Probing the archaeal diversity of a mixed thermophilic bioleaching culture by TGGE and FISH

ARTICLE IN PRESS

Systematic and Applied Microbiology 32 (2009) 501–513 www.elsevier.de/syapm

Probing the archaeal diversity of a mixed thermophilic bioleaching culture by TGGE and FISH Deirdre Mikkelsena,1, Ulrike Kapplerb, Alastair G. McEwanb, Lindsay I. Slya,b, a

Centre for Bacterial Diversity and Identification, School of Chemistry & Molecular Biosciences, The University of Queensland, Brisbane, Qld 4072, Australia b Centre for Metals in Biology, School of Chemistry & Molecular Biosciences, The University of Queensland, Brisbane, Qld 4072, Australia Received 24 February 2009

Abstract The archaeal community present in a sample of Mixed Thermophilic Culture-B (MTC-B) from a laboratory-scale thermophilic bioleaching reactor was investigated by temperature gradient gel electrophoresis (TGGE) and fluorescence in situ hybridisation (FISH). Both techniques were specifically adapted for use on native state bioleaching samples, with a view to establishing convenient means for monitoring culture composition. Using the TGGE protocol developed, the relative species composition of the thermophilic bioleaching sample was analysed, and included four phylotypes belonging to the Sulfolobales, which were related to Stygiolobus azoricus, Metallosphaera sp. J1, Acidianus infernus and Sulfurisphaera ohwakuensis. However, the St. azoricus-like phylotype was difficult to resolve and some micro-heterogeneity was observed within this phylotype. Specific FISH probes were designed to qualitatively assess the presence of the phylotypes in MTC-B. The sample was dominated by Sf. ohwakuensis-like Archaea. In addition, the St. azoricus-like, Metallosphaera species-like and Acidianus species-like cells appeared in similar low abundance in the community. Most strikingly, FISH identified Sulfolobus shibatae-like cells present in low numbers in the sample even though these were not detected by PCR-dependent TGGE. These results highlight the importance of using more than one molecular technique when investigating the archaeal diversity of complex bioleaching reactor samples. r 2009 Elsevier GmbH. All rights reserved. Keywords: Bioleaching; Fluorescence in situ hybridisation; Molecular ecology; Temperature gradient gel electrophoresis; Sulfolobales; Acidianus; Metallosphaera; Sulfolobus; Stygiolobus; Sulfurisphaera

Introduction Corresponding author at: Centre for Bacterial Diversity and

Identification, School of Chemistry & Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072, Australia. Tel.: +61 7 3365 2396; fax: +61 7 3365 1566. E-mail address: [email protected] (L.I. Sly). 1 Current address: Centre for Nutrition and Food Sciences, The University of Queensland, Brisbane, Qld 4072, Australia. 0723-2020/$ - see front matter r 2009 Elsevier GmbH. All rights reserved. doi:10.1016/j.syapm.2009.06.001

Bioleaching, the microbial solubilisation of metals from low-grade sulfidic ores [6], has become a wellestablished commercial process in the last decade. During operation of bioleaching processes, changes in operating parameters such as increase or decrease in pH, temperature and/or metal ion concentrations in the leaching environment can potentially cause a shift in the

