wang, Y., Yu, X.J.,
5