Prevalence, typing and phylogenetic analysis of Melissococcus plutonius strains from bee colonies of the State of Chihuahua, Mexico

Accepted Manuscript Prevalence, typing and phylogenetic analysis of Melissococcus plutonius strains from bee colonies of the State of Chihuahua, Mexico Adrián Ponce de León-Door, Alejandro Romo-Chacón, Claudio Rios-Velasco, Paul Baruk Zamudio-Flores, José de Jesús Ornelas-Paz, Carlos H. AcostaMuñiz PII: DOI: Reference:

S0022-2011(18)30108-3 https://doi.org/10.1016/j.jip.2018.10.006 YJIPA 7141

To appear in:

Journal of Invertebrate Pathology

Received Date: Revised Date: Accepted Date:

23 March 2018 3 October 2018 5 October 2018

Please cite this article as: Ponce de León-Door, A., Romo-Chacón, A., Rios-Velasco, C., Baruk Zamudio-Flores, P., de Jesús Ornelas-Paz, J., Acosta-Muñiz, C.H., Prevalence, typing and phylogenetic analysis of Melissococcus plutonius strains from bee colonies of the State of Chihuahua, Mexico, Journal of Invertebrate Pathology (2018), doi: https://doi.org/10.1016/j.jip.2018.10.006

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Reference: YJIPA 7141 Article title: Prevalence, typing and phylogenetic analysis of Melissococcus plutonius strains from bee colonies of the State of Chihuahua, Mexico. To be published in: Journal of Invertebrate Pathology

Author names: 1. Adrián Ponce de León-Door

email address: [email protected]

2. Alejandro Romo-Chacón

email address: [email protected]

3. Claudio Rios-Velasco

email address: [email protected]

4. Paul Baruk Zamudio-Flores

email address: [email protected]

5. José de Jesús Ornelas-Paz

email address: [email protected]

6. Carlos H. Acosta-Muñiz *

email address: [email protected]

Authors’ affiliation: Centro de Investigación en Alimentación y Desarrollo, A.C. Av. Rio Conchos s/n, parque industrial, Z.C. 31570, Cuauhtémoc, Chihuahua, México.

* Corresponding author: Carlos H. Acosta-Muñiz Centro de Investigación en Alimentación y Desarrollo, A.C. Av. Rio Conchos s/n, parque industrial, Z.C. 31570, Cuauhtémoc, Chihuahua, México. Email address: [email protected] Tel: +52 625 581 29 20. Ext 117. Fax: +52 625 581 29 21.

1

Prevalence, typing and phylogenetic analysis of Melissococcus plutonius strains from bee colonies of the State of Chihuahua, Mexico.

ABSTRACT European foulbrood (EFB) caused by Melissococcus plutonius is an important bee brood disease but, in Mexico, information about this bacterium is limited. We evaluated the prevalence of typical and atypical strains in beehives of seven apicultural regions of the state of Chihuahua, Mexico. We performed MLST and phylogenetic analysis to characterize the isolates. Prevalence was highest 59%, in the region of Chihuahua, and lowest, 14%, in the regions of Cuauhtémoc and Nuevo Casa Grandes. Typical and atypical strains were identified in hives from all regions; however, in the regions of Parral, Cuauhtémoc and Aldama, the atypical strains were only detected in combination with typical strains. We obtained 81 isolates of M. plutonius and identified seven sequence types, of which three were new types. Additionally, we observed a relation between sequence type and the region where the strain was isolated. Phylogenetic analysis and multilocus sequence typing using goeBURST analysis showed that 97.5% of the isolates correspond to the Clonal Complex (CC) 12 and 2.5% to the CC3. Our work is the first molecular characterization of M. plutonius in Mexico and contributes to global information about the epidemiology of this pathogen. Keywords: European foulbrood; Multi-locus sequence typing; Apis mellifera; Epidemiology; atypical strain; typical strain.

2

1. INTRODUCTION According to the Agri-Food and Fisheries Information Service (SIAP), Mexico ranks eighth globally in production of honey with 55,358 tons (SIAP, 2017), and fourth in exports. There are more than 57,000 beekeepers in the country and more than 2 million honey bee (Apis mellifera) hives (SIAP, 2016). However, beekeeping has been impacted by multiple factors such as pesticides, adverse environmental conditions, and poor nutrition, among others. All of these factors in combination with diseases exert a synergistic negative effect, causing increased death of colonies (Meixner, 2010). One of the most serious diseases of bee brood, European foulbrood (EFB), is globally distributed and causes colony death in severe cases. Its causative agent is the bacterium Melissococcus plutonius. Until recently, M. plutonius was thought to be homogeneous (Allen and Ball, 1993; Bailey and Gibbs, 1962; Djordjevic et al., 1999), however, a study conducted by Arai et al. (2012) reported two variants with phenotypic and genetic differences. One variant “typical M. plutonius”, matched the description of Bailey and Collins (1982) because it requires the addition of KH2PO4 and anaerobic conditions for its growth and loses virulence when it is cultivated in vitro (McKee et al., 2004). The second variant, “atypical M. plutonius” is less restrictive in its growth requirements and maintains virulence after repeated in vitro subculture (Arai et al., 2012). The typical and atypical M. plutonius strains could present different mechanisms to regulate virulence and produce different impacts on bee colonies (Arai et al., 2014). 3

