Proanthocyanidins and probiotics combination supplementation ameliorated intestinal injury in Enterotoxigenic Escherichia coli infected diarrhea mice

Journal of Functional Foods 62 (2019) 103521

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Proanthocyanidins and probiotics combination supplementation ameliorated intestinal injury in Enterotoxigenic Escherichia coli infected diarrhea mice Cuie Tanga, Bijun Xiea, Qi Zongb, Zhida Suna,c,

T

⁎

a

College of Food Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China c Key Laboratory of Environment Correlative Dietology, Huazhong Agricultural University, Ministry of Education, Wuhan, Hubei 430070, PR China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Oligomeric procyanidins Tight junctions Intestinal barrier Inflammatory Enterotoxigenic Escherichia coli Diarrhea

The protective effects of the oligomeric proanthocyanidins from lotus seedpod (LSPC) and probiotics (Lactobacillus rhamnosus LGG and Bifidobacterium Bb-12) were evaluated in Enterotoxigenic Escherichia coli (ETEC) infected diarrhea mice. In normal mice, LSPC, LGG and Bb-12 showed no intestinal injury effect. In the prophylactic groups fed with LSPC and probiotics for 10 days, diarrhea signs were significantly reduced. The marker of intestine barrier, inflammatory response and oxidant stress were significantly improved. In addition, LSPC and probiotics regulated the expressions of tight junction proteins and inflammatory mediators via MAPKs pathway. Furthermore, the combination of LSPC and probiotics (LGG and Bb-12) could significantly improve the effect of treating diarrhea alone. These findings suggested that LSPC could act as prebiotics combining with probiotics to improve the composition of intestinal microbes and further reduce ETEC-induced diarrhea consequences. It might provide a novel potential natural therapeutic agent to resist ETEC infected diarrhea disease.

1. Introduction As one of the most common recognized diarrheagenic Escherichia coli (E. coli) strains, Enterotoxigenic Escherichia coli (ETEC) could annually bring nearly 600,000 deaths mainly among children under age of 5 in most underdeveloped countries (Dubreuil, 2013; Walker, 2015), and it is also the leading cause of neonatal and post-weaning piglets diarrhea that become an enormous economic burden to the swine industry (Fairbrother, Nadeau, & Gyles, 2005). Currently, antibiotics are mainly used to cure ETEC diarrhea, but growing interest for natural alternatives has been paid attention to as a result of antibiotic resistant effect and the restriction on the uncontrolled use of antibiotics (Zhang, Wu, Zhang, Lai, & Zhu, 2016). ETEC produced endotoxins which could up-regulate the cAMP and cGMP leading to secretory diarrhea, and they can also disrupt intestinal barrier functions (Fleckenstein et al., 2010).

The intestinal barrier functions general regulated by epithelial cell mucous layer-tight junctions (TJs) structures, which are assembled by different transmembrane proteins such as claudins, occludins and zonulin/zonula occludens (ZO) (Gil-Cardoso et al., 2017). Recent evidences show that these tight junction proteins are regulated by MAPK signaling pathway, while ETEC infection could also induce pro-inflammatory response in IPEC cells through MAPK pathway (Sargeant, Miller, & Shaw, 2011; Zanello et al., 2011). Moreover, ETEC strains can produce the complete O-antigen-containing lipopolysaccharide (LPS), which can activate the myeloid differentiation pro-inflammatory response protein 88 (MyD88) pathways (Campos-Salinas et al., 2014). These activations will release the reactive oxidant species (ROS), inflammatory mediators, and ultimately lead to cell death (Shimazu et al., 1999). Therefore, the prevention of the production of ROS, inflammatory mediators and elevation the formation of TJs structures can

Abbreviations: ETEC, Enterotoxigenic Escherichia coli; E. coli, Escherichia coli; LSPC, oligomeric procyanidins of lotus seedpod; LGG, Lactobacillus rhamnosus; Bb-12, Bifidobacterium Bb-12; cAMP, cyclic adenosine monophosphate; cGMP, cyclic guanosine monophosphate; TJ, tight junction; LPS, lipopolysaccharide; CD14, cluster of differential 14; TRL4, toll-like receptor 4; MyD88, myeloid differentiation primary response gene 88; IPEC, intestinal porcine epithelial cell; MAPK, mitogen-activated protein kinase; LB, Luria-Bertani; CFU, colony forming units; MRS, de Man Rogosa and Sharpe; ICR, Institute of Cancer Research; PVDF, polyvinylidene difluoride; ECL, enhanced chemiluminescent; TEM, transmission electron microscopy; T-SOD, total superoxide dismutase; GSH, glutathione; MDA, malondialdehyde; DAO, diamine oxidase; RT-qPCR, real-time quantitative PCR; ZO-1, zona occuldens protein1; p38, protein 38; JNK, c-Jun N-terminal kinase; ERK, extracellular signalregulated protein kinases; EcN, Escherichia coli Nissle; MIC, minimal inhibitory concentration ⁎ Corresponding author at: College of Food Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China. E-mail address: [email protected] (Z. Sun). https://doi.org/10.1016/j.jff.2019.103521 Received 14 February 2019; Received in revised form 1 August 2019; Accepted 16 August 2019 1756-4646/ © 2019 Published by Elsevier Ltd.

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

2. Materials and methods

effectively counteract the ETEC-induced injury in animals. Epidemiological and experimental studies provide convincing evidence that natural dietary polyphenols that human beings consume as food possess many biological activities. Among these natural polyphenols, proanthocyanidins are dimers, oligomers, and polymers of catechin, epicatechin and their esters that are bound together by links between C4 and C8 (or C6) (Li, Sui, Li, Xie, & Sun, 2016). Proanthocyanidins are abundant in daily foods and plants (Choy & Waterhouse, 2014), and they are the major polyphenols in lotus. Our previous works have indicated that the oligomeric proanthocyanidins from lotus seedpod (LSPC) consisted of (+)-catechin, (−)-epicatechin, epicatechin gallate, B type procyanidins dimer, trimer and tetramer (Ling, Xie, & Yang, 2005). LSPC, like other sources of proanthocyanidins, is widely recognized for their biological and pharmacological effects, including antioxidant, antimicrobial, anti-inflammatory and improved gut environment. (Ling et al., 2005; Tang, Xie, & Sun, 2017; Wu et al., 2015; Wu et al., 2015). In particular, certain research data show that proanthocyanidins can reduce LPS-induced inflammation, strengthen intestinal barrier integrity and regulate tight junction proteins mainly via modulation of ERK and TLR-MAPKS signaling pathway (Rahimifard et al., 2017). However, these biological activities of dietary polyphenols are highly sources and dose dependent (Kaulmann & Bohn, 2016; Yasir, Sultana, & Amicucci, 2016). Therefore, the selection of active polyphenol for curing ETEC diarrheal have been widely discussed (Bruins, Vente-Spreeuwenberg, Smits, & Frenken, 2011). Previously, we have demonstrated that LSPC exert high anti-bacterial activity on ETEC strains (Tang et al., 2017), which indicate that LSPC may exert high protection on ETEC-induced diarrhea. However, their specific action and mechanism of LSPC on anti-diarrhea remains unknown. Probiotics are viable microorganisms that can provide numerous health benefits to the host via a variety of mechanisms, including inhibition of pathogen adhesion, alteration of gut microbiota, regulation of host immune responses and modulation of intestinal integrity (Hou, Zeng, Yang, Liu, & Qiao, 2015; Ohland & Macnaughton, 2010; Yu, Yuan, Deng, & Yang, 2015). In the past decades, the use of many Lactobacilli and Bifidobacterium to prevent diarrhea has been extensively studied (Ohland & Macnaughton, 2010; Yu et al., 2015). Ohland et al demonstrated that LGG could prevent pathogen E. coli binding to Hep-2 cells (Ohland & Macnaughton, 2010). Leahy et al proved that Bifidobacterium Bb-12 could prevent diarrhea and help the other prebiotic in improving the antioxidant status and gut homeostatsis (Leahy, Higgins, Fitzgerald, & van Sinderen, 2005). Furthermore, probiotic also have been widely used to prevent the diarrhea induced by ETEC in swine (Dubreuil, 2017). Interestingly, recent studies suggest that the proper ingredients or food carriers for probiotics can enhance their functional properties (Valero-Cases, Roy, Frutos, & Anderson, 2017). The combination of polyphenol and Lactobacillus complex represented better antidiarrhea effect in rotavirus diarrhea (Yang et al., 2015). However, as far as we know, the effect of suitable polyphenols carriers on the antidiarrhea activity of probiotics in ETEC related intestine disease haven’t been widely studied. The above-mentioned findings suggest the high anti-oxidant and anti-inflammatory of proanthocyanidins and improving the role of probiotics in protecting intestinal integrity could be an effective methods of the prevention against ETEC diarrhea. Based on the wellreported TLR4-MAPK mechanism of polyphenol that they strengthen the intestinal barrier function in LPS challenged situation, we hypothesize the same signaling pathway of LSPC and probiotics in the modulation of ETEC diarrhea. In present study, we aimed to evaluate the underlying anti-diarrhea effects and its mechanisms of LSPC, Bb-12 and LGG and the combination of LSPC with probiotics on the diarrhea mice induced by ETEC, with a specific focus on intestinal barrier function, oxidative stress and inflammatory.

