Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase

Journal Pre-proof Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase Ravil R. Garafutdinov, Assol R. Sakhabutdinova, Maxim S. Kupryushkin, Dmitrii V. Pyshnyi PII:

S0300-9084(19)30336-0

DOI:

https://doi.org/10.1016/j.biochi.2019.11.013

Reference:

BIOCHI 5796

To appear in:

Biochimie

Received Date: 20 August 2019 Accepted Date: 20 November 2019

Please cite this article as: R.R. Garafutdinov, A.R. Sakhabutdinova, M.S. Kupryushkin, D.V. Pyshnyi, Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase, Biochimie, https://doi.org/10.1016/j.biochi.2019.11.013. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.

Abstract

Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. For isothermal amplification, DNA polymerases with strand-displacement activity are needed, and Bst exo- polymerase is one of the most commonly used. Unfortunately, Bst exo- causes nonspecific DNA amplification (so-called multimerization) under isothermal conditions that results in undesirable products (multimers) consisting of tandem nucleotide repeats. Multimerization occurs only for short ssDNA or primer dimers, and the efficiency of multimerization depends significantly on the reaction conditions, but slightly depends on the sequence of DNA templates. In this study we report the prevention of DNA multimerization using a new type of modified oligonucleotide primers with internucleosidic phosphates containing 1,3-dimethyl-2-imino-imidazolidine moieties (phosphoryl guanidine (PG) groups). Primers with one, two or three PG groups located at the 3'- or 5'-ends or in the middle of the primers were designed. It turned out, such bulky groups interfere with the moving of Bst exopolymerase along DNA chains. However, one modified phosphate does not notably affect the efficiency of polymerization, and the elongation is completely inhibited only when three contiguous modifications occur. Multimerization of the linear ssDNA templates is blocked by three modifications in the middle of both primers whereas specific amplification of the circular ssDNA by rolling circle amplification is not inhibited. Thus, incorporation of three PG groups is sufficient to prevent multimerization and allows to create improved primers for reliable isothermal amplification with Bst exo- DNA polymerase.

Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase

Authors:

Ravil R. Garafutdinov (corresponding author) Institute of Biochemistry and Genetics, Ufa Federal Research Centre, Russian Academy of Sciences Address: 450054, prosp. Oktyabrya, 71, Ufa, Bashkortostan, Russia Tel./fax: +7 347 235-60-88 E-mail address: [email protected]

Assol R. Sakhabutdinova Institute of Biochemistry and Genetics, Ufa Federal Research Centre, Russian Academy of Sciences Address: 450054, prosp. Oktyabrya, 71, Ufa, Bashkortostan, Russia Tel./fax: +7 347 235-60-88 E-mail address: [email protected]

Maxim S. Kupryushkin Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, Address: 630090, Lavrentiev avenue 8, Novosibirsk, Russia, Tel./fax: +7 383 363-51-36 E-mail address: [email protected]

Dmitrii V. Pyshnyi Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, Novosibirsk State University Address: 630090, Lavrentiev avenue 8, Novosibirsk, Russia, Tel./fax: +7 383 363-51-51 E-mail address: [email protected]

1

Abstract Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. For isothermal amplification, DNA polymerases with strand-displacement activity are needed, and Bst exo- polymerase is one of the most commonly used. Unfortunately, Bst exo- causes nonspecific DNA amplification (so-called multimerization) under isothermal conditions that results in undesirable products (multimers) consisting of tandem nucleotide repeats. Multimerization occurs only for short ssDNA or primer dimers, and the efficiency of multimerization depends significantly on the reaction conditions, but slightly depends on the sequence of DNA templates. In this study we report the prevention of DNA multimerization using a new type of modified oligonucleotide primers with internucleosidic phosphates containing 1,3-dimethyl-2-imino-imidazolidine moieties (phosphoryl guanidine (PG) groups). Primers with one, two or three PG groups located at the 3'- or 5'-ends or in the middle of the primers were designed. It turned out, such bulky groups interfere with the moving of Bst exo- polymerase along DNA chains. However, one modified phosphate does not notably affect the efficiency of polymerization, and the elongation is completely inhibited only when three contiguous modifications occur. Multimerization of the linear ssDNA templates is blocked by three modifications in the middle of both primers whereas specific amplification of the circular ssDNA by rolling circle amplification is not inhibited. Thus, incorporation of three PG groups is sufficient to prevent multimerization and allows to create improved primers for reliable isothermal amplification with Bst exo- DNA polymerase.

Key words Isothermal amplification, multimerization, rolling circle amplification, Bst exo- DNA polymerase, phosphoryl guanidine oligonucleotides (PGO), blocking modifications

1. Introduction Nucleic acids amplification by polymerase chain reaction (PCR) became the routine technique in molecular diagnostics, forensics, food control, etc. [1-3]. However, due to a number of limitations that restrict PCR assay, new approaches based on isothermal amplification have been developed [4-6]. Isothermal methods are characterized by high efficiency due to the sustainable work of enzymes and are an excellent alternative to PCR [4, 7]. The use of isothermal amplification for detection of pathogenic or genetically modified organisms, markers of human diseases, analysis of environmental samples and even inorganic pollutants have been described [8-10]. A number of isothermal techniques have been proposed: Rolling Circle Amplification (RCA) [11, 12], Loop mediated AMPlification (LAMP) [13], Nucleic Acid Sequence Based Amplification (NASBA) 2