Different PCR assays have been developed for reliable detection of M. plutonius, which include regular PCR (Govan et al., 1998) and hemi-nested PCR (Djordjevic et al., 1998) that amplify the 16S rRNA gene. Real-time PCR for the sodA gene has also been used (Roetschi et al., 2008). Recently, the Na+/H+ antiporter gene and the transcriptional regulatory gene of the Fur family in duplex PCR were used for detection of typical and atypical strains respectively (Arai et al., 2014). Haynes et al. (2013) reported a new classification scheme of M. plutonius, using multilocus sequence typing (MLST) based on four genes, galactokinase (galK), acetylornithine deacetylase (argE), secreted antigen (gbpB) and purine operon repressor (purR). This scheme has allowed the identification of 35 sequence types (STs) in the M. plutonius population, which are grouped into three clonal complexes (CCs). CC3 and CC13 correspond to typical strains and CC12 to atypical strains (Arai et al., 2012; Takamatsu et al., 2014). Budge et al. (2014) in the United Kingdom and Takamatsu et al. (2014) in Japan have used the MLST scheme to show that these complexes occur in several countries and in other bee species. According to the OIE (2017) 182 new cases of EFB were detected in Mexico in 2016, but there is no information about the prevalence of the disease, nor on the presence of typical or atypical strains of M plutonius, or the complexes prevalent in the country. Therefore, the objectives of this research were to determine the distribution and prevalence of typical and atypical strains of M. plutonius in colonies of honey bees in the State of Chihuahua Mexico, as well as to characterize the

4

strains using a MLST approach and compare them with isolates reported in other countries.

2. MATERIALS AND METHODS Prevalence of M. plutonius was evaluated in seven beekeeping regions of the State of Chihuahua México, from June 2016 to June 2017. Duplex PCR was performed to identify typical and atypical isolates of M. plutonius. Isolates were then characterized by using MLST to determine their STs and were clustered in clonal complexes.

2.1 Sampling and detection of visible symptoms of EFB Sampling was carried out in seven beekeeping regions of the State of Chihuahua, Mexico: Aldama (28 ° 50'27.1 "N 105 ° 55'40.5" W), Nuevo Casa Grandes (30 ° 24'50.5 "N 107 ° 54'09.1" W), Chihuahua (28 ° 38'28.9 "N 106 ° 04'37.5" W), Cuauhtémoc (28 ° 24'27.1 "N 106 ° 52'24.9" W), Delicias (28 ° 10'58.8 "N 105 ° 28'05.3 "W), Jiménez (27 ° 07'56.2" N 104 ° 54'41.8 "W) and Parral (26 ° 56'00.3" N 105 ° 40'34.9 "W) (Figure 1). Collections were made from eight apiaries and, eight colonies were sampled from each apiary. Ten larvae less than 7 days posthatch were collected from brood frames with sterile tweezers. Larvae were placed in a sterile 7 oz Whirl-Pak® bag (Nasco, USA), with 10 mL phosphate buffer PBS pH 7.4 (138 mM NaCl, 3 mM KCl, 8.1 mM Na2HPO4 and 1.5 mM KH2PO4).

5

The apiaries were georeferenced, and the evaluated colonies were marked. In addition, colonies with clinical signs of EFB were identified. The samples were stored at 4 ° C for further analysis. Average annual temperatures were recorded from the website of the world climatic data (CLIMATE-DATA.ORG), which places Aldama, Chihuahua and Jiménez in the warm steppe climate (BSh), NCG, Cuauhtémoc and Parral in the cold steppe (BSk), and Delicias in hot desert (BWh), according to the climatic classification of Köppen-Geiger.

2.2 Prevalence and PCR detection of typical and atypical M. plutonius Samples of 10 larvae were combined and homogenized in 10 mL PBS buffer. An aliquot of 50 μL of the macerated sample was placed in a 200 μL PCR tube and heated at 95 ° C for 10 min and then cooled to 4 ° C for 5 min; 2 μL were used immediately for the duplex PCR. Primers Mp-T-F and Mp-T-R were used for detection of typical M. plutonius and primers Mp-A-F and Mp-A-R were used for detection of atypical M. plutonius (Table 1). Reactions were carried out in a final volume of 25 μL, including 0.4 μM of each primer, 2.5 μL of 10X PCR buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl and 20 mM MgCl2), 0.2 mM of each dNTP and 2 U of Taq DNA polymerase. The program used for amplification consisted of an initial denaturation of 90 s at 94 ° C, followed by 34 cycles of 94 ° C for 30 s, 57 ° C for 90 s and 72 ° C for 90 s, in addition to a final extension of 72 ° C for 10 min (Arai et al., 2014).