2.1. Extraction and analysis of LSPC Fresh lotus seedpod was purchased from a local market in Honghu Lantian in the late July (Hubei, China), and LSPC were extracted following our laboratory previous methods with some modification (Xiao et al., 2012). Briefly, 100 g small pieces of fresh lotus seedpod were extracted twice in 1500 mL 70% (v/v) aqueous methanol at 60 ℃ for 1.5 h. After filtration, the extracts were concentrated by rotary evaporator (RE111, Buchi labortechnik, Switzerland) at 40℃ to remove the methanol. The residue was then purified by column chromatography coated with AB-8 macroporous resin (Chemical Plant of Nankai University). The column was washed with 2.5 L distilled water and eluted with 70% (v/v) aqueous methanol, the eluent was concentrated again by rotatory evaporation method. Then the residue was extracted twice with three times volume of ethyl acetate, the ethyl acetate phase were combined, concentrated and freeze-dried(APHA 2-8L, Chris, Osterode, Germany) to recover LSPC (3.67 g). The purity of LSPC was 98.65 ± 0.53% compared with commercial grape seed procyanidins determined by Butanol-HCl assay (Poter, Hrstich, & Chan, 1986). Based on LC-ESI-MS analysis (Xiao et al., 2012), the major procyanidins components in LSPC were (−)-epicatechin (12.95%), (+)-catechin (33.07%), dimer (30.4%), trimer (12.14%) and tetramer (1.83%) as recalculated by normalization method based on the peak area of each procyanidins (Fig. S1). LSPC was kept in −20 °C until use. 2.2. Bacterial strains The ETEC strain K88ac (C83715) used in this study was obtained from the China Institute of Veterinary Drug Control. Lactobacillus rhamnosus HN001 (ATCC SD5675) was purchased from DuPont™ Danisco® (Shanghai, China), and Bifidobacterium Bb-12® was provided by HANSEN (Bb-12®, Chr. Hansen, Hónsholm, Denmark). The preparation and cultured conditions were the same as described in our previous work (Tang et al., 2017). Briefly, ETEC strain was re-cultured in Luria Broth Both medium with shaking at 170 rpm and 37 °C for 12–13 h. Those two probiotic strains were re-cultured overnight in anaerobically (85% N2, 10% H2, 5% CO2) in MRS broth with 0.05% cysteine supplement at 37 °C. After incubation, bacterial were centrifugated and washed three times with 0.9% NaCl, and the colony forming units (CFU) of the suspensions were measured the optical density at 600 nm on 1800 UV–VIS spectrophotometer (Shimadzu, Japan) and calculated by our established growth curves. 2.3. Animals and experimental design All experimental using animals and protocols were approved by Animal Ethical and Welfare Committee of Huazhong Agriculture University (permission no. SCXK2017-0018) and the involving procedures were performed in accordance with international Guiding Principles in the Care and Use of Animals. The ETEC diarrhea model was established following the method described by Ren et al. (2014) and Wang et al. (2016) with modification, and the experimental scheme of ETEC model was illustrated in Fig. 1. After one-week acclimatization, eighty 3–4 weeks old ICR female mice were randomly divided into eight groups as summarized in table 1. Initially, all the mice in each treatment were fed with specific diet or plus probiotics. Five days later, mice received 36 h antibiotic streptomycin (5 g/L) treatment in the drinking water containing 6.7% fructose. After 12 h fasting, 0.2 mL of 0.3% NaHCO3 was administered to all the mice 30 min prior to challenge with 109 CFU of K88ac or boiled water on the morning of days 0–3. Infection symptoms such as diarrhea, weight loss, the water content of mice feces were observed. After three days post infection, all mice were fasted 12 h and sacrificed. Blood samples were collected shortly by retro-orbital bleeding in heparin-containing tubes and serum collection 2

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Fig. 1. Gross morphology of stool pellets in the second day of diarrhea mice challenged by K88ac (A) and the percentage of water in stool of ICR mice pre and post infection by K88ac (B). Data are expressed as the mean ± SD (n = 7). Different capital letters above column indicate significant differences between groups (p < 0.05). NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture.

2.5. Analysis of serum diamine oxidase (DAO) activity and ion concentration

tubes. Serum samples were collected by centrifuge at 4 °C, 3500 rpm for 30 min and stored at −80 °C until use. The spleen, thymus and other organs were weighed and the organ index was calculated as organ weight/body weight. The liver, jejunum, ileum, colon sections were also collected immediately and deposited at −80 °C until use.

The DAO activity and the concentration of Na+, Cl− in the serum were determined using chemistry kits (Jiancheng, Nanjing, China) according to the instructions through UV–VIS spectrophotometer (UV1800, Shimadzu, Japan).

2.4. Biochemical analyses 2.6. Histopathological analysis The total WBCs and differential leukocyte counts of plasma was measured by automatic animal blood cell analyzer (BC-2800vet, Mindray, China). The stool water content was determined by weighing method. Pre-weighed tubes were used to collect and weigh from eight mice for all groups during the days before and post K88ac infection. After drying in 105 °C for 6 h and the stool was reweighed, the percentages of the water content in the stool were calculated from the differences between wet and dry weights (Guttman et al., 2006). The total superoxide dismutase (T-SOD) activity, glutathione (GSH) and malondialdehyde (MDA) level in jejunum/ileum were determined by the commercial enzymatic methods (Jiancheng, Nanjing, China).

The histopathological analysis was investigated as described by Huang et al. (2016). Resected jejunum sections were cleaned with saline, fixed with 4% formaldehyde buffered with PBS at 4 °C, and then embedded in paraffin. 5 μm-thick section were mounted on slides and stained with hematoxylin and eosin. The images were collected by Olympus microscope (BX63, Olympus, Japan). 2.7. Real-Time Quantitative PCR (RT-qPCR) The abundances of mRNA for TNF-α, IL-1β, IL-6, IL-8, CD14, TLR4, p-38, NK-ƙB, zonnula occludens-1 (ZO-1), occludin and claudin-1 in the jejunum were determined by quantitative RT-PCR as similar to describe

Table 1 Treatments for animal experiment. Groups Group1: Group2: Group3: Group4: Group5: Group6: Group7: Group8: a b c d e f g

Diet (1–10 d) NC DM 0.5% 0.2% 0.5% 0.5% P1 P2

a

B B B + P1 B + P2

Basal diets Basal diets 0.5% LSPC dietsb 0.2% LSPC dietsc 0.5% LSPC diets + Bb-12d 0.5% LSPC diets + Bb-12 & LGG mixturee Basal diets + Bb-12f Basal diets + Bb-12 & LGG mixtureg

Antibiotic treatment (5–7 d)

Injection (8–10 d)

5 g/L antibiotic streptomycin in drinking water

Boiled water 109 cfu ETEC 109 cfu ETEC 109 cfu ETEC 109 cfu ETEC 109 cfu ETEC 109 cfu ETEC 109 cfu ETEC

Basal diets:AINP3G, standard diets for post-weaning mice or rats. 0.5% LSPC diets: standard diets with 0.5% LSPC. 0.2% LSPC diets: standard diets with 0.2% LSPC. 0.5% LSPC diets + Bb-12: 0.5% LSPC diets with 1 × 108 CFU/kg Bb-12 per day. 0.5% LSPC diets + Bb-12&LGG: 0.5% LSPC diets with 1 × 108 CFU/kg Bb-12 and LGG mixture per day. Basal + Bb-12: basal diets with 1 × 108 CFU/kg Bb-12 per day. Basal + Bb-12 & LGG mixture diets: basal diets with 1 × 108 CFU/kg Bb-12 per day. 3

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

2.9. Transmission electron microscopy (Cao, Li, Fang, Chen, & Xiao, 2012)

Table 2 Sequences of primer used for quantitative real-time PCR analysis. Name

GenBank accession no.