[14], etc. RCA is a very versatile method based on amplification of the small single-stranded circular DNA templates, which can be differently designed according to the problem that must be solved [12, 15]. When RCA is carried out with only one primer, long single-stranded DNA products are formed. If more than one primer is used (hyperbranched RCA, or ramification), a set of doublestranded concatameric DNA products is accumulated and appears on electrophoretic gels as a ladder [16]. Due to high sensitivity and broad range of application, RCA has become a powerful tool in biomedical and nanotechnological studies [15, 17-20]. Isothermal amplification requires polymerases with strand-displacement activity in order to provide effective denaturation of dsDNA at a constant temperature. Among these Bst exo- (the large fragment of DNA polymerase I from Geobacillus stearothermophilus), phi29, Vent exopolymerases are the most commonly used. Bst exo- polymerase has strong strand-displacement activity, moderate thermal stability and high processivity, but frequently results in undesirable amplification products. Unfortunately, during amplification with Bst exo- polymerase, short linear DNA and two primers, the multimeric products consisting of tandem nucleotide repeats are readily accumulated [21]. The multimers appear on electrophoretic gels as a ladder that makes it impossible to distinguish the results of specific (e.g., with circular template) and nonspecific amplification. Recently, a hypothesis on DNA multimerization by Bst exo- polymerase has been proposed [22]. It has been demonstrated with short linear single-stranded DNA and one primer, that after primer's annealing and extension, the free 3’-end of the initial template molecule bends and anneals at the opposite part of the duplex followed by a cycle-like structure formation and elongation. This results in the formation of an additional annealing site for the primer, and further amplification leads to exponential accumulation of multimers. However, the cause of DNA termini bending remains unclear. Multimerization can hinder the interpretation of amplification results and make it impossible to produce accurate and reliable DNA diagnostics. In this study, a simple approach for complete elimination of DNA multimerization using modified primers is proposed. The data obtained would allow for an increase in the specificity of isothermal amplification methods.

2. Materials and methods 2.1. Reagents The following reagents were used: Bst 2.0 DNA polymerase and Isothermal buffer (New England Biolabs); T4 DNA ligase, exonuclease I, T4 polynucleotide kinase, dNTP (Thermofisher Scientific); SYBR Green I (Lumiprobe); acrylamide, N,N’-methylenbisacrylamide, Tris, ammonium persulfate, N,N,N’,N’-tetramethylethylenediamine, N,N,N’,N’ethylenediaminetetraacetic acid disodium salt (Applichem), phenol, acetonitrile and tetrahydrofuran 3

for DNA synthesis (Panreac); potassium chloride, ammonium sulfate (Sigma); 2-cyanoethyl deoxynucleoside phosphoramidites and CPG solid supports for DNA synthesis (Glen Research); pAL2-T vector (Evrogen, Russia). All solutions were prepared with highly purified water (>18 MOm) (Millipore).

2.2. Oligonucleotides Linear DNA templates LTa-LTf, unmodified oligonucleotide primers Fa-Ff and Ra-Rf and splint probes Sa-Sf were designed using an OligoAnalyzer tool (Integrated DNA Technologies) and purchased from Syntol (Russia). Oligonucleotides Fc1-Fc9 and Rc1-Rc9 with internucleosidic phosphoryl 1,3-dimethyl-2-imino-imidazolidine groups (phosphoryl guanidine oligonucleotides (PGO)) were synthesized as described in [23, 24]. PGO were isolated by reverse-phase HPLC on an Agilent 1200 HPLC system (USA) using a Zorbax SB-C18 (4.6x150 mm) column with a linear gradient of elution buffer (0-50% acetonitrile in 20 mM triethylammonium acetate, pH 7.0, flow rate 2 ml/min). Purified oligonucleotides were concentrated followed by precipitation with 2% LiClO4 in acetone, washing with pure acetone and desiccation under vacuum. PGO structures were confirmed by MALDI-TOF mass spectra recorded on a Reflex III Autoflex mass spectrometer (Bruker) using 3-hydroxypicolinic acid or LC-MS/MS ESI MS on an Agilent G6410A mass spectrometer (USA) in a negative ion mode. Molecular masses of phosphoryl guanidine oligonucleotides were calculated using experimental m/z values and are given in [25]. Stock solutions were prepared by dilution of precipitates in deionized water. The oligonucleotide sequences are listed in Table 1.

Table 1. Oligonucleotides. Name

Sequence, 5’→3’