6

Amplification products were observed in agarose gel (2.0 % w/v) stained with ethidium bromide. A negative control without DNA was included in each analysis. Likewise, positive controls were also included. For typical M. plutonius, DNA of reference strain ATCC 35311 was used, and for atypical M. plutonius, DNA from a strain isolated and previously characterized as atypical (belonging to ST 19, unpublished data) was used.

2.3 M. plutonius isolation The macerated samples that were positive for either of the two types of M. plutonius were inoculated on KSBHI agar plates (0.15 M KH2PO4, 1% soluble starch, 37 g/L Brain Heart Infusion and 1.5% Agar). The plates were incubated for 5 days at 35 ± 1 ° C, under anaerobic conditions, using the AnaeroGenTM atmospheric generator system (Oxoid Ltd, UK). Bacterial colonies that presented a morphology characteristic of M. plutonius (Forsgren et al., 2013) were cultured in new KSBHI agar plates. These colonies were Gram stained and duplex PCR was performed on a sample directly from the colony. For PCR, a colony was taken with a sterile toothpick and suspended in 30 μL of 0.5% triton X-100, the suspension was heated at 95 ° C for 10 min and subsequently cooled to 4 ° C for 5 min. The lysate (2 μL per sample) was used for the identification of M. plutonius. Isolates that were positive by PCR were grown in KSBHI broth without agitation for 5 days at 35 ± 1 ° C. Subsequently, 2 mL culture was used for DNA extraction with MasterPureTM Complete DNA & RNA Purification Kit (EPICENTRE®

7

Biotechnologies, USA), following the manufacturer's recommendations. All DNA samples were stored at -20 ° C for later use and the isolates were stored in a 30% glycerol solution at -80 ° C.

2.4 MLST and phylogenetic analysis All isolates were confirmed by a specific PCR for M. plutonius using Primer 1 and Primer 2 (Table 1), which amplify a region of the 16S gene of the rRNA. PCR reactions were performed in 25 μL solutions containing 0.4 μM of each primer, 0.2 mM of each dNTP, 2.5 μL of 10X PCR buffer, 50 ng of DNA and 2 U of Taq DNA polymerase. The PCR program consisted of an initial denaturation of 95 ° C for 3 min, followed by 30 cycles of 95 ° C for 30 s, 55 ° C for 15 s and 72 ° C for 1 min, with a final elongation step of 72 ° C for 3 min (Govan et al., 1998). A negative control without DNA and a positive control with DNA of strain ATCC 35311 were included. The PCR products were visualized on a 1.5% (w/v) agarose gel stained with ethidium bromide. The size of the PCR product was estimated using molecular weight marker GeneRulerTM 1kb Plus (Thermo Fisher Scientific Inc). Once M. plutonius was confirmed, the MLST scheme designed by Haynes et al. (2013) was used to determine the sequence of four genes (galK, argE, gbpB and purR). PCR reactions were performed in a volume of 50 μL containing the appropriate primers for each gene (Table 1) at a final concentration of 0.4 μM each, 0.2 mM of each dNTP, 5 μL of 10X PCR buffer, 50 ng of DNA and 2 U of Taq DNA polymerase. The PCR program consisted of an initial denaturation of 94 ° C

8

for 2 min, followed by 35 cycles of 94 ° C for 30 s, 52 ° C for 30 s and 72 ° C for 1 min, followed by a final extension at 72 ° C for 1 min. A negative control without DNA was included in all the reactions. The PCR products were visualized on a 2% (w/v) agarose gel stained with ethidium bromide. The PCR fragment size was estimated using molecular weight marker GeneRulerTM 1kb Plus (Thermo Fisher Scientific Inc). The PCR products were purified using DNA Clean & Concentrator 5 kit (Zymo Research, USA), and were sequenced using the BigDye Terminator v3.1 chemistry and automatic multi-capillary system electrophoresis, with the AB 3730 analyzaer DNA (Applied Biosystems). The sequences obtained were edited using the MEGA7 program (Kumar et al., 2016). The allelic numbers and the STs of the isolated strains were determined by comparing the sequences with sequences in the database designed by Budge et al. (2014). The data of the allelic combination of each isolate were analyzed in the MLST database for M. plutonius (https://pubmlst.org/mplutonius/). The evolutionary patterns between the STs were calculated using the goeBURST algorithm (Francisco et al., 2009) in the PHYLOViZ 2.0 program (Francisco et al., 2012). For construction of the goeBURST tree, 81 isolates sequenced in the present study and 379 isolates contained in the database were included (Budge et al., 2014; Haynes et al., 2013; Takamatsu et al., 2014; Takamatsu et al., 2017). A phylogenetic tree was constructed from the 38 STs using the MEGA7 program (Kumar et al., 2016). The sequences of the four genes were joined together for a total of 2109 bases in each ST, and were aligned using the ClustalW 1.6 program. Phylogenetic analysis was carried out with the Maximum Likelihood method, based 9

on the Tamura and Nei (1993) model. The initial trees were obtained by applying the Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. Analysis included 38 nucleotide sequences. All positions with less than 95% site coverage were eliminated for a total of 1681 positions in the final data set, gaps in the alignment were treated by partial deletion, and the test of phylogeny was gauged using the Bootstrap method (500 replications).