Sequence (5′–3′)

Size

Mus b-actin

NM_007393.5

F: CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT

240bp

Mus TNF-a

NM_013693.3

F: CGTCAGCCGATTTGCTATCT R: CGGACTCCGCAAAGTCTAAG

206bp

Mus IL-1beta

NM_008361.4

F: GCCCATCCTCTGTGACTCAT R: TTGTCGTTGCTTGGTTCTCC

216bp

Mus IL-8

NM_011339.2

F: CCCTGTGACACTCAAGAGCT R: CAGTAGCCTTCACCCATGGA

190bp

Mus IL-6

NM_031168.2

F: GTTGCCTTCTTGGGACTGATG R: GTATAGACAGGTCTGTTGGGAG

107bp

2 mm mice jejunum were fixed in 0.1 M sodium phosphate buffer containing 2% glutaraldehyde (pH7.0) overnight at 4 °C and washed three times with 0.1 M sodium phosphate buffer. After post-fixed for 1.5 h in 0.1 M sodium phosphate buffer containing 2% glutaraldehyde (pH7.0), the sections were washed, and dehydrated in an ascending acetone series (30%, 50%, 70%, 80%, 90%, 100%). Followed by infiltration, the materials were embedded in expoxy resin SPI-812 and then polymerized at 60 °C for 24 h. Ultrathin sections (60–70 nm in thickness) were cut, mounted, stained for 30 min with 5% uranyl acetate and 5% lead citrate respectively, and then observed with H7650 transmission electron microscope (Hitachi Instruments Inc., Tokyo, Japan) at 80 kV.

Mus CD14

NM_009841.4

F: TCAAGTTCCCGACCCTCCAA R: GCTTCAGCCCAGTGAAAGACA

207bp

2.10. Statistical analysis

Mus TLR4

NM_021297.3

F: GCCCTACCAAGTCTCAGCTA R: CTGCAGCTCTTCTAGACCCA

165bp

Mus p38

NM_011951.3

F: GCATCGTGTGGCAGTTAAGA R: AGCTTCTGGCACTTCACGAT

225bp

All data was indicated as mean ± standard errors and analyzed by one-way ANOVA with Tukey's test using SPSS 20.0 software. P value of < 0.05 indicated statistical significance.

Mus NF-ƙB

NM_008689.2

F: CGGGAGGGGAGGAGATTTAC R: TGAACAAACACGGAAGCTGG

208bp

3. Results

Mus occludin

NM_008756.2

F: TAAGAGCTTACAGGCAGAACTAG R: CTGTCATAATCTCCCACCATC

225bp

3.1. Effect of LSPC and probiotics on the growth performance and symptoms

Mus ZO-1

NM_009386.2

F: GAGATGAGCGGGCTACCTTA R:CATGCGAGCGACCTGAATGG

129bp

Mus claudin-1

NM_016674.4

F: TGAGGTGCAGAAGATGTGGAT R:AGGAGCAGGAAAGTAGGACAC

224bp

In the present study, the feed intake, weight gain and the stool water content were evaluated during the first 5 days before K88ac infection. As showed in Table 3 and Fig. 1B, there was no significant difference between the treated and untreated groups (p > 0.05). These results indicated that both LSPC and probiotics treatment did not affect the water content in mice feces, feed intake and weight gain. After infection with K88ac suspensions, the diarrhea symptoms appeared at 2 h in DM group. Watery feces (Fig. 1A) and loss of appetite of mice were observed in DM group compared to the other groups. The stool water content of mice (83.62% ± 5.23) in DM group was much higher (p < 0.05) than that of NC group (48.00% ± 3.20), in which the former was about 1.74 times as large as the latter. These results suggested that the diarrhea mice model infected by K88ac was successfully established. Compared with NC group, there was no significant difference in the stool water contents of mice in 0.5% B (50.88% ± 4.86), 0.2% B (56.24% ± 7.31) and 0.5% B + P1 (50.41% ± 5.81) groups, while the water content of mice feces in 0.5% B + P2 (57.75% ± 3.09), P1 (59.42% ± 3.29) and P2 (62.18% ± 5.25) groups showed slightly higher values. After dissection, the organ index was measured and displayed in Table 3. In the DM group, the organ index of thymus markedly elevated (p < 0.05) as compared to that of NC group, and there was no significant difference between the other treated groups. Normally, the occurrence of diarrhea was associated with sharp increase of leukocytosis in the blood of diarrhea mice compared to that in normal control (p < 0.05) (Table 3). The total and neutrophil leukocytes count in the treated group was significantly less than that in DM group. LSPC with higher concentration had greatest influence on total white blood cells numbers among all the treated groups, and its effect on the percentage of neutrophil leukocytes was significantly enhanced (p < 0.05) in 0.5% B + P1 and 0.5% B + P2 groups. Combined treatment with probiotics (Bb-12 and LGG) and LSPC could significantly reduce the total white blood cells numbers and the percentage of neutrophil leukocytes of mice. While non-significant difference was observed in the percentage of lymphocytes in blood of each group.

previously in our laboratory (Li et al., 2016). Briefly, total RNA from frozen jejunum were extracted using Trizol (Invitrogen, USA). The SYBR Green PCR Master Mix (Toyobo) was subjected to quantitative RT-PCR run using the primers, and the primers sequences were listed in Table 2. The thermal cycling conditions were used as follows: denaturation at 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s and then 60 °C for 30 s, and the quantitative RT-PCR was performed on ABI QuantStudio 6 Flex Sequence Detection System (Applied Biosystems, Foster City, CA, U.S.A.). Results were calculated using 2−ΔΔCT method as ΔCTsample = CTtarget ΔΔCTsample = ΔCTtreated gene − CTβ-actin, group − ΔCTNC group. The relative mRNA expression of the target genes are normalized to that of normal control (Livak & Schmittgen, 2001).

2.8. Western blot analysis The expression of tight junction proteins and signaling proteins in the jejunum were determined by Western blot as previously described. The protein concentrations were measured by BCA assay. The diluted protein extracts were denatured in boiling water for 10 min, loaded into 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto a 0.45 μm-pore PVDF (polyvinylidene difluoride) membrane (Merck Millipore, Darmstadt, Hesse-Darmstadt, Germany). The membranes were blocked with 5% skimmed milk at room temperature (RT) for 2 h, followed by incubating with primary antibodies against ZO-1 (1:500), claudin-1 (1:3000), occludin (1:1500), p-JNK1/2 (1:2000), p-JNK1/2 (1:1000), p-p38 (1:1000), and β-actin (1:200) overnight at 4 °C, and then washed six times with TBST. After incubation with secondary antibody horseradish peroxidase-conjugated (1:50,000) for 2 h at 37 °C in a shaker. The enhanced chemiluminescent reagents (ECL) were added for chemiluminescence imaging. The films were scanned and the intensity of bands were recorded using BandScan 5.0 software, the relative levels of each proteins are expressed as the intensity of target band over the intensity of β-actin band in the same sample.