LTa

GTCACGTCAGTCCTGTAGTGCTCAGTGTCGTCGTACAGCCTACATTGCAGA

Fa

GTCACGTCAGTCCTGTAGTGCTCAGT

Ra

TCTGCAATGTAGGCTGTACGACGAC

Sa

GACTGACGTGACTCTGCAATG

LTb

CTCTCTCTCTCGCTGACGTGCTCAGTGTCGTCGTACAGCCTAAGGAGAAGA

Fb

CTCTCTCTCTCGCTGACGTGCTCAGT

Rb

TCTTCTCCTTAGGCTGTACGACGAC

Sb

AGAGAGAGAGTCTTCTCCTTA

LTc

CCTCTTGCTTTCGCTCTCGTTCTTTACAGAACACAGACGAGAAGAAGACCA

Fc

CCTCTTGCTTTCGCTCTCGTTCTTT 4

Fc1

CCTCTTGCTTTCGCTCTCGTTCTp*TT

Fc2

СCTCTTGCTTTCp*GCTCTCGTTCTTT

Fc3

Cp*CTCTTGCTTTCGCTCTCGTTCTTT

Fc4

CCTCTTGCTTTCGCTCTCGTTCp*Tp*TT

Fc5

CCTCTTGCTTTCp*GCp*TCTCGTTCTTT

Fc6

СCTCTTGCTTTCGCTCTCGTTp*Cp*Tp*TT

Fc7

CCTCTTGCTTTCp*Gp*Cp*TCTCGTTCTTT

Fc8

CCTCTTGCTp*TTCp*GCp*TCTCGTTCTTT

Fc9

Cp*Cp*Tp*CTTGCTTTCGCTCTCGTTCTTT

Rc

TGGTCTTCTTCTCGTCTGTGTTCTGT

Rc1

TGGTCTTCTTCTCGTCTGTGTTCTp*GT

Rc2

TGGTCTTCTTCTCp*GTCTGTGTTCTGT

Rc3

Tp*GGTCTTCTTCTCGTCTGTGTTCTGT

Rc4

TGGTCTTCTTCTCGTCTGTGTTCp*Tp*GT

Rc5

TGGTCTTCTTCTCp*GTp*CTGTGTTCTGT

Rc6

TGGTCTTCTTCTCGTCTGTGTTp*Cp*Tp*GT

Rc7

TGGTCTTCTTCTCp*Gp*Tp*CTGTGTTCTGT

Rc8

TGGTCTTCTTp*CTCp*GTp*CTGTGTTCTGT

Rc9

Tp*Gp*Gp*TCTTCTTCTCGTCTGTGTTCTGT

Sc

AAAGCAAGAGGTGGTCTTCTTC

LTd

AGGAGAAGACTGCTGACGTGCTCAGTGTCGTCGTACAGCCTACTCTTCCTC

Fd

AGGAGAAGACTGCTGACGTGCTCAGT

Rd

GAGGAAGAGTAGGCTGTACGACGAC

Sd

AGTCTTCTCCTGAGGAAGAGTA

LTe

ATTATTAGACTGCTGACGTGCTCAGTGTCGTCGTACAGCCTACGCTGCCGC

Fe

ATTATTAGACTGCTGACGTGCTCAGT

Re

GCGGCAGCGTAGGCTGTACGACGAC

Se

CAGCAGTCTAATAATGCGGCAGCG

LTf

CTGCCGCGACTGCTGACGTGCTCAGTGTCGTCGTACAGCCTACGATTATTA

Ff

CTGCCGCGACTGCTGACGTGCTCAGT

Rf

TAATAATCGTAGGCTGTACGACGAC

Sf

TCGCGGCAGTAATAATCGTAG p* corresponds to modified phosphates (PG groups).

5

2.3. DNA circularization The circular DNA templates was prepared as follows. One pmol of each linear oligonucleotides LTa-LTf was routinely phosphorylated by T4 polynucleotide kinase in a 10 ul reaction mixture. Then, 5 pmol of corresponding splint probe Sa-Sf and 2 ul of T4 DNA ligase buffer were added, and the reaction mixtures were put in T100 thermal cycler (Bio-Rad Laboratories) for DNA strands annealing. The temperature was slowly decreased from 80 to 25°С within 1 hour. After the end of annealing, 2 ul of 10 mM ATP and 5 U of T4 DNA ligase were added. The mixtures were incubated for 18 h at 8°С, after which the ligase was inactivated at 75°С for 15 min. Then, 1 U of exonuclease I was added in each sample, and the reaction mixtures were incubated for 2 h at 37°С and then for 1 h at 45°С followed by enzyme inactivation at 85°С for 15 min. The circular DNA templates were diluted up to 107 molecules/ul and used for further amplifications without additional purification.

2.4. Isothermal DNA amplification All amplification samples were prepared in an UVC/T-M-AR PCR box (Biosan). The working space, dispensers, and plastic ware were preliminarily irradiated with ultraviolet for 20 min. Amplification was carried out in an iQ5 thermal cycler (Bio-Rad Laboratories) in 10 ul of reaction mixture containing 107 linear or 107 circular DNA target copies per reaction, 5 pmol of each primer, 1 ul of 2.5 mM dNTP, 1× Isothermal buffer, 0.1× SYBR Green I intercalating dye and 1.5 U of Bst 2.0 polymerase. Each sample was represented in three repeats. The program of amplification consisted of the following steps: 1) 70°С – 30 s, 2) 60°С – 3 h. For an evaluation of the influence of temperature on multimerization efficiency, the experiments with a temperature gradient were held (40-65°С range for the third step). In some cases, the amplification results were additionally analyzed by PAGE followed by ethidium bromide staining and visualization in the Gel Camera System (UVP Inc.).

2.5. Sequencing The nucleotide sequences of amplification products were determined as follows. The amplicons were preliminarily purified by phenol-chloroform extraction [26] and routinely cloned with pAL2-T vector in E. coli XL1-Blue competent cells. Isolated plasmid DNA were sequenced using ABI Big Dye Terminator chemistry on 3500 Genetic Analyzer.