ARTICLE IN PRESS 502

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

relative composition of the microbial bioleaching community. Subsequently, the bioleaching capacity of the microbial consortium with respect to the ore concentrate used could be substantially affected, thus increasing the residence time of the ore and eventually reducing the economical benefits of the bioleaching operation. To address these issues and ensure the optimum operation of such processes, it is desirable to develop tools for the rapid screening of the bioleaching microbial communities. In recent years, methods typically used to fingerprint microbial communities in various environments have included denaturing/temperature gradient gel electrophoresis (DGGE/TGGE) [34,35] and fluorescence in situ hybridisation (FISH) [1,33]. The appeal of TGGE is that it is relatively easy and rapid to perform, being especially suited to the simultaneous analysis of multiple samples. This latter feature is particularly useful when examining and monitoring microbial population changes due to changing environmental factors [35]. On the other hand, FISH has proven to be an important tool as it allows the simultaneous identification, visualisation, enumeration and spatial distribution of microorganisms in their natural habitat [1,33]. Interestingly, in bioleaching environments, DGGE/ TGGE and FISH techniques have been used sparingly. In fact TGGE, a variant of DGGE that uses a linear temperature gradient instead of a linear chemical gradient to separate DNA fragments, to the best of our knowledge, has not been used to investigate the diversity of bioleaching communities in extremely acidic, metal-rich environments. However, several studies have used DGGE to analyse mesophilic bioleaching microorganisms in an Indonesian auto-heating copper mine waste heap [23], a deep South African gold mine [23] and a low-grade copper ore bioleaching test heap in Chile [14]. To date, only one study has used DGGE to characterise a thermophilic sulphur-oxidising enrichment culture dominated by a Sulfolobus sp., obtained from an extremely acidic underground hot spring sediment, located in an underground mine in Japan [49]. The use of FISH to study the microorganisms in extremely acidic metal-rich environments has been limited to sites of acid mine drainage, the Tinto River (in Spain) and an acid mining lake [4,5,15–17,25, 26,29,42]. In these investigations, oligonucleotide probes have been designed to target the phylum Acidobacteria subdivision 1 and the following mesophilic and moderately thermophilic acidophilic microorganisms: Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans, Leptospirillum ferrooxidans, Leptospirillum ferriphilum and ‘Leptospirillum ferrodiazotrophum’, Acidithiobacillus caldus, Acidimicrobium and relatives, the genera Sulfobacillus, Acidiphilium and Ferroplasma, and the Thermoplasmales group [4,5,11,15–17,25,26,29,53]. Despite these acid mine drainage microbes also being ubiquitous

in mesophilic and moderate thermophilic commercial bioleaching processes, only one study has utilised some of the existing FISH probes to assay the microbial population in a heap bioleaching operation in South Africa [10]. Crude ore and liquid samples were taken from the GeoBiotics temperature controlled mesophilic heap bioleaching operation at the Agnes Gold Mine in Barberton, and were subjected to several washes with detergent and acidified water [10]. Thereafter, microbial identification and quantification was achieved using previously published species- and genus-specific FISH probes targeting mesophilic and moderately thermophilic acidophilic microorganisms [10]. Recently, 16S rRNA-targeted oligonucleotide probes have been designed to detect cultured and uncultured archaeal lineages in high-temperature environments and include a group probe targeting all the members of the order Sulfolobales [36]. However, this probe has only been used in dot-blot hybridisation experiments [36]. FISH is yet to be applied to investigate the microbial communities in extreme thermophilic bioleaching operations. This is not surprising, as analyses of such samples with FISH pose a special challenge, due to their high ore content and acidic nature. Furthermore, the ore particles in samples could interfere with sample processing and give false-positive results due to autofluorescence. Given the lack of molecular tools to rapidly analyse and monitor the biodiversity of commercial (or natural) acidic, metal-rich, extreme thermophilic environments, this study aimed to develop TGGE and FISH protocols suitable for rapid fingerprinting and characterisation. We have used the well-characterised MTC-B lab scale reactor sample [32] as the model community to develop methods for investigating community composition.