3.2. The counteraction of LSPC and probiotics on ETEC-induced oxidative stress in jejunum/ileum As shown in Fig. 2, infection of ETEC in DM group significantly decreased the status of T-SOD and GSH (p < 0.05), while at the same 4

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Table 3 Effect of LSPC and probiotics supplementation on the growth performance, Organ/Body Weight Index and leukocyte counts in the diarrhea mice challenged by K88ac1. NC

DM

0.5% B

0.2% B

0.5% B + P1

0.5% B + P2

P1

P2

13.65 ± 1.46 20.32 ± 1.13

13.15 ± 1.73 19.68 ± 0.74

12.9 ± 0.85 20.26 ± 0.97

12.95 ± 1.25 19.31 ± 0.98

13.15 ± 1.45 19.81 ± 1.18

13.17 ± 0.85 20.22 ± 1.24

13.31 ± 1.03 19.79 ± 1.77

13.03 ± 1.30 20.27 ± 1.21

Before K88ac challenge (day 0–5) Feed intake (g/d) 2.20 ± 0.21 Weight gain (g/d) 1.33 ± 0.12

2.10 ± 0.30 1.33 ± 0.23

2.71 ± 0.27 1.26 ± 0.26

2.56 ± 0.03 1.18 ± 0.11

2.64 ± 0.30 1.08 ± 0.11

2.61 ± 0.46 1.26 ± 0.20

2.78 ± 0.32 1.29 ± 0.22

2.88 ± 0.09 1.32 ± 0.24

After K88ac challenge (day 7–10) Feed intake (g/d) 2.3 ± 0.28 Weight gain (g/d) 1.18 ± 0.04a Spleen index (mg/g) 2.61 ± 0.27 Liver index (mg/g) 38.98 ± 1.49 Thymus index (mg/g) 3.43 ± 0.52b 9 Total WBC ×10 /L 1.88 ± 0.11f Neutrophils (segment) (%) 9.67 ± 0.50d Lymphocytes (%) 86.3 ± 1.47

1.79 ± 0.24 0.44 ± 0.21c 3.50 ± 0.54 45.36 ± 4.03 4.26 ± 0.73a 5.43 ± 0.51a 23.23 ± 2.3a 84.35 ± 5.46

2.19 ± 0.14 0.85 ± 0.17b 2.89 ± 0.38 41.6 ± 3.22 3.40 ± 0.38b 2.23 ± 0.21ef 17.63 ± 1.17b 80.23 ± 1.33

1.96 ± 0.19 0.83 ± 0.19b 3.26 ± 0.45 44.25 ± 4.03 3.18 ± 0.57b 4.28 ± 0.29bc 12.5 ± 0.87 cd 85.43 ± 0.93

2.04 ± 0.26 0.85 ± 0.21b 2.72 ± 0.42 41.05 ± 3.91 3.42 ± 0.31b 2.88 ± 0.27de 10.9 ± 1.09 cd 87.47 ± 2.39

2.02 ± 0.08 0.83 ± 0.21b 3.26 ± 0.53 40.33 ± 4.07 3.16 ± 0.75b 3.47 ± 0.31 cd 12.23 ± 0.51 cd 85.46 ± 3.15

2.06 ± 0.14 0.77 ± 0.29b 3.33 ± 0.39 40.52 ± 4.10 3.15 ± 0.54b 2.97 ± 0.15de 13.7 ± 1.21c 83.37 ± 0.98

2.03 ± 0.14 0.79 ± 0.21b 2.80 ± 0.29 40.77 ± 4.08 3.19 ± 0.64b 4.87 ± 0.32ac 17.97 ± 1.05b 86.47 ± 5.56

Initial BW (g) Final BW (g)

1 Data are expressed as the mean ± SD (n = 8). The mean values in the same row with unlike letters indicate significant differences (p < 0.05). NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture.

significant difference in villous height and crypt depth comparing to that in NC group (p < 0.05), which indicated that LSPC remarkably alleviated the intestinal injury caused by ETEC. Among the other treated diarrhea mice, those fed with LSPC and probiotics together had lower injury than mice fed with probiotics and LSPC alone, whereas there was no significant difference in the jejunal morphology between the mice fed with single probiotic and mixed probiotics. Moreover, the groups treated with probiotics alone showed no significant difference in villous height and crypt depth in the comparison with DM group (p > 0.05). 3.4. Effects of LSPC and probiotics on diamine oxidase (DAO) activity, Na+ and Cl− concentration in the serum The DAO activity of plasma/serum has been commonly used for monitoring the intestinal injury. The released of DAO from the small intestine into blood reflects the destruction of intestinal epithelial functions (Wolvekamp & Debruin, 1994). As shown in Table 4, the serum DAO activity of DM group was significantly increased as compared with that of NC group (p < 0.05). The dietary supplement of LSPC and probiotics profoundly decreased the serum DAO level. Moreover, no significant difference of the serum DAO activity was observed among of all LSPC and probiotics treated groups. The concentration of Na+ and Cl− ions in the serum of mice were also presented in Table 4. It showed that the serum Na+ and Cl− concentrations of mice in DM group remarkably reduced (p < 0.05). However, among the supplement treated groups, both LSPC and probiotics administration increased the concentrations of Na+ and Cl− in serum. In addition, there were interactive effects of LSPC and probiotics on the serum ion concentrations, the maximum values for the Na+ and Cl− concentrations of serum were observed at both 0.5% B + P1 and 0.5% B + P2 groups.

Fig. 2. Effect of LSPC and probiotics supplementation on the total superoxide dismutase (T-SOD) activity, glutathione (GSH) and malondialdehyde (MDA) level in the mice jejunum/ileum. Data are expressed as the mean ± SD (n = 3). Different capital letters above column indicate significant differences between groups (p < 0.05). NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture.

time increased the content of MDA in jejunum/ileum. The deleterious effect of ETEC on these oxidative stress biomarkers were alleviated by the administration of LSPC and probiotics. Moreover, the combination use of LSPC and Bb-12 showed both the lowest content of MDA and highest levels of T-SOD, GSH among all the treatments.

3.3. Effects of LSPC and probiotics on jejunal morphology

3.5. Effects of LSPC and probiotics on the intestinal tight junction proteins mRNA expression and the ultrastructure of tight junctions

The jejunum morphology were shown in Fig. 3 and Table S1. In the NC group, the mice showed normal histopathological morphology. In contrast, K88ac-challenged mice showed pronounced histological injury and significant inflammation changes. The intestinal villi of DM group was disintegrated, the crypt depth increased, and the intestinal villous was severely widened as compared that of NC group (p < 0.05), forming epithelial edema and erosion. Dietary supplementation with LSPC, especially in higher concentration, showed no

The gut barrier is mainly composed by tight junctions, which are integrated by multiple protein complexes that link the neighboring epithelial cells beside their apical border. Tight junctions (TJs) are the most important shield of the intestine for preventing the paracellular permeation of macromolecules into the circulation (Ling, Wan, ElNezami, & Wang, 2016). To evaluate whether the state of intestinal injury and inflammation changes were related to the alteration in the 5

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Fig. 3. Representative morphology of mice intestinal tissues. NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture. Original magnification 20×. Scale bar = 200 μm.

permeability of the intestinal barrier, we first analyzed the mRNA expressions of three tight junction proteins, including ZO-1, claudin-1 and occludin. As shown in Fig. 4, the expressions of ZO-1 (20%), claudin-1 (26%) and occludin (19%) genes were markedly decreased in DM group when compared to that of in NC group (p < 0.05). The mice treated with LSPC and probiotics led to increase the expression of ZO-1, claudin-1 and occludin, and probiotics treatments showed stronger regulatory effect than LSPC. In addition, the 0.5%B + P2 group possessed the maximum mRNA levels of ZO-1 (85%), claudin-1 (79%) and occludin (77%) when compared to that of NC group. To clearly investigate the effect of LSPC and probiotics supplements on the intestinal permeability barrier function, we used transmission electron microscopy (TEM) to observe the alterations of the tight junction ultrastructure. As the highlighted parts displayed in Fig. 5, the tight junction in jejunum of NC group appeared as typical normal membrane fusions, in which intercellular space between neighboring enterocyte was obliterated (Fig. 5A). In contrast, the tight junctions in DM group appeared bigger than those in NC group, and were discontinuous with few apparent membrane fusions (Fig. 5B). The tight junctions of diarrhea mice in LSPC and LSPC + Probiotics groups presented normal brush border, and only showed slight membrane disruption as compared to that of the DM group (Fig. 5C–H). While in 0.5%B + P2 group, the tight junctions showed more membrane fusions than that in LSPC and probiotics alone groups. These results suggested that the combination use of LSPC and probiotics could play synergistic protection effect to adjust intestinal permeability barriers functions in diarrhea infected by ETEC.