6

3. Results and discussion

3.1. Experimental design When nucleic acids amplification is carried out with Bst exo- polymerase, nonspecific products formation often occurs that significantly limits the use of isothermal methods, e.g. Rolling Circle Amplification (RCA) and Loop mediated AMPlification (LAMP). In both methods, a set of specific DNA products with different lengths is formed, which cannot be distinguished from undesired products when nonspecific amplification occurs. Recently, DNA multimerization on short single-stranded DNA template was convincingly demonstrated [21, 22]. According to [22], DNA multimerization by Bst exo- polymerase includes the formation of a cycle-like DNA structure and further extension of annealed 3’-ends. The products of multimerization appear as a ladder on electrophoretic gels and represent tandem repeats that correlate with nucleotide sequence of initial template [21, 22]. Thereby, the multimerization is same to hyperbranched rolling circle amplification where concatameric products are formed. Since the exact mechanism of DNA multimerization by Bst exo- polymerase remains controversial, further studies are required and the search for methods that suppress this by-side reaction is relevant. We hypothesized that the multimerization can be blocked by primers containing modified phosphate groups that interfere with the elongation of DNA by polymerase. Currently, oligonucleotide chemistry allows for the synthesis of DNA and RNA analogues with different modifications of the sugar-phosphate backbone. Among them, peptide nucleic acids and morpholino oligonucleotides have been the most actively studied over the past 20 years and began to be used as therapeutic agents [27, 28] due to charge-neutral backbone and the ability to hybridize with natural DNA and RNA sequences. In this study, primers with modified internucleosidic phosphates containing guanidine derivative – 1,3-dimethyl-2-imino-imidazolidine moieties (PG groups) were used (Fig. 3A). Unlike peptide nucleic acids and morpholino oligonucleotides, phosphoryl guanidine oligonucleotides (PGOs) can be synthesized by conventional phosphoramidite chemistry using standard DNA synthesizers. The number and position of PG groups in oligonucleotide can be varied, and it is possible to obtain either completely or partially modified oligonucleotides [23, 24]. PGOs can bind with complementary DNA and RNA to form stable double-stranded structures that differ only slightly in their thermal stability from the natural duplexes. However, taking into account the hydrophobicity and the large size of modified phosphate groups, steric hindrances in 'DNA-polymerase-triphosphate' complex formation during DNA polymerization is possible. It is known that some nucleic acid analogues with small unnatural groups can undergo enzymatic transformations [29-31] but some analogues are inactive [32, 33]. Previously, we have shown that PGOs can act as primers for DNA amplification in polymerase 7

chain reaction [34], but their possibility to be extended and used as primers in isothermal amplification with Bst exo- polymerase was unclear. To clarify this, model experiments with artificial short single-stranded DNA templates (LTa-LTf) and two corresponding primers (F/R pairs) that are not homologous to any known genomic sequences were performed. A similar molecular set (linear DNA template and two primers) is common for the most reactions of DNA or RNA amplification, for example, in PCR after cDNA synthesis or in primer dimers formation, in LAMP or during microRNA amplification. Since the rolling circle amplification was used as an amplification control, the circular templates CTa-CTf were obtained from linear templates by ligation on the splint probes Sa-Sf (Fig. 1).

Figure 1. The scheme of circular templates (CT) synthesis and isothermal amplification of circular and linear (LT) templates (S - splint probe).

Initially, R primer is annealed to the 3’-part of the linear template LT or to the circular template CT and is extended by DNA polymerase, resulting in short double-stranded amplicon for LT amplification or long single-stranded DNA product for CT amplification at the first step of the reaction. Then, the F primer anneals to the new strand built by the polymerase after extension of the R primer. Multimers accumulation is achieved through LT multimerization after cycle-like structure formation (see Fig. 4), whereas for CT the products of amplification are formed by hyperbranched RCA reaction (Fig. 1). The multimers and concatamers are clearly visible on electrophoretic gels and represent as the molecular ladders with bands that multiple to the length of the initial template 8

(1L…nL). In all our experiments, the samples both with linear and circular templates were prepared. Amplification was carried out with a program consisting of the following temperature steps: 1) 70°С – 30 s, and 2) 60°С – 3 h. The first temperature (70°С) is included in order to dissociate the probable secondary structures. The higher temperature was impermissible because of Bst exo- polymerase inactivation at 80°С within 10 minutes. Then, the elongation step was performed over 3 hours at a constant temperature (60°С) that corresponds to primers annealing. No temperature changes for modified primers were used.

3.2. Effect of reaction conditions and the sequence of DNA templates on multimerization In our previous study we found that the most effective multimers formation is caused by Bst 2.0 or Bst 2.0 WarmStart DNA polymerases along with an Isothermal buffer [35]. Besides, the multimers are mainly formed at 55-60°C (Fig. 2A). Likely, at this temperature range the equilibrium between annealed and dissociated states of amplicon termini (so called ‘breathing’ of double stranded DNA) is achieved and the multimerization initiation is most effective.

Figure 2. Dependence of isothermal amplification on temperature (for Fc/Rc pair, Bst 2.0 polymerase and Isothermal buffer). (A, C) - amplification of a circular DNA template (rolling circle amplification), and (B, D) - amplification of a linear DNA template (multimerization). N/A – no amplification.