2.5 Statistical analysis The prevalence of disease was determined from visible symptoms and the detection of M. plutonius using PCR, and were transformed to arcsine for analysis. A X2 test (Chi-square) was performed to compare the prevalence of M. plutonius between the different apicultural regions of the State of Chihuahua, as well as between ST and region of isolation. Additionally, a contrast analysis was made between prevalence and the climatic conditions according to the classification of each region. In each ST, a goodness-of-fit test was carried out to determine its association in each region. The analysis was performed with the statistical package Minitab® 18.1, at a confidence interval of 95%.

3. RESULTS AND DISCUSSION 3.1 Sampling and detection of visible symptoms of EFB

10

During sampling of larvae in the major beekeeping areas of the State of Chihuahua, clinical symptoms of EFB were observed in all regions. The highest percentage of observable infected colonies, 16%, was detected in Chihuahua region, while the lowest number of colonies with observable EFB symptoms, 2%, was recorded in the regions of Cuauhtémoc and NCG (Figure 2). The clinical symptoms observed were similar to those reported by (Forsgren, 2010); irregular brood patterns, presence of larvae with a yellow or brown color, larvae in abnormal position, flaccid larvae or scales in the bottom of the cell, as well as an unpleasant odor, symptoms. EFB is a serious disease in the development of honey bees. However, in Mexico, attention has been reduced; proof of this is the reclassification from being considered a disease with significant effects on livestock production, international trade, public health and strategic importance for animal health actions, which should be notified immediately and obligatorily to the animal health authorities of the country (DOF, 2007), to an endemic disease, which represents a lower risk from the epidemiological point of view and only should be reported monthly to the animal health authorities of the country (DOF, 2016). Epidemiological surveillance in the country currently focuses on Varroasis, Acariosis and Nosemosis (SIVE, 2018). From 1996 to 2016, there were no reports of EFB in Mexico (OIE, 2017). We highlight the need for a monitoring system that includes the detection of bacterial pathogens such as M. plutonius.

3.2 Prevalence and PCR detection of typical and atypical M. plutonius 11

The presence of M. plutonius was determined by duplex PCR in bee colonies of the main beekeeping regions of the State of Chihuahua. M. plutonius was detected in 154 hives, 34% of all the samples evaluated. The prevalence in Chihuahua region was highest at 59%, while the lowest prevalence was detected in colonies located in the regions of Cuauhtémoc and NCG, both with 14% (Figure 2). The correlation between the results obtained from the visible symptoms of the disease and the detection of M. plutonius by PCR in the different beekeeping regions, showed a R2 = 0.90 (Figure 3). Several studies mention that colonies can remain without visible symptoms due to the low bacterial load present in the larvae (Belloy et al., 2007; Budge et al., 2010; Forsgren et al., 2005). Likewise, Roetschi et al. (2008) reported that a threshold of 50000 CFU M. plutonius/bee is necessary for symptoms to be evident. On the other hand, duplex PCR is capable of detecting 50 copies of the M. plutonius chromosome, from purified DNA (Arai et al., 2014); however, compounds in complex samples (adult bees, larvae, honey, pollen, etc.) can decrease the sensitivity of PCR up to 10 times (Forsgren et al., 2005). The analysis of the samples of the different beekeeping regions of the State of Chihuahua using duplex PCR (Figure 4 A, Figure 2) showed 71% typical strains, 3% atypical, and 26% of the samples contained both strains. When the prevalence of typical strains by region was evaluated, the lowest values were in Cuauhtémoc and NCG with 8 and 11%, respectively. The prevalence of typical and atypical strains combined was higher in the Chihuahua region (33%), compared with that found in each of the other regions. No larvae samples with only atypical M. plutonius strains were detected in the regions of Parral, Cuauhtémoc and Aldama 12

(Figure 2). Arai et al. (2014) detected 40% typical strains, 54% combined typical and atypical strains and 6% atypical strains in Japan. The low percentage of atypical strains occurring alone is similar to that obtained in this study. Prevalence of M. plutonius in the warm zones (BSh and BWh) were significantly different from prevalence in the cold zones (BSk) (Chi-square = 29.45, p <0.0001) with average prevalences of 45% and 20%, respectively (Figure 2). In the study conducted by Garrido‐Bailón et al. (2013) in Spain, a low prevalence of M. plutonius was detected, where the climate type BSh represents a small area of the territory and the BWh climate is not present. Budge et al. (2010) reported that the prevalence of EFB is historically low in the north of England and Wales compared to the south, possibly due to the absence of M. plutonius or to unfavorable environmental conditions for the development of the disease. Budge et al. (2014) concluded that the disease could be influenced by climatic factors. In addition, prevalence of the disease also could be affected by conditions of colony stress, genetic factors or mishandling of apiaries (Bailey, 1961; Forsgren, 2010).