Fig. 4. The tight junction protein mRNA relative expressions of zonnula occludens-1 (ZO-1), claudin-1 and occludin in the mice jejunum. Data are expressed as the mean ± SD (n = 3). Different capital letters above column indicate significant differences between groups (p < 0.05). The relative mRNA expression of the target genes are normalized to that of normal control. NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture.

3.6. The elevating on the tight junction protein expression of LSPC and probiotics through MAPK signaling pathway To elucidate the roles of particular signaling pathways in LSPC and probiotic-mediated regulation of intestinal permeability, we

Table 4 Effect of LSPC and probiotics supplementation on the DAO activity, Na+ and Cl− concentration of serum in the diarrhea mice challenged by K88ac2.

DAO/U·L-1 Na+ mmol/L Cl− mmol/L

NC

DM

0.5%B

0.2%B

0.5%B + P1

0.5%B + P2

P1

P2

5.93 ± 0.35c 138.7 ± 4.11a 34.28 ± 1.49ab

14.07 ± 0.53a 116.17 ± 3.54c 26.22 ± 1.82c

10.45 ± 1.04b 124.01 ± 4.66bc 32.39 ± 1.18b

10.65 ± 1.57b 126.56 ± 2.37bc 33.97 ± 0.71ab

11.63 ± 0.40ab 128.12 ± 1.55ab 36.67 ± 3.38a

10.31 ± 0.5b 134.59 ± 4.43ab 34.35 ± 1.89ab

11.34 ± 1.48ab 124.99 ± 5.46bc 34.47 ± 1.43ab

12.68 ± 0.20ab 126.75 ± 4.71bc 33.15 ± 2.03ab

2 Data are expressed as the mean ± SD (n = 3). The mean values in the same row with unlike letters indicate significant differences (p < 0.05). NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture.

6

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Fig. 5. Transmission electron microscopy of tight junctions from jejunum segments in normal control (A); diarrhea model (B); diarrhea mice fed with 0.5% LSPC (C), 0.2% LSPC (D), 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 per day (E), 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture per day (F), 1 × 108 CFU/kg Bb-12 alone per Day (G), and 1 × 108 CFU/kg Bb-12 plus LGG mixture per day (H). Scale bar = 500 nm.

possessed higher anti-inflammatory function than that of P1 and P2 group. Moreover, the infection of ETEC also remarkably elevated the mRNA levels of CD14, TLR4, p38 and NF-κB (Fig. 7B) as compared to that of NC group (p < 0.05). However, the increase in mRNA levels of these mediators were significantly inhibited by treatment of 0.5% B, 0.2% B, 0.5% B + P1, 0.5% B + P2, P1, and P2. It was noteworthy that the mRNA levels of CD14, TLR4 and NF-κB were remarkably lowered in 0.5% B + P1, 0.5% B + P2, P1, and P2 groups than that in 0.5%B (p < 0.05). Furthermore, no significant difference in p38 levers was observed among all the treatments.

determined the effects of LSPC and probiotic on the expression of occludin, claudin-1, ZO-1 protein, and the phosphorylation of p38, JNK1/ 2, as well as ERK1/2. As shown in Fig. 6, the expressions of occludin, claudin-1, and ZO-1 in the DM group were significantly reduced compared with that in the NC group (p < 0.05), and that the phosphorylation levels of p38, JNK1/2 and ERK1/2 were significantly up-regulated in DM group (p < 0.05) (Fig. 6A–E). All the treated groups showed higher status of occludin, claudin-1, ZO-1 expressions, meanwhile lower expression levels of p-p38, p-JNK1/2 and p-ERK1/2 were observed. In addition, P1, and P2 groups showed higher protection effect than that of 0.5% B and 0.2% B groups, and the co-treatment with 0.5% B + P2 obtained the maximum expression of occludin, claudin-1, ZO-1, and that the p-p38, p-JNK1/2 and p-ERK1/2 expressions were reduced to a minimum level.

4. Discussion Given the antibiotics resistant effect of the antibiotic therapy for Enterotoxigenic Escherichia coli (ETEC) diarrhea, accumulation studies have suggested that the specific polyphenols and probiotics could be effective strategies for curing these kind of diarrhea disease (Ohland & Macnaughton, 2010; Tang et al., 2017; Verhelst, Schroyen, Buys, & Niewold, 2014; Yu et al., 2015). The lipopolysaccharide (LPS) produced by ETEC can attach to cluster of differential 14 (CD14) protein, activate TLR4 signaling and subsequently induce intestinal inflammatory response (Shimazu et al., 1999), while increasing number of studies have demonstrated that polyphenol phytochemicals and probiotics could suppress the LPS/ETEC-induced inflammatory response via TLR4MAPKs pathways (Rahimifard et al., 2017; Wu et al., 2016). In the present study, our results first demonstrated that LSPC provided high protection against ETEC diarrhea both in probiotics colonized and nonprobiotics colonized ICR mice by alleviating the clinical symptoms, reducing intestine injury, enhancing intestine integrity, decreasing the inflammatory response and oxidative stress. Furthermore, the regulation of TJ proteins assembly by LSPC and/or probiotics involved the activation of MAPK signaling. In our previous study, we found that LSPC showed high anti-bacterial activity against ETEC strains (Tang et al., 2017), so the maximum concentration of 0.5% LSPC employed in the current study was based on these previous results in accordance with the feed intake, feed frequency and stomach capacity of ICR mice (Goebel, Stengel, Wang, & Tache, 2011). On the basis of clinic symptoms results, the ETEC infected diarrhea mice model was successfully established. The stool water content, the total white blood cells numbers and the percentage

3.7. The protections against ETEC-induced barrier dysfunctions of LSPC and probiotics via MAPK mechanism possibly mediated through proinflammatory factors The lipopolysaccharide (LPS) produced by ETEC can induce inflammatory response, and the phosphorylation of MAPKs can further promote the inflammation (Sanchez-Fidalgo et al., 2013). In order to elucidate the effects of MAPKs in regulating the expression of pro-inflammatory cytokines, RT-qPCR was applied to determine the gene expressions of four pro-inflammatory cytokines (TNF-α, IL-8, 1L-1ß and IL-6) and their four main mediators (CD14, TLR4, p38 and NF-ƙB) (Fig. 7). As shown in Fig. 7A, we observed that the mRNA levels of TNFα, IL-8, 1L-1ß and IL-6 in DM group were respective 4.3, 4.4, 3.7 and 3.0-fold than that in the NC group. In 0.2% B, 0.5% B groups, the mRNA levels of these four key inflammatory cytokines were about 2.2 to 2.7fold than that in NC group, while the mRNA levels of IL-8, 1L-1ß and IL6 in P1 and P2 groups were down to 1.1–1.5 times. No significant difference of these four cytokines were found between 0.5% B + P1, 0.5% B + P2 and P1, P2 groups, but significantly lower than the DM group. These results indicated that the infection of ETEC dramatically increased TNF-α, IL-8, 1L-1ß and IL-6 mRNA levels, the treatment of LSPC and probiotics alone or combination utilization could abrogate these up-regulations induced by ETEC. Moreover, the mice in P1 and P2 groups, which had no significant difference in the cytokine mRNA levels, showed lager anti-inflammatory effect compared to mice treated with LSPC alone, and the combination use of LSPC and probiotics 7

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Fig. 6. The expression of tight junction proteins and their key regulators in MAPK pathway in mice jejunum: (A) Occludin and Claudin-1 levels; (B) ZO-1 levels; (C) p-p38 levels; (D) p-JNK1/2 levels; (E) p-ERK1/2 levels; (F) proposed effect of LSPC and probiotics on MAPK pathway. Data are expressed as the mean ± SD (n = 3). Different capital letters above column indicate significant differences between groups (p < 0.05). The expression of each target proteins are normalized to that of β-actin. NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb12 and LGG mixture. ZO-1, zonnula occludens-1; p-p38; phosphorylated p38; p-JNK1/2, phosphorylate c-Jun Nterminal kinase 1/2; p-ERK1/2, phosphorylated extracellular signal-regulated protein kinases 1/2.