9

In contrast, concatameric products are accumulated at broader temperature range (45-63°C) with an optimum at 60-63°C (Fig. 2B) that is near with maximum of enzyme activity (65°C). Realtime amplification showed that for samples with circular templates the rise of fluorescence occurred at the early reaction times (small time-to-treshold (Tt) values), while for samples with linear templates the curves had different and increased Tt values (Fig. 2C and 2D). The difference in Tt values within repeats with the linear template is, apparently, due to the fact that the start of multimerization is a likely random and very rare event, which can occur only in certain conditions. It was also shown that multimerization occurs only for relatively short (50-60 nucleotides) linear single-stranded DNA or primer dimers and does not depend on the nucleotide sequence of the whole templates [35]. However, there is a data on the sequence-dependent nature of nonspecific DNA amplification using Bst polymerase [36]. We decided to specify the influence of primary structure on multimerization efficiency once again by varying the nucleotide composition of the 5'and 3'-termini of the templates. For this, a set of short LTa-LTf templates with the same length (51 nt) but different sequences were designed. LTa template has a uniform composition, LTb has pyrimidine-rich 5'-end and purine-rich 3'-end. In contrast, LTd has pyrimidine-rich 3'-end and purine-rich 5'-end. LTe and LTf have GC-rich 3'- and 5'-termini ('GC-clamp') and AT-rich 5'- and 3'-termini respectively. As for LTc, the 5'-half of this template contains mostly pyrimidines, and the 3'-half consists mainly of purines. It turned out the multimerization is occurred for all templates excluding LTe, and its efficiency diminished as follows: LTa ≈ LTb ≈ LTc >> LTd ≈ LTf (see [25]). The lack of multimerization for LTe indicates that multimerization is affected by stabilization of the double-stranded structure, since the GC-clamp prevents the 'breathing' of the ends of the initiating duplex and the formation of cycle-like structure I (see Fig. 4, step 2). On the other hand, the unstable AT-rich 3′-end of the LTf does not increase the multimerization efficiency, and templates only with a high purine content at the 3'-end provide a high multimerization rate as was shown earlier [36].

3.3. Effect of PG-modified primers on multimerization Since the highest efficiency of multimerization is inherent for Bst 2.0 polymerase in Isothermal buffer and at 55-60°С, therefore these conditions were used in further experiments with modified primers bearing PG groups (Fig. 3A). LTc was taken as a template too because the suitable primers Fc and Rc have a peculiar pyrimidine-rich structure that prevents the formation of homo- and heterodimers. The influence of PG modifications on Bst exo- polymerase activity was unknown, so several primer pairs with one (Fc1/Rc1, Fc2/Rc2, Fc3/Rc3), two (Fc4/Rc4, Fc5/Rc5) or three modified internucleosidic phosphates (Fc6/Rc6, Fc7/Rc7, Fc8/Rc8, Fc9/Rc9) were used (Fig. 3B). Primers with three options of PG position were designed: near the 3'-end (Fc1/Rc1, 10

Fc4/Rc4 and Fc6/Rc6 pairs), in the center (Fc2/Rc2, Fc5/Rc5, Fc7/Rc7 and Fc8/Rc8 pairs) and near the 5'-end (Fc3/Rc3 and Fc9/Rc9 pairs) of the primers. In primers containing two or three PG groups, modifications were separated by one nucleoside with the exception of the Fc8/Rc8 pair where PG groups were separated by two and three nucleosides. Taking into account the nature of phosphoryl guanidine groups, one can expect that modifications in the middle of the primers or at the 5'-ends should likely prevent multimerization. As for location at the 3'-end, prevention of both specific and nonspecific amplification should occur.

Figure 3. The structure of the primers: (A) modified internucleosidic phosphate bearing 1,3dimethyl-2-imino-imidazolidine moieties (PG group) in sugar-phosphate backbone; (B) location of the modifications (dark circles) in primer pairs.

The mechanism of multimerization blocking is proposed on Figure 4. Firstly, modified R primer is annealed at the linear template and extended by polymerase (step 1), providing single (1L) double-stranded DNA product. Then, the cycle-like structure I is formed (step 2) according to [22] and elongation of the 3'-end is proceeded until the polymerase meets the PG groups (step 3). When polymerase encounters the modified phosphate, no further amplification might occur, i.e. the amplification will be blocked (step 4b). If polymerase passes the modified phosphate, it will complete the strand, giving the duplex with long 5’-overhang (structure II) (step 4a). Then extension of another strand or R primer annealing can occur (step 5) followed by the formation of the product with double nucleotide sequence (2L) (steps 6 and 7b). The displaced strand indicated on the scheme as III binds to the modified F primer (step 7a) and then is involved in amplification steps 1'-7' that are similar to steps 1-7. Multiple repeats of the steps 3-i leads to DNA multimerization, and a set of the products with different lengths (nL) is formed as a result of the reaction. The scheme on Fig. 4 shows the start of multimerization only from the right end of the duplex. However, a similarly symmetrical process can occur from the opposite end, and both F and R primers must be modified. Obviously for the RСА reaction, blocking of amplification is achieved 11

only if primers with modifications at the 3'-ends are used since the other positions will not interfere with the polymerase (the scheme is not shown).

Figure 4. The mechanism of multimerization blocking: R primer annealing and extension resulting in a single (1L) double-stranded product (step 1), cycle-like secondary structure formation (step 2) and the beginning of elongation (step 3), blocking of multimerization when PG groups arrest polymerase movement (step 4b) or normal elongation when PG groups don’t hamper polymerase movement (step 4a), extension of upper strand or R primer annealing (step 5), formation of full amplicon with duplicate nucleotide sequence (steps 6a, 6b and 7b), displacement of strand III and F 12

primer annealing (step 7a), formation of full amplicons with multiple (tandem) nucleotide repeats (steps i). Sequences of F primer and complementary sites are in black, sequences of R primer and complementary sites are in grey. Star symbols on DNA chains schematically indicate the position of serial PG groups (near the 3'-end, in the middle and near the 5'-end of the F or R primers).