3.3 M. plutonius isolation The analysis of all larval samples by PCR allowed the detection of 154 positive samples. From these samples, 81 isolates were obtained, of which 25 came from larvae with clinical symptoms of the disease. The largest number of isolates, 26, were collected from the Chihuahua region, while the regions with the lowest number were Cuauhtémoc and NCG with 6 and 5 isolates, respectively (Table 2). 13

These isolates correspond with the macro and microscopic descriptions made by Arai et al. (2012), and were confirmed by duplex PCR. We identified 2 typical and 79 atypical M. plutonius strains (Table 2, Supplementary Table 1), however, typical strains from samples of larvae in bee colonies were more numerous than the atypical strains. The typical and atypical strains differ in their development characteristics, even though the KSBHI culture medium has been reported as appropriate for the cultivation of both types of strains (Arai et al., 2012). Arai et al. (2014) and Takamatsu et al. (2014) mentioned that if both types are present in a single sample, typical M. plutonius tends to be missed due to the small size of the colonies or to the growth of atypical strains over the small colonies of typical strains, possibly explaining the low number of isolates of typical strains we obtained. Use of a culture medium that is advantageous for typical strains, as in the case of “medium 1” reported by Arai et al. (2012), could help in the isolation of typical strains of M. plutonius.

3.4 MLST and phylogenetic analysis To perform MLST, the 81 isolates were confirmed by PCR amplification of the fragment corresponding to a specific region of the 16S rRNA gene (Figure 4 B). Subsequently, the argE, galK, gbpB and purR genes were amplified and sequenced (Figure 4 C and Table 1). The analysis of the MLST profiles of the 81 isolates of M. plutonius using the database https://pubmlst.org/mplutonius/, allowed the identification of STs 3, 12, 19, 34, 36, 37 and 38, of which STs 36, 37 and 38 correspond to new allelic profiles. ST36 differs from ST12 in allele 9 of the gbpB 14

gene, while ST37 and ST38 are novel single locus variants of ST12, which has novel allele’s sequences of gbpB (gbpB-18 and gbpB-19 respectively: DDBJ/EMBL/GenBank accession numbers MH443007 and MH443008). These three new STs are grouped in CC12 (Figure 2). The ST most common in the present study was the ST36 detected in 28 isolates, followed by the STs 19, 34, 12, 38, 37 and 3, detected in 17, 13, 11, 6, 4 and 2 isolates, respectively. The ST36 found in six of the regions evaluated (Table 2, Supplementary Table 1) was not reported in other countries, suggesting that this variant is endemic in northern Mexico. On the other hand, STs 37 and 38 were detected only in two regions, so we assume that they are not widely distributed in the State of Chihuahua. It is important to mention that ST19 has been reported in the Netherlands (Haynes et al., 2013), STs 12 and 34 in Japan, England and USA, while ST3 was found in 11 countries (Takamatsu et al., 2014). The association between the ST and the region where M. plutonius was isolated showed significant differences (Χ2= 100.054, GL=36). ST12 and ST38 were associated with the Chihuahua region, ST34 with Jiménez, ST19 with the region of Parral, while ST36 is associated with the regions of Aldama and Delicias. ST37 and ST3 were not associated with any region, due to the low number of isolates with these STs (Table 2). The goeBURST analysis considered 460 isolates from 20 countries, including the 81 isolates obtained in the present study (Supplementary table 1), of which 79 are grouped in CC12, and 2 in CC3. ST3 was the most frequently isolated strain and is widely distributed, including 115 isolates reported from 12 countries. ST12 with 68 15

samples, 53 from Japan, 11 from Mexico, 2 from England and 2 from the U.S. ST13 includes 24 isolates, 19 from England, 3 from Denmark, 1 from Poland and 1 from Switzerland. With the exception of ST1 and ST4, the other STs have been detected in only one or two countries, which suggest that the common ancestors of these variants are indeed ST3, ST13 and ST12. The grouping of STs in CC showed that 55% of the isolates correspond to CC3, mostly reported from the United Kingdom, followed by CC12 with 34% of isolates, primarily reported from Mexico and Japan, and 11% of the remaining isolates correspond to CC13, which are reported from different countries (Figure 5). Even though the characterizations of ST10, ST28, ST30, ST31 and ST35 are found in the database designed by Budge et al. (2014), no isolates corresponding to these sequences were found in the database or in this study, possibly as a consequence of their reclassification, such as ST10 isolates reported by Haynes et al. (2013) and reassigned to ST12 (Takamatsu et al., 2014). The phylogenetic analysis of the different STs of M. plutonius showed a group consistency with the goeBURST tree, similar to that reported by Budge et al. (2014), where ST17 belonging to CC13 is related to CC3, due to allele 3 of the galK gene (Supplementary Table 2). The new STs found in this study (ST36, ST37 and ST38), are grouped in CC12, with ST36 the most abundant and detected in a greater number of regions (Figure 6). MLST analysis revealed a greater number of CC12 isolates. This contradicts the results obtained by duplex PCR using larvae samples, where a higher number of typical M. plutonius of CC13 and CC3 was detected. However, the difficulties in 16