group, the mice in 0.5% B, 0.2%B, 0.5% B + P1, 0.5% B + P2, P1 and P2 groups showed significant lower stool water content (Fig. 1B), which was consistent with the recent study on polyphenol (Verhelst et al., 2014). Moreover, the same results on leukocytes counts, Na+ and Cl− ion concentration were also observed among all the treatments as

of neutrophil leukocytes in serum were significantly increased, while the weight gain, sodium ion and chloride ion concentration in serum were remarkably decreased after ETEC challenge in DM group, all of which were the typical clinic response in diarrhea model induced by ETEC (Dubreuil, Isaacson, & Schifferli, 2016). Compared with DM 8

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Fig. 7. Effect of LSPC and probiotics on the mRNA levels of TNF-α, IL-8, IL-1ß, IL-6 (A), CD14, TLR4, p38, NF-ƙB (B) and the proposed regulation pathway in the intestinal mucosa of ICR mice challenged with K88ac (C). Data are expressed as the mean ± SD (n = 3). The mean values in the same row with unlike letters indicate significant differences (p < 0.05). The relative mRNA expression of the target genes are normalized to that of normal control. NC, normal control group; DM, diarrhea mice group; 0.5% B diarrhea mice fed with 0.5% LSPC; 0.2%B, diarrhea mice fed with 0.2%LSPC; 0.5% B + P1, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12; 0.5% B + P2, diarrhea mice fed with 0.5% LSPC plus 1 × 108 CFU/kg Bb-12 and LGG mixture; P1, diarrhea mice fed with 1 × 108 CFU/kg Bb-12; P2, diarrhea mice fed with 1 × 108 CFU/kg Bb-12 and LGG mixture. TNF-α, tumor necrosis factorα; IL-8, interleukin-8; IL-1ß, interleukin-1β; IL-6, interleukin-6; CD14, cluster of differential 14; TLR4, toll-like receptor 4; NF-ƙB, nuclear factor-κB.

mainly depends on intestinal barrier function, which can be generally assessed by different indices such as DAO activity of plasma/intestine and tight junction structure. In agreement with related studies (Wang et al., 2017), the serum DAO activity sharply increased in DM group, while LSPC and probiotics supplementation alleviated the ETEC-induced increase of DAO. The intestinal integrity is fundamental to epithelial cell function and to prevent the invasion of pathogenic bacteria. It has been reported that the injured intestine infected by ETEC will increase the intestinal permeability (Hu, Gu, Luan, Song, & Zhu, 2012). These observations are in line with our current ongoing studies, in which LSPC and LGG show high anti-invasion activity in J2 cell against ETEC. It is widely reported that ETEC infection can inhibit the expression of intestinal tight junction protein and subsequently loosen the epithelial barrier. And the membrane fusion of tight junctions, which represent the damage of epithelial barrier, can be observed by electron microscopy (Yu et al., 2015). Our results showed that ETEC infection significantly reduced the mRNA expression of ZO-1, claudin-1, occludin in intestine tissues (p < 0.05) (Fig. 4), and the status levels of these three tight junction proteins (p < 0.05) (Fig. 6A and B). Moreover, as in ultrastructural analysis, tight junctions of ETEC-infected mice widened and were broken, which were corresponded to previous reports (Ugalde-Silva, Gonzalez-Lugo, & Navarro-Garcia, 2016). However, the supplementation with LSPC and probiotics enhanced the expression of ZO-1, claudin-1, occludin in the intestinal mucosa at both the mRNA expressions and protein levels, as well as improving the tight junction

compared to DM group. Interestingly, all the symptom results in 0.5% B + P1 and 0.5% B + P2 combing group displayed better effects than that in 0.5%B, P1 and P2 alone groups. In line with the recent reported results, our data also suggested that the combination of LSPC and Bb-12 and LGG further improved this anti-diarrhea function than that of treated individual (Yang et al., 2015). This may be because LSPC acts as a prebiotics to combine with probiotics, improving the composition of intestinal microbes and further reducing diarrhea caused by ETEC. The excessive losses of water and salt (chloride ion and sodium ion) in the secretory diarrhea can in turn bring intestine injury and disrupt intestinal integrity (Deng et al., 2015). And intestine morphology analysis can clearly reveal the extent of intestine injury. As the described in previous study (Bian et al., 2016; Wang et al., 2016), reduction in villous height, increasing of villous width and crypt depth, forming epithelial erosion were observed in DM group after challenged with ETEC (Fig. 3). Villi plays an important role in intestinal absorption. The crypt depth and the status of intestinal epithelium are a useful criterion for evaluating intestinal healthy (Bian et al., 2016). The morphology changes in DM group were consistent with the above results of clinic symptoms. Among all the treatments, LSPC and probiotics treatment groups all showed the intestinal protection effect against ETEC infection, while 0.5% LSPC supplementation exhibited a lager villous height and narrower crypt width than that in 0.2% B, P1 and P2 groups. Moreover, the combination of LSPC with Bb-12 and LGG group can further improve the protection than that of individual treatment. Besides the intact intestinal morphology, the intestinal integrity also 9

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

infection in DM group. As reduction of inflammatory cytokines in LSPC and probiotics treatments mice, the expression of these four regulators were also profoundly decreased (Fig. 7B). These results were in line with a recent study, which indicated that tea polyphenols reduced inflammation via regulation of the TLR4 signaling pathway (Li et al., 2014). The proposed improvement pathway in inflammation was summarized in Fig. 7C. In conclusion, our present study clearly demonstrated the dietary supplements of LSPC and probiotics improved intestine barrier, inflammatory response and oxidant stress, and protected against ETECinduced intestinal damage probably via mediating TLR4-MAPK signaling pathway. The combination of procyanidins and probiotics might act as intestinal barrier repaired, immunomodulators, antioxidants and provide a new potential nature therapeutic agent to restrict the diarrhea consequences of ETEC infection. In spite of a number of limitations in this ETEC-induced ICR diarrhea model, the amounts of LSPC and probiotics used in this study will be applicable in the ETEC-induced diarrhea prevention of young animals.