All suitable primer pairs as well as mixed pairs were used to amplify both linear and circular templates (Table 2). It turned out, modifications near the 5'-end of the primers (Fc3/Rc3 and Fc9/Rc9 pairs) do not affect the efficiency of amplification. One PG group near the 3'-end (Fc1/Rc1 pair) slightly retards amplification whereas two PG groups (Fc4/Rc4 pair) delay and three PG groups (Fc6/Rc6 pair) stop any amplification. Moreover, complete inhibition of amplification for all mixed pairs with any primer from Fc6/Rc6 pair was also observed.

Table 2. The mean Tt (time-to-threshold) for linear (LTc) and circular (CTc) templates amplification (minutes)*. Primer pairs

LTс

CTс

Primer pairs

LTс

CTс

Fc/Rc

53.4±5.9

15.2±1.5

Fc5/Rc5

50.8±9.6

13.9±1.6

Fc1/Rc1

67.8±5.3

27.4±2.1

Fc6/Rc6

-

-

Fc2/Rc2

50.6±7.1

13.5±1.4

Fc7/Rc7

-

11.6±1.5

Fc3/Rc3

53.2±6.8

15.7±1.8

Fc8/Rc8

47.2±6.3

13.5±2.0

Fc4/Rc4

110.3±14.7

60.4±1.7

Fc9/Rc9

60.2±5.6

11.2±1.3

Fc/Rc1

43.5±7.4

17.3±1.8

Fc1/Rc

50.7±4.4

13.4±1.4

Fc/Rc4

-

60.5±2.2

Fc4/Rc

-

50.6±1.5

Fc/Rc5

67.8±8.6

47.5±1.7

Fc5/Rc

63.5±7.8

13.2±1.9

Fc/Rc6

-

-

Fc6/Rc

-

-

Fc/Rc7

63.4±5.3

53.4±1.4

Fc7/Rc

77.1±11.3

53.6±1.4

Fc1/Rc4

-

36.6±1.6

Fc4/Rc1

-

33.5±1.6

Fc1/Rc5

63.7±5.5

27.2±1.4

Fc5/Rc1

67.6±10.5

17.7±1.5

Fc1/Rc6

-

-

Fc6/Rc1

-

-

Fc1/Rc7

77.3±8.2

60.4±1.9

Fc7/Rc1

74.8±7.3

53.5±2.0

Fc4/Rc5

74.5±5.1

33.6±1.8

Fc5/Rc4

-

27.4±1.5

Fc4/Rc7

63.3±4.8

50.5±1.1

Fc7/Rc4

-

60.2±2.1

Fc6/Rc7

-

-

Fc7/Rc6

-

-

* Only the most relevant data for mixed pairs are given. Tt values for all combinations of unmodified and modified primers are given in [25]. 13

The most relevant result was obtained for the Fc7/Rc7 pair (three PG groups in the middle of both primers) which prevents multimerization while specific amplification is not inhibited. It was surprising that the Fc8/Rc8 pair, similar to Fc7/Rc7, but having PG modifications separated by only 2-3 nucleosides, did not lead to the blocking of multimerization. Although the inhibition of multimerization for some mixed pairs (Fc/Rc4, Fc4/Rc, Fc1/Rc4, Fc4/Rc1, Fc5/Rc4, Fc7/Rc4) was observed as well, the efficiency of corresponding specific amplification was satisfactory only for Fc7/Rc7 pair. Thus, complete inhibition of multimerization occurs only for F/R pairs with three contiguous PG groups in the middle of the primers.

3.4. Effect of PG-modified primers on the primary structure of amplification products Additionally, the primary structure of the amplicons was determined to study how Bst exopolymerase passes the sites with PG groups. For this, the cloning of multimers and concatamers obtained with Fc/Rc-Fc5/Rc5 and Fc7/Rc7-Fc9/Rc9 pairs were carried out in a T-like pAL2-T vector. Because the reaction mixtures after amplification contain products with different lengths, plasmid DNA with different lengths of insertions was sequenced. The cloning was successful for all pairs except Fc9/Rc9 containing three contiguous PG groups at the 3’-ends. In this case, the polymerase cannot complete the 3'-ends in amplicons and gives the products with 5'-overhangs which makes ligation with a vector impossible. It was found for multimers that single insertions (1L) fully repeated the template sequence in all cases (Fig. 5). The multiple insertions (≥2L) represented the sequences consisting of unidirectional repeats and had deletions at the junctions of repeats for both 3’- or 5’-ends. The size of the deletions within one insertion was mainly constant and most of the deletions were 2-5 nucleotides large. It turned out the PG groups did not affect the primary structure of the amplicons and the size of the deletions. The sequencing of concatamers revealed their anticipated structure that contained repeats of the initial DNA template sequence without any additional nucleotides or deletions at the junctions of the repeats (data not shown). Thus, the presence of modifications in primers did not violate the nucleotide sequence of amplification products.

14

Figure 5. Nucleotide sequences of cloned multimerization products (only one clone out of 10 analyzed for each primer pair is shown as an example).