Materials and methods Reference cultures and bioleaching reactor sample The type cultures Acidianus brierleyi (DSMZ 1651T), Metallosphaera sedula (DSMZ 5348T), Stygiolobus azoricus (DSMZ 6296T), Sulfolobus acidocaldarius (DSMZ 639T), Sulfolobus metallicus (DSMZ 6482T) and Sulfolobus solfataricus (DSMZ 1616T) were used in the early developmental and optimisation stages of the TGGE and FISH methods. All reference cultures were obtained from the Deutsche Sammlung von Mikroorganismen und Zellkuturen (DSMZ), Braunschweig, Germany. Propionibacterium acnes (ACM 5109) was obtained from the Australian Collection of Microorganisms (ACM), The University of Queensland, Australia, and served as a negative control when testing the specificity of the MET631 probe (Table 2). All cultures

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

were revived and maintained as per the instructions of the providing facility. The thermophilic bioleaching sample analysed in this study was kindly supplied by BHP-Billiton (Randburg, South Africa) and is referred to as Mixed Thermophilic Culture-B (MTC-B). The MTC-B sample was grown at 78 1C in a medium containing 0.4 g L1 (NH4)2SO4, 0.5 g L1 MgSO4  7H2O, 0.2 g L1 K2PO4 and 0.1 g L1 KCl, at pH 1.6 in a laboratory-scale batch reactor fed with chalcopyrite (CuFeS2) concentrate (12% w/v pulp density) and at a redox potential of 650 mV, a dissolved oxygen concentration of 2.25 mg/L, and with 11 g L1 copper in solution.

DNA extraction and PCR DNA was extracted from the MTC-B sample using the DNAzols Reagent (Invitrogen Australia Pty Limited, Australia). Community DNA was extracted in duplicates and pooled. Archaeal primers 25F [8] and 519R [41] were used to generate partial 16S rRNA gene amplicons by polymerase chain reaction (PCR) for TGGE analysis. The 50 end of the reverse primer contained a 42-base GC-clamp (50 -CGC CCC CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC CGC-30 ). PCR was carried out in a PTC-100 thermal cycler (MJ Research Inc., USA) (Cycling conditions: 96 1C for 9 min followed by 30 cycles of 96 1C for 1 min, 48 1C for 1 min and 72 1C for

503

2 min, final extension period: 10 min at 72 1C). PCR reactions were carried out according to the manufacturer’s specifications using 2.5 U AmpliTaq Gold (Applied Biosystems Inc., USA) and 50 ng of template DNA. 2% DMSO (v/v) was added to the PCRs.

TGGE conditions The Poland program package was used to generate melting profiles to determine if the PCR product size and region of 16S rRNA gene chosen was suitable for TGGE analysis. PCR templates were either genomic DNA from reference cultures or the MTC-B community, or PCR products generated from 16S rRNA gene clone representatives of each of the phylotypes identified from the previously constructed clone library of the MTC-B community (Fig. 1) [32]. TGGE was performed using the Biometra TGGE System (Biometra, Germany), according to the manufacturer’s instructions. Perpendicular gels were used to determine the temperature gradient needed to separate fragments amplified from the 16S rRNA genes on a parallel TGGE gel. For perpendicular TGGE analysis, unpurified PCR products of the pure cultures (160 ng per sample) were applied directly onto a 6% (wt/vol) polyacrylamide gel containing 8 M urea, 2% glycerol and 20% formamide in 0.5  TBE buffer. Electrophoresis of these gels was performed at constant current

Fig. 1. Evolutionary distance tree of 16S rRNA gene sequences generated in a previous 16S rRNA gene library study of MTC-A and MTC-B bioleaching samples (modified from [32]), showing the five groups formed by the phylogenetic affiliation of MTC-A and MTC-B clones with known members of the order Sulfolobales, and the specificity of the FISH probes designed in this study to target them. The groups are presented as triangles and the number next to each indicates the number of MTC-A and MTC-B clones present in each group. The S. shibatae-like group was only present in the MTC-A clone library and not in the MTC-B clone library. Evolutionary distances are indicated by the sum of horizontal branch lengths. The scale bar represents 0.1 estimated change per nucleotide.