isolating typical strains could lead to the wrong conclusion that CC12 is the most abundant complex in northern Mexico. Studies conducted by Budge et al. (2014), mentioned that the CC3 was the most abundant complex. This is possibly due to the high resistance of STs in this complex to royal jelly (Takamatsu et al., 2017). The role of each CC in pathogenesis is still unclear because the three types of CCs isolated from diseased colonies may or may not present multiple infections. Strains of different CCs can affect bee colonies differently due to differences in their growth (Arai et al., 2012), virulence (Nakamura et al., 2016) and resistance to royal jelly (Takamatsu et al., 2017). For this reason, knowing the type strain of M. plutonius and its geographic area will allow implementation of strategies focused on reducing the risk of dissemination and transmission. Recent studies have used PCR to confirm the presence of M. plutonius globally. The 16S rRNA gene sequences are available in the GenBank (https://www.ncbi.nlm.nih.gov/genbank/) (Ansari et al., 2017; Singh Rana et al., 2012; Tibatá et al., 2018), however, according to Arai et al. (2012), M. plutonius exhibits great homogeneity in this gene. The MLST scheme is a higher resolution typing method that has allowed the identification of multiple variants of M. plutonius (Haynes et al., 2013), but the isolates that have been analyzed by this technique were mostly from the United Kingdom and Japan (Budge et al., 2014; Takamatsu et al., 2014). Our study presents the first prevalence data and molecular characterization of M. plutonius in Mexico. Typical strains, atypical strains and the combination of both types of strains were detected in bee colonies. Four STs of M. plutonius reported in 17

other countries were detected, and three new STs were identified, which could be representative of northern Mexico. Our data expand the information on the global epidemiology of M. plutonius and support the hypothesis that climatic factors may influence the development of EFB. Early detection of M. plutonius is important to prevent spread and new outbreaks of the disease caused by strains other than endemic ones.

4. ACKNOWLEDGEMENTS A. Ponce de León-Door wants to thanks CONACYT for his doctoral fellowship. We also gratefully acknowledge the technical assistance of M. C. Gerardo Perez and Dr. Jorge Jiménez. We gratefully acknowledge the invaluable support with the collection of samples to the beekeepers of the state of Chihuahua.

5. REFERENCES Allen, M., Ball, B., 1993. The cultural characteristics and serological relationships of isolates of Melissococcus pluton. Journal of Apicultural Research. 32, 8088. Ansari, M. J., et al., 2017. Survey and molecular detection of Melissococcus plutonius, the causative agent of European Foulbrood in honeybees in Saudi Arabia. Saudi journal of biological sciences. 24, 1327-1335.

18

Arai, R., et al., 2014. Development of duplex PCR assay for detection and differentiation of typical and atypical Melissococcus plutonius strains. Journal of Veterinary Medical Science. 76, 491-498. Arai, R., et al., 2012. Diversity of Melissococcus plutonius from honeybee larvae in Japan and experimental reproduction of European foulbrood with cultured atypical isolates. PLoS One. 7, e33708. Bailey, L., 1961. European foulbrood. American Bee Journal. 101, 89-92. Bailey, L., Collins, M., 1982. Reclassification of ‘Streptococcus pluton’(White) in a new genus Melissococcus, as Melissococcus pluton nom. rev.; comb. nov. Journal of Applied Microbiology. 53, 215-217. Bailey, L., Gibbs, A., 1962. Cultural characters of Streptococcus pluton and its differentiation from associated enterococci. Microbiology. 28, 385-391. Belloy, L., et al., 2007. Spatial distribution of Melissococcus plutonius in adult honey bees collected from apiaries and colonies with and without symptoms of European foulbrood. Apidologie. 38, 136-140. Budge, G. E., et al., 2010. The occurrence of Melissococcus plutonius in healthy colonies of Apis mellifera and the efficacy of European foulbrood control measures. Journal of invertebrate pathology. 105, 164-170. Budge, G. E., et al., 2014. Molecular epidemiology and population structure of the honey bee brood pathogen Melissococcus plutonius. The ISME journal. 8, 1588. Djordjevic, S. P., et al., 1998. Development of a hemi-nested PCR assay for the specific detection of Melissococcus pluton. Journal of Apicultural Research. 37, 165-174. 19