4. Conclusion Bst exo- polymerase is extremely inclined to multimerization of short DNA templates under isothermal conditions leading to nonspecific multimeric products accumulation. Obviously, these by-products can complicate the interpretation of obtained results due to similarity with the products of Rolling Circle Amplification and Loop-mediated AMPlification. Until the detailed molecular 15

mechanism of multimerization will be discovered it is necessary to use techniques that allow the suppression of this by-side reaction. Previously, we found that multimerization occurs only for short linear ssDNA or primer dimers, and the efficiency of multimerization significantly depends on the reaction conditions. Here, we have shown that the primary structure of the templates does not greatly affect the efficiency of multimerization, and only the GC-clamp at the 3'-end of the initiating duplex can inhibit nonspecific amplification. However, multimerization can be prevented by chemically modified primers arresting DNA elongation using polymerase. We studied multimerization blocking using primers bearing substituted guanidine residues at the phosphate backbone. It turned out that one PG modification does not affect the efficiency of amplification, and complete inhibition of elongation occurs only for primers with three contiguous PG groups. Multimerization is blocked if three modified phosphates in the middle of both primers are present whereas specific amplification is not inhibited. PG groups don’t disrupt the nucleotide sequence of amplification products. However, multimers have short deletions at the junctions of the repeats regardless of PG modifications. Since three contiguous phosphoryl guanidine groups in the middle of both primers are sufficient to prevent multimerization, this combination should be used to create improved primers that can provide accurate and reliable isothermal amplification with Bst exoDNA polymerase.

Acknowledgments This work was partially supported by Russian State Federal budget (No. АААА-А16116020350032-1). M.S.K. and D.V.P. thank the Russian Science Foundation [grant No. 18-1400357] for financial support concerning oligonucleotide synthesis and purification. Authors acknowledge T.Yu. Bushueva for fruitful technical assistance.

Author Contributions R.R.G. designed the experiments and drafted the manuscript. A.R.S. carried out the experiments, collected and analyzed the data. M.S.K. performed the synthesis of modified oligonucleotides and analyzed the data. D.V.P. coordinated the project and edited the manuscript. All authors approved the final version of the article. References

[1] K.B. Mullis, F.A. Faloona, Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction, Methods Enzymol. 155 (1987) 335-350.

16

[2] J.M.S. Bartlett, D. Stirling, Methods in molecular biology, 226: PCR protocols, second ed., Humana, Totowa, NJ, 2003. [3] V.V. Demidov, N.E. Broude, DNA amplification: current technologies and applications, first ed., Horizon bioscience, Wymondham, UK, 2004. [4] M. Fakruddin, K.S. Mannan, A. Chowdhury, R.M. Mazumdar, M.N. Hossain, S. Islam, M.A. Chowdhury, Nucleic acid amplification: alternative methods of polymerase chain reaction, J. Pharm. Bioallied Sci. 5 (2013) 245-252. [5] Y. Zhao, F. Chen, Q. Li, L. Wang, C. Fan, Isothermal amplification of nucleic acids, Chem. Rev. 115 (2015) 12491-12545. [6] O. Mayboroda, I. Katakis, S.K. O'Sullivan, Multiplexed isothermal nucleic acid amplification, Anal. Biochem. 545 (2018) 20-30. [7] M.C. Giuffrida, G. Spoto, Integration of isothermal amplification methods in microfluidic devices: Recent advances, Biosens. Bioelectron. 90 (2017) 174-186. [8] I.P. Oscorbin, E.A. Belousova, A.I. Zakabunin, U.A. Boyarskikh, M.L. Filipenko, Comparison of fluorescent intercalating dyes for quantitative loop-mediated isothermal amplification (qLAMP), Biotechniques. 61 (2016) 20-25. [9] Tang D., Xia B., Tang Y., Zhang J., Zhou Q. Metal-ion-induced DNAzyme on magnetic beads for detection of lead (II) by using rolling circle amplification, glucose oxidase, and readout of pH changes, Mikrochim. Acta. 186 (2019) 318. [10] J. Zhong, X. Zhao, Isothermal amplification technologies for the detection of foodborne pathogens, Food Anal. Methods. 11 (2018) 1543-1560. [11] A. Fire, S.Q. Xu, Rolling replication of short DNA circles, Proc. Natl. Acad. Sci. USA. 92 (1995) 4641-4645. [12] M.G. Mohsen, E.T. Kool, The discovery of rolling circle amplification and rolling circle transcription, Acc. Chem. Res. 49 (2016) 2540-2550. [13] T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Loop-mediated isothermal amplification of DNA, Nucleic Acids Res. 28 (2000) E63. [14] J. Compton, Nucleic acid sequence-based amplification, Nature. 350 (1991) 91-92. [15] M.M. Ali, F. Li, Zh. Zhang, K. Zhang, D.K. Kang, J.A. Ankrum, X.C. Le, W. Zhao, Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine, Chem. Soc. Rev. 43 (2014) 3324-3341. [16] D.Y. Zhang, M. Brandwein, T.C. Hsuih, H. Li, Amplification of target-specific, ligationdependent circular probe, Gene. 211 (1998) 277-285. [17] L. Gu, W. Yan, L. Liu, S. Wang, X. Zhang, M. Lyu, Research progress on rolling circle amplification (RCA)-based biomedical sensing, Pharmaceuticals. 11 (2018) 35. 17