ultrastructure. Interestingly, LSPC with combination of probiotic also further improved the tight junction protein expression and their ultrastructure comparing with the LSPC and probiotic alone. It has been reported that polyphenol-rich extracts (Ling et al., 2016; Shigeshiro, Tanabe, & Suzuki, 2013) and probiotics (Bian et al., 2016; Yang, Jiang, Zheng, Wang, & Yang, 2014) improved the intestinal barrier function by up-regulation of tight junction proteins in mice or piglets challenged by pathogenic E. coli. strains or colitis. In addition, the combination of polyphenol-rich rice bran and LGG and E. coli Nissle (EcN) also further improved the gut barrier function in rotavirus diarrhea than use of rice bran, LGG and EcN separately (Yang et al., 2015). Thus, our observations suggested that LSPC, Bb-12, LGG or their combinations could be an effective way to inhibit the intestinal barrier dysfunction induced by ETEC. Generally, the regulations of tight junction ultrastructure and function envelops different MAPK signaling molecules, in which ERK, p38 and JNK subfamilies are three most widely characterized members (Wang et al., 2016). Our present results suggested that LSPC and probiotics markedly reduced the phosphorylation of p38, JNK1/2 and ERK1/2 levels induced by ETEC (Fig. 6C–E), which was in agreement with several other studies. Catechin and EGCG had been reported that they could inhibit the LPS-induced phosphorylation of ERK, p38 and JNK. And probiotics such as Lactobacillus strains had also extensively reported their down-regulations in ERK and JNK (Ohland & Macnaughton, 2010; Yu et al., 2015). As same as the other polyphenols, our results also proved that LSPC and probiotics regulated the expression of ETEC-induced tight junction proteins through MAPK pathway, and this proposed improving effect was displayed in Fig. 6F. On the one hand, it has been established that the phosphorylation of MAPKs could promote the inflammation, and the activated p38 and JNK had been demonstrated in expanding the inflammation (Zanello et al., 2011). Furthermore, ETEC infection could activate the inflammation response by NF-kB and MAPKs signaling pathway (Ren et al., 2014). Similar to the other studies, our results also showed that the ETEC infection significantly up-regulated the intestinal mRNA expression of TNF-α, IL-8, 1L-1ß,IL-6 and the gene expression of their regulator in MAPKs pathway. The increasing expression of these inflammatory factors were markedly alleviated in the LSPC and probiotics treatments. Our results were in line with recent studies in which the polyphenol showed inhibition in TNF-α, IL-8, 1L-1ß,IL-6, and NF-ƙB expression in TLR4 signaling pathway (Rahimifard et al., 2017), and ETEC-induced IL-8 and IL-6 levels could also been inhibited by different probiotics (Yang et al., 2014; Yu et al., 2015). On the other hand, LPS infection could increase the free radical production which would also promote the inflammation response in the intestine. Nevertheless, it was widely accepted that the proanthocyanidin could act as radical scavenging compounds, which could reduce this oxidative damage (Kaulmann & Bohn, 2016). Our results found that the LSPC and probiotics supplements were helpful for suppressing the intestinal oxidative stress by increasing the status of T-AOC, GSH and reducing MDA levels, and the present of Bb-12 significantly enhanced this protective effect of LSPC (Fig. 2). Similar results had also reported on other sources of proanthocyanidin (Gil-Cardoso et al., 2017; Li et al., 2016) and probiotics (Bifidobacterium) (Yang et al., 2015). Bifidobacterium exert the protective actions in the improvement of colonic immune system and the gut environment, and our laboratory had also demonstrated that the combination of Bb-12 and LSPC could maintain the intestinal steady-state (Li et al., 2016). To clarify the mechanism involved of anti-inflammatory effects of LSPC and probiotics, the expressions of CD14, TLR4, p38 and NF-ƙB in MAPKs pathway were measured. The endotoxin LPS generated by ETEC can activate MyD88 pathways, and the LPS complex first attaches to a membrane-bound protein-CD14 for facilitating its membrane crossing, which substantially enhance the TLR4 signaling and induce the activation of NF-ƙB (Rahimifard et al., 2017). Our present results demonstrated the same activations of CD14, TLR4, p38 and NF-ƙB after ETEC

5. Ethics statements All experimental using animals and protocols were approved by Animal Ethical and Welfare Committee of Huazhong Agriculture University (permission no. SCXK2017-0018) and the involving procedures were performed in accordance with international Guiding Principles in the Care and Use of Animals. Declaration of Competing Interest No conflict of interest exists in the submission of this paper. Acknowledgements This work was supported by Science and Technology Program of Guangzhou, China (Project No. 2016170). Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.jff.2019.103521. References Bian, X., Wang, T. T., Xu, M., Evivie, S. E., Luo, G. W., Liang, H. Z., et al. (2016). Effect of lactobacillus strains on intestinal microflora and mucosa immunity in Escherichia coli O157:H7-induced Diarrhea in mice. Current Microbiology, 73(1), 65–70. Bruins, M. J., Vente-Spreeuwenberg, M. A., Smits, C. H., & Frenken, L. G. (2011). Black tea reduces diarrhoea prevalence but decreases growth performance in enterotoxigenic Escherichia coli-infected post-weaning piglets. Journal of Animal Physiology and Animal Nutrition, 95(3), 388–398. Campos-Salinas, J., Cavazzuti, A., O'Valle, F., Forte-Lago, I., Caro, M., Beverley, S. M., et al. (2014). Therapeutic efficacy of stable analogues of vasoactive intestinal peptide against pathogens. Journal of Biological Chemistry, 289(21), 14583–14599. Cao, J., Li, B., Fang, L., Chen, H., & Xiao, S. (2012). Pathogenesis of nonsuppurative encephalitis caused by highly pathogenic Porcine reproductive and respiratory syndrome virus. Journal of Veterinary Diagnostic Investigation, 24(4), 767–771. Choy, Y. Y., & Waterhouse, A. L. (2014). Proanthocyanidin Metabolism, a mini review. Nutrition and Aging, 2(2,3), 111–116. Deng, Y., Han, X., Tang, S., Xiao, W., Tan, Z., Zhou, C., et al. (2015). Magnolol and honokiol regulate the calcium-activated potassium channels signaling pathway in Enterotoxigenic Escherichia coli-induced diarrhea mice. European Journal of Pharmacology, 755, 66–73. Dubreuil, J. D. (2013). Antibacterial and antidiarrheal activities of plant products against enterotoxinogenic Escherichia coli. Toxins (Basel), 5(11), 2009–2041. Dubreuil, J. D. (2017). Enterotoxigenic Escherichia coli and probiotics in swine: What the bleep do we know? Biosci Microbiota Food Health, 36(3), 75–90. Dubreuil, J. D., Isaacson, R. E., & Schifferli, D. M. (2016). Animal Enterotoxigenic Escherichia coli. EcoSal Plus, 7(1), 1–47. Fairbrother, J. M., Nadeau, E., & Gyles, C. L. (2005). Escherichia coli in postweaning diarrhea in pigs: An update on bacterial types, pathogenesis, and prevention strategies. Animal Health Research Reviews, 6(1), 17–39. Fleckenstein, J. M., Hardwidge, P. R., Munson, G. P., Rasko, D. A., Sommerfelt, H., &