Djordjevic, S. P., et al., 1999. Geographically diverse Australian isolates of Melissococcus pluton exhibit minimal genotypic diversity by restriction endonuclease analysis. FEMS microbiology letters. 173, 311-318. DOF, Acuerdo mediante el cual se dan a conocer en los Estados Unidos Mexicanos las enfermedades y plagas exóticas y endémicas de notificación obligatoria de los animales terrestres y acuáticos. In: G. SECRETARIA DE AGRICULTURA, DESARROLLO RURAL, PESCA Y ALIMENTACION, (Ed.), http://dof.gob.mx/nota_detalle.php?codigo=5001157&fecha=20/09/2007, 2007. DOF, Acuerdo mediante el cual se dan a conocer en los Estados Unidos Mexicanos las enfermedades y plagas exóticas y endémicas de notificación obligatoria de los animales terrestres y acuáticos. In: G. SECRETARIA DE AGRICULTURA, DESARROLLO RURAL, PESCA Y ALIMENTACION, (Ed.). Diario Oficial de la Federación, 2016. Forsgren, E., 2010. European foulbrood in honey bees. Journal of invertebrate pathology. 103, S5-S9. Forsgren, E., et al., 2013. Standard methods for European foulbrood research. Journal of Apicultural Research. 52, 1-14. Forsgren, E., et al., 2005. Distribution of Melissococcus plutonius in honeybee colonies with and without symptoms of European foulbrood. Microbial Ecology. 50, 369-374. Francisco, A. P., et al., 2009. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinformatics. 10, 152. 20

Francisco, A. P., et al., 2012. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods. BMC bioinformatics. 13, 87. Garrido‐Bailón, E., et al., 2013. The prevalence of the honeybee brood pathogens Ascosphaera apis, Paenibacillus larvae and Melissococcus plutonius in Spanish apiaries determined with a new multiplex PCR assay. Microbial biotechnology. 6, 731-739. Govan, V., et al., 1998. A PCR Detection Method for Rapid Identification of Melissococcus pluton in Honeybee Larvae. Applied and environmental microbiology. 64, 1983-1985. Haynes, E., et al., 2013. A typing scheme for the honeybee pathogen Melissococcus plutonius allows detection of disease transmission events and a study of the distribution of variants. Environmental microbiology reports. 5, 525-529. Kumar, S., et al., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular biology and evolution. 33, 1870-1874. McKee, B. A., et al., 2004. The transmission of European foulbrood (Melissococcus plutonius) to artificially reared honey bee larvae (Apis mellifera). Journal of apicultural research. 43, 93-100. Meixner, M. D., 2010. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. Journal of invertebrate pathology. 103, S80-S95.

21

Nakamura, K., et al., 2016. Virulence Differences among Melissococcus plutonius Strains with Different Genetic Backgrounds in Apis mellifera Larvae under an Improved Experimental Condition. Scientific reports. 6. OIE, Enfermedades, infecciones e infestaciones de los animales terrestres de la Lista de la OIE presentes, México, 2015 y 2016. Organización Mundial de Sanidad Animal, 2017. Roetschi, A., et al., 2008. Infection rate based on quantitative real-time PCR of Melissococcus plutonius, the causal agent of European foulbrood, in honeybee colonies before and after apiary sanitation. Apidologie. 39, 362371. SIAP, Servicio de Información Agroalimentaria y Pesquera, Población apícola 2007 - 2016 Colmenas. Servicio de Información Agroalimentaria y Pesquera 2016. SIAP, Servicio de información agroalimentaria y pesquera; Resumen Nacional Producción, precio, valor, animales sacrificados y peso 2016. 2017. Singh Rana, B., et al., 2012. Characterization of Melissococcus plutonius causing European foulbrood disease in Apis cerana F. Journal of Apicultural Research. 51, 306-311. SIVE,

Sistema

Nacional

de

Vigilancia

Epidemiológica

https://www.gob.mx/senasica/acciones-y-programas/sistema-nacional-devigilancia-epidemiologica-sive, 2018. Takamatsu, D., et al., 2014. Typing of Melissococcus plutonius isolated from European and Japanese honeybees suggests spread of sequence types

22

across borders and between different Apis species. Veterinary microbiology. 171, 221-226. Takamatsu, D., et al., 2017. High‐level resistance of Melissococcus plutonius clonal complex 3 strains to antimicrobial activity of royal jelly. Environmental Microbiology Reports. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular biology and evolution. 10, 512-526. Tibatá, V. M., et al., 2018. Molecular detection of Melissococcus plutonius assessed in Africanized honey bee populations (Apis mellifera) in three regions of Colombia. Journal of Apicultural Research. 1-7.

23

Figure captions

Figure 1. Geographical areas of the major beekeeping regions of Chihuahua state, Mexico.