[18] K. Treerattrakoon, T. Jiemsakul, C. Tansarawiput, P. Pinpradup, T. Iempridee, P. Luksirikul, K. Khoothiam, T. Dharakul, D. Japrung, Rolling circle amplification and graphene-based sensor-on-a-chip for sensitive detection of serum circulating miRNAs, Anal. Biochem. 577 (2019) 89-97. [19] C. Zhang, G. Chen, Y. Wang, J. Zhou, C. Li, Establishment and application of hyperbranched rolling circle amplification coupled with lateral flow dipstick for the sensitive detection of Karenia mikimotoi, Harm. Algae. 84 (2019) 151-160. [20] J. Chen, Y.R. Baker, A. Brown, A.H. El-Sagheer, T. Brown, Enzyme-free synthesis of cyclic single-stranded DNA constructs containing a single triazole, amide or phosphoramidate backbone linkage and their use as templates for rolling circle amplification and nanoflower formation, Chem. Sci. 9 (2018) 8110-8120. [21] G.J. Hafner, I.C. Yang, L.C. Wolter, M.R. Stafford, P.M. Giffard, Isothermal amplification and multimerization of DNA by Bst DNA polymerase, BioTechniques. 30 (2001) 852-867. [22] G. Wang, X. Ding, J. Hu, W. Wu, J. Sun, Y. Mu, Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities, Sci. Rep. 7 (2017) e13928. [23] M.S. Kupryushkin, D.V. Pyshnyi, D.A. Stetsenko, Phosphoryl Guanidines: A New Type of Nucleic Acid Analogues, Acta Naturae. 6 (2014) 116-118. [24] D.A. Stetsenko, M.S. Kupryushkin, D.V. Pyshnyi, Мodified oligonucleotides and methods for their synthesis, WO2016028187A1. Priority from 22.08.2014. [25] R.R. Garafutdinov, A.R. Sakhabutdinova, M.S. Kupryushkin, D.V. Pyshnyi, Data on multimerization efficiency for short linear DNA templates and phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase, Data-in-Brief, (submitted) for publication. [26] J. Sambrook, D.W. Russell, Isolation of DNA fragments from polyacrylamide gels by the crush and soak method, CSH Protocols. 2006. doi: 10.1101/pdb.prot2936. [27] E. Quijano, R. Bahal, A. Ricciardi, W.M. Saltzman, P.M. Glazer, Therapeutic Peptide Nucleic Acids: Principles, Limitations, and Opportunities, Yale J. Biol. Med. 90 (2017) 583-598. [28] E. Subbotina, S.R. Koganti, D.M. Hodgson-Zingman, L.V. Zingman, Morpholino-driven gene editing: A new horizon for disease treatment and prevention, Clin. Pharm. Ther. 99 (2016) 2125. [29] H. Higuchi, T. Endo, A. Kaji, Enzymic synthesis of oligonucleotides containing methylphosphonate internucleotide linkages, Biochemistry. 29 (1990) 8747-8753.

18

[30] D. Froim, C.E. Hopkins, A. Belenky, A.S. Cohen, Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection, Nucleic Acids Res. 25 (1997) 4219-4223. [31] R.N. Veedu, B. Vester, J. Wengel, Efficient enzymatic synthesis of LNA-modified DNA duplexes using KOD DNA polymerase, Org. Biomol. Chem. 7 (2009) 1404-1409. [32] J. Summerton, D. Stein, S.B. Huang, P. Matthews, D. Weller, M. Partridge, Morpholino and phosphorothioate antisense oligomers compared in cell-free and in-cell systems, Antisense Nucleic Acid Drug Dev. 7 (1997) 63-70. [33] N.A. Kuznetsov , M.S. Kupryushkin, T.V. Abramova, A.A. Kuznetsova, A.D. Miroshnikova, D.A. Stetsenko, D.V. Pyshnyi, O.S. Fedorova, New oligonucleotide derivatives as unreactive substrate analogues and potential inhibitors of human apurinic/apyrimidinic endonuclease APE1, Mol. Biosyst. 12 (2016) 67-75. [34] M.S. Kupryushkin, I.A. Pyshnaya, E.V. Dmitrienko, D.A. Stetsenko, M.L. Filipenko, I.P. Oscorbin, G.A. Stepanov, V.A. Richter, M.K. Ivanov, D.V. Pyshnyi, Template-directed enzymatic DNA synthesis using phosphoryl guanidine oligonucleotides, WO 2019/112485 A1. Priority from 13.06.2019 / M.S. Kupryushkin, I.A. Pyshnaya, E.V. Dmitrienko, D.A. Stetsenko, M.L. Filipenko, I.P. Oscorbin, G.A. Stepanov, V.A. Richter, M.K. Ivanov, D.V. Pyshnyi, The method of amplification of nucleic acids using phosphorylguanidine oligonucleotides, RU2698134C2, Priority from 04.12.2017. [35] R.R. Garafutdinov, A.R. Gilvanov, A.R. Sakhabutdinova, The influence of reaction conditions on DNA multimerization during isothermal amplification with Bst DNA polymerase, Appl. Biochem. Biotechnol. 2019. doi: 10.1007/s12010-019-03127-6 [Epub ahead of print]. [36] J. Qian, T.M. Ferguson, D.N. Shinde, A.J. Ramírez-Borrero, A. Hintze, C. Adami, A. Niemz, Sequence dependence of isothermal DNA amplification via EXPAR, Nucleic Acids Res. 40 (2012) e87.

19

Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase

Highlights: 1. Bst exo- polymerase causes DNA multimerization under certain reaction conditions. 2. Multimerization occurs only for short linear ssDNA or primer dimers. 3. Multimerization does not depend significantly on the sequence of DNA templates. 4. DNA multimerization can be prevent using phosphoryl guanidine primers. 5. Multimerization is blocked by 3 serial modifications in the middle of the primers.

Conflict of interest

The authors declare that there are no conflicts of interest.