10

Journal of Functional Foods 62 (2019) 103521

C. Tang, et al.

Shimazu, R., Akashi, S., Ogata, H., Nagai, Y., Fukudome, K., Miyake, K., et al. (1999). MD2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. Journal of Experimental Medicine, 189(11), 1777–1782. Tang, C., Xie, B. J., & Sun, Z. D. (2017). Antibacterial activity and mechanism of B-type oligomeric procyanidins from lotus seedpod on enterotoxigenic Escherichia coli. Journal of Functional Foods, 38, 454–463. Ugalde-Silva, P., Gonzalez-Lugo, O., & Navarro-Garcia, F. (2016). Tight junction disruption induced by Type 3 secretion system effectors injected by Enteropathogenic and Enterohemorrhagic Escherichia coli. Frontiers in Cellular and Infection Microbiology, 6, 87. Valero-Cases, E., Roy, N. C., Frutos, M. J., & Anderson, R. C. (2017). Influence of the fruit juice carriers on the ability of lactobacillus plantarum DSM20205 to improve in vitro intestinal barrier integrity and its probiotic properties. Journal of Agricultural and Food Chemistry, 65(28), 5632–5638. Verhelst, R., Schroyen, M., Buys, N., & Niewold, T. (2014). Dietary polyphenols reduce diarrhea in enterotoxigenic Escherichia coli (ETEC) infected post-weaning piglets. Livestock Science, 160, 138–140. Walker, R. I. (2015). An assessment of enterotoxigenic Escherichia coli and Shigella vaccine candidates for infants and children. Vaccine, 33(8), 954–965. Wang, K., Jin, X., Chen, Y., Song, Z., Jiang, X., Hu, F., et al. (2016). Polyphenol-rich propolis extracts strengthen intestinal barrier function by activating AMPK and ERK signaling. Nutrients, 8(5), 272–284. Wang, H., Liu, Y., Shi, H., Wang, X., Zhu, H., Pi, D., et al. (2017). Aspartate attenuates intestinal injury and inhibits TLR4 and NODs/NF-kappaB and p38 signaling in weaned pigs after LPS challenge. European Journal of Nutrition, 56(4), 1433–1443. Wang, K., Qi, Y., Yi, S., Pei, Z., Pan, N., & Hu, G. (2016). Mouse duodenum as a model of inflammation induced by enterotoxigenic Escherichia coli K88. Journal of Veterinary Research, 60(1), 19–23. Wolvekamp, M. C. J., & Debruin, R. W. F. (1994). Diamine oxidase – An overview of historical, biochemical and functional-aspects. Digestive Diseases, 12(1), 2–14. Wu, Q., Li, S. Y., Li, X. P., Sui, Y., Yang, Y., Dong, L. H., et al. (2015). Inhibition of advanced glycation endproduct formation by lotus seedpod oligomeric procyanidins through RAGE-MAPK signaling and NF-kappa B activation in high-fat-diet rats. Journal of Agricultural and Food Chemistry, 63(31), 6989–6998. Wu, Q., Li, S. Y., Yang, T., Xiao, J., Chu, Q. M., Li, T., et al. (2015). Inhibitory effect of lotus seedpod oligomeric procyanidins on advanced glycation end product formation in a lactose-lysine model system. Electronic Journal of Biotechnology, 18(2), 68–76. Wu, Y., Zhu, C., Chen, Z., Chen, Z., Zhang, W., Ma, X., et al. (2016). Protective effects of Lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic Escherichia coli in intestinal porcine epithelial cells. Veterinary Immunology and Immunopathology, 172, 55–63. Xiao, J. S., Xie, B. J., Cao, Y. P., Wu, H., Sun, Z. D., & Xiao, D. (2012). Characterization of oligomeric procyanidins and identification of quercetin glucuronide from lotus (Nelumbo nucifera Gaertn.) seedpod. Journal of Agricultural and Food Chemistry, 60(11), 2825–2829. Yang, K. M., Jiang, Z. Y., Zheng, C. T., Wang, L., & Yang, X. F. (2014). Effect of lactobacillus plantarum on diarrhea and intestinal barrier function of young piglets challenged with Enterotoxigenic Escherichia coli k88. Journal of Animal Science, 92(4), 1496–1503. Yang, X., Twitchell, E., Li, G., Wen, K., Weiss, M., Kocher, J., et al. (2015). High protective efficacy of rice bran against human rotavirus diarrhea via enhancing probiotic growth, gut barrier function, and innate immunity. Scientific Reports, 5, 15004. Yasir, M., Sultana, B., & Amicucci, M. (2016). Biological activities of phenolic compounds extracted from Amaranthaceae plants and their LC/ESI-MS/MS profiling. Journal of Functional Foods, 26, 645–656. Yu, Q., Yuan, L., Deng, J., & Yang, Q. (2015). Lactobacillus protects the integrity of intestinal epithelial barrier damaged by pathogenic bacteria. Frontiers in Cellular and Infection Microbiology, 5, 26. Zanello, G., Berri, M., Dupont, J., Sizaret, P. Y., D'Inca, R., Salmon, H., et al. (2011). Saccharomyces cerevisiae modulates immune gene expressions and inhibits ETECmediated ERK1/2 and p38 signaling pathways in intestinal epithelial cells. PLoS ONE, 6(4), 1–13. Zhang, S., Wu, Q., Zhang, J., Lai, Z., & Zhu, X. (2016). Prevalence, genetic diversity, and antibiotic resistance of enterotoxigenic Escherichia coli in retail ready-to-eat foods in China. Food Control, 68, 236–243.

Steinsland, H. (2010). Molecular mechanisms of enterotoxigenic Escherichia coli infection. Microbes and Infection, 12(2), 89–98. Gil-Cardoso, K., Gines, I., Pinent, M., Ardevol, A., Arola, L., Blay, M., et al. (2017). Chronic supplementation with dietary proanthocyanidins protects from diet-induced intestinal alterations in obese rats. Molecular Nutrition & Food Research, 61(8). Goebel, M., Stengel, A., Wang, L., & Tache, Y. (2011). Central nesfatin-1 reduces the nocturnal food intake in mice by reducing meal size and increasing inter-meal intervals. Peptides, 32(1), 36–43. Guttman, J. A., Li, Y., Wickham, M. E., Deng, W., Vogl, A. W., & Finlay, B. B. (2006). Attaching and effacing pathogen-induced tight junction disruption in vivo. Cellular Microbiology, 8(4), 634–645. Hou, C., Zeng, X., Yang, F., Liu, H., & Qiao, S. (2015). Study and use of the probiotic Lactobacillus reuteri in pigs: A review. Journal of Animal Science and Biotechnology, 6(1), 14. Hu, C. H., Gu, L. Y., Luan, Z. S., Song, J., & Zhu, K. (2012). Effects of montmorillonite–zinc oxide hybrid on performance, diarrhea, intestinal permeability and morphology of weanling pigs. Animal Feed Science and Technology, 177(1–2), 108–115. Huang, B., Xiao, D., Tan, B., Xiao, H., Wang, J., Yin, J., et al. (2016). Chitosan oligosaccharide reduces intestinal inflammation that involves calcium-sensing receptor (CaSR) activation in lipopolysaccharide (LPS)-challenged piglets. Journal of Agricultural and Food Chemistry, 64(1), 245–252. Kaulmann, A., & Bohn, T. (2016). Bioactivity of polyphenols: Preventive and adjuvant strategies toward reducing inflammatory bowel diseases-promises, perspectives, and pitfalls. Oxidative Medicine and Cellular Longevity, 2016, 9346470. Leahy, S. C., Higgins, D. G., Fitzgerald, G. F., & van Sinderen, D. (2005). Getting better with bifidobacteria. Journal of Applied Microbiology, 98(6), 1303–1315. Li, X., Sui, Y., Li, S., Xie, B., & Sun, Z. (2016). A-type procyanidins from litchi pericarp ameliorate hyperglycaemia by regulating hepatic and muscle glucose metabolism in streptozotocin (STZ)-induced diabetic mice fed with high fat diet. Journal of Functional Foods, 27, 711–722. Li, Y. W., Zhang, Y., Zhang, L., Li, X., Yu, J. B., Zhang, H. T., et al. (2014). Protective effect of tea polyphenols on renal ischemia/reperfusion injury via suppressing the activation of TLR4/NF-kappa B p65 signal pathway. Gene, 542(1), 46–51. Ling, K. H., Wan, M. L., El-Nezami, H., & Wang, M. (2016). Protective capacity of resveratrol, a natural polyphenolic compound, against deoxynivalenol-induced intestinal barrier dysfunction and bacterial translocation. Chemical Research in Toxicology, 29(5), 823–833. Ling, Z. Q., Xie, B. J., & Yang, E. L. (2005). Isolation, characterization, and determination of antioxidative activity of oligomeric procyanidins from the seedpod of Nelumbo nucifera Gaertn. Journal of Agricultural and Food Chemistry, 53(7), 2441–2445. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods, 25(4), 402–408. Ohland, C. L., & Macnaughton, W. K. (2010). Probiotic bacteria and intestinal epithelial barrier function. American Journal of Physiology: Gastrointestinal and Liver Physiology, 298(6), G807–G819. Poter, L. J., Hrstich, L. N., & Chan, B. (1986). The conversion of proanthocyanidins and prodelphinidins to cyanidins and delphinidin. Phytochemistry, 25(7), 223–230. Rahimifard, M., Maqbool, F., Moeini-Nodeh, S., Niaz, K., Abdollahi, M., Braidy, N., et al. (2017). Targeting the TLR4 signaling pathway by polyphenols: A novel therapeutic strategy for neuroinflammation. Ageing Res Rev, 36, 11–19. Ren, W., Yin, J., Duan, J., Liu, G., Zhu, X., Chen, S., et al. (2014). Mouse intestinal innate immune responses altered by enterotoxigenic Escherichia coli (ETEC) infection. Microbes and Infection, 16(11), 954–961. Sanchez-Fidalgo, S., da Silva, M. S., Cardeno, A., Aparicio-Soto, M., Salvador, M. J., Sawaya, A. C. H. F., et al. (2013). Abarema cochliacarpos reduces LPS-induced inflammatory response in murine peritoneal macrophages regulating ROS-MAPK signal pathway. Journal of Ethnopharmacology, 149(1), 140–147. Sargeant, H. R., Miller, H. M., & Shaw, M. A. (2011). Inflammatory response of porcine epithelial IPEC J2 cells to enterotoxigenic E. coli infection is modulated by zinc supplementation. Molecular Immunology, 48(15–16), 2113–2121. Shigeshiro, M., Tanabe, S., & Suzuki, T. (2013). Dietary polyphenols modulate intestinal barrier defects and inflammation in a murine model of colitis. Journal of Functional Foods, 5(2), 949–955.

11