Figure 2. Prevalence of typical and atypical strains of M. plutonius in the major beekeeping regions of Chihuahua State Mexico. Different letters indicate significant difference between overall prevalence of M. plutonius; ^ Indicates a significant difference between regions in the detection of combined strains of M. plutonius; v Indicates a significant difference between regions in the detection of typical strains of M. plutonius, with a confidence interval of 95%. The empty circles in the segmented line represent regions with warm weather (BSh and BWh), the filled circles in the segmented line represent regions with cold weather (BSk).

Figure 4. Electrophoresis in agarose gels. A) Duplex PCR for detection of typical and atypical M. plutonius from larvae samples; M, molecular weight marker; C-, negative control; T+, positive control for typical M. plutonius ATCC 35311; A+, positive control for atypical M. plutonius C1; Lanes 1-2, samples with typical M. plutonius; Lanes 3-4, samples with atypical M. plutonius; Lanes 5-6, samples with typical and atypical M. plutonius. B) M. plutonius identification by specific 16S rRNA gene amplification. M, molecular weight marker; C-, negative control; C+, positive control for M. plutonius ATCC 35311; Lanes 1-6 isolates of M. plutonius. C) Gene amplification for MLST analysis; M, molecular weight marker; BT; gene 24

gbpB, ET; gene argE, KT; gene galK, RT; gene purR for typical M. plutonius; BA; gene gbpB, EA; gene argE,

KA; gene galK,

RA; gene purR for atypical M.

plutonius.

Figure 3. Visual detection of EFB and M. plutonius prevalence. Confidence intervals of 95%.

Figure 5. Updated goeBURST tree of STs from different countries, each circle represents a different ST, with lines linking closest relatives. Black lines indicate a single allelic change between STs and light gray lines indicate difference at two loci. Circles ringed with a yellow outline indicate putative founder genotypes. Colors within circles show the proportion of isolates of a particular type that were found in the countries indicated in the key.

Figure 6. Molecular phylogenetic analysis by Maximum Likelihood method, constructed from a 2109 bp concatenated alignment from all four MLST alleles. Horizontal segmented red lines delimit the three clonal complexes (CC3, CC12 and CC13) as defined by goeBURST. Individual EFB cases analyzed in this study are represented by colored bars aligned to the corresponding ST; green= Chihuahua, red= Jiménez, dark blue= Parral, light blue= Delicias, pink= Aldama, gray= Cuauhtemoc and black= Nuevo Casas Grandes (NCG).

25

26

27

28

29

30

31

Table 1. PCR primers used for the amplification of different M. plutonius sequences.

Primer galK L galK R argE L argE R gbpB L gbpB R purR L purR R primer 1 primer 2 Mp-T-F Mp-T-R Mp-A-F Mp-A-R

Target gene

Oligonucleotide sequence (5’-3’)

TTTCCAGCAGCAATTACAA GGGTAGGGATTTTTGAAGAG GGTGGGACATTTAGACGTAG Acetylornithine deacetylase AAATTAAGACCCAACCCTTC AGCAGCTAAACAGAATGAGC Secreted antigen GCCAACGTCTAACAGATACC ACCACCAAGTGCCAGTATTA Purine operon repressor CGATTTTGTTCTGATAACCTG GAAGAGGAGTTAAAAGGCGC 16S rRNA gene TTATCTCTAAGGCGTTCAAAGG + + Na /H antiporter TGGTAGCTTAGGCGGAAAAC gene, napA TGGAGCGATTAGAGTCGTTAGA Fur family GAGAACGATTCGGTACAAGC transcriptional CCTTTTCTTCACATTCTGGACAT regulator gene Galactokinase

PCR product size (pb)

Reference

565 579 386-632

Haynes et al. (2013)

507 832 187

Govan et al. (1998) Arai et al. (2014).

424

32

Table 2. Analysis of M. plutonius isolates from seven beekeeping regions in Chihuahua State, Mexico

Region

Isolated from larvae with symptomsa

Type of MLST No. of strainb resultsc strains

ST12 1 ST36d 8 ST12 8 ST19 4 Chihuahua 10 atypical ST34 3 ST36d 7 d ST38 4 ST19 1 d ST36 2 Cuauhtémoc 2 atypical ST37d 1 d ST38 2 ST12 1 Delicias 2 atypical d ST36 8 typical ST3 1 ST12 1 Jiménez 6 ST19 2 atypical ST34 8 ST36d 2 ST19 3 1 NCG 0 atypical ST34 d ST36 1 typical ST3 1 ST19 7 Parral 5 1 atypical ST34 d ST37 3 a Larvae with symptoms were determined as reported by Forsgren (2010) b M. plutonius isolates were classified into typical and atypical by the duplex PCR (Arai et al., 2014). c The MLST analysis was performed by sequencing four genes (Haynes et al., 2013) d Novel STs found in this study. Aldama

0

atypical

33

Highlights •

Typical and atypical strains of Melissococcus plutonius were detected in beehives from Mexico

•

Visual symptoms correlate with molecular detection of M. plutonius

•

Three new STs of M. plutonius were identified

•

First report in Mexico about the molecular characterization of M. plutonius

34

35