ARTICLE IN PRESS 504

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

(20 mA) with a temperature gradient of 25–65 1C (2.67 1C/ cm gel) for 4 h. For parallel TGGE analysis, unpurified TGGE-PCR products (20–40 ng/sample) were applied onto a polyacrylamide gel prepared as described above and separated using 20 mA current and a temperature gradient of 37–45 1C (0.53 1C/cm gel). After electrophoresis, all TGGE gels were silver stained [44].

cyanine fluorochrome. The archaeal domain-specific probe was 50 labelled with Cy3 or the fluorescein isothiocyanate (FITC) fluorochrome. The FITC-labelled probes EUB338, EUB338-II and EUB338-III [12] were combined in a mixture and called the EUBMix, which collectively covered the bacterial domain.

Probe optimisation Design of 16S rRNA-targeted oligonucleotide probes Five oligonucleotide probes were designed specific to the Sulfolobus shibatae-like (SSHI263), the Sulfurisphaera ohwakuensis-like (SOH1252), the St. azoricuslike (STY1255), the Metallosphaera species-like (MET631) and the Acidianus species-like (ACI862) monophyletic phylotypes previously identified during the phylogenetic analysis of thermophilic chalcopyrite bioleaching samples MTC-A and MTC-B [32] (Fig. 1). The probes were designed using the probe design tool in the ARB software package [28], based on the comparative analysis of all sequences in the database and the selection of specific regions within the target sequences which allowed their discrimination from the reference sequences. The specificity of the designed probes was tested using probeCheck [27]. The online oligonucleotide properties calculator OligoCalc [22] was used to check the melting temperatures and the Mol% G+C content of the probes. The sequences and details of the probes used in this study are presented in Table 1. All probes were synthesized commercially (Thermo Electron, Germany) and were 50 labelled with the Cy3 sulfoindoTable 1.

The specificity and optimal hybridisation stringency conditions for all probes were determined using the method described by Manz et al. [30]. Each probe was tested on all archaeal reference cultures and negative control cultures (Table 2) to test specificity and optimal hybridisation stringency conditions of probe binding for the envisaged target. The optimal hybridisation stringency was taken as the highest concentration of formamide in the hybridisation buffer that did not result in a substantial drop of bound probe to target 16S rRNA, thus causing loss of fluorescence intensities of the target cells. Probes targeting clone targets were optimised using the MTC-B culture and the closest negative control culture.

Fluorescence in situ hybridisation The thermophilic archaeal positive control reference cultures A. brierleyi, M. sedula, S. acidocaldarius, S. metallicus and S. solfataricus (culture age: 3 days) were used to optimise the sample fixation period. These cultures were selected to represent the Sulfolobales, the

Oligonucleotide probes used in FISH experiments.

Probe

Target organisms

16S rRNA target sitea

Probe sequence (50 –30 )

% formamide

Reference

ARC915 EUB338b EUB338-IIb

Most Archaea Most Bacteria Most Bacteria not detected by EUB338 Most Bacteria not detected by EUB338 and EUB338-II Sf. ohwakuensis-like MTC-A and MTC-B clones (Phylotype I) St. azoricus-like MTC-A and MTC-B clones (Phylotype II) S. shibatae-like MTC-A and MTC-B clones (Phylotype III) Metallosphaera sp. J1 -like MTC-A and MTC-B clones (Phylotype IV), Metallosphaera sp. J1, M. prunae, M. sedula and M. hakonensis A. infernus-like MTC-A and MTC-B clones (Phylotype V), A. infernus and A. ambivalens

915–933 338–355 338–355

GTGCTCCCCCGCCAATTCCT GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT

15, 25, 35 35 35

[52] [2] [12]

338–355

GCTGCCACCCGTAGGTGT

35

[12]

1252–1270

CTTTCGGGGTAGCTTCCC

15

This study

862–880

CCTCTTTCGGGGTAGCAT

25

This study

263–286

CCCGTTATCGGCTTGGGGGGCCC

35

This study

631–649

CTGTAAGTATCACCGCCG

35

This study

862–880

GGCAGGCTTACCGGTTTC

35

This study

EUB338-IIIb SOH1252 STY1255 SSHI263 MET631

ACI862

a

16S rRNA, E. coli numbering [7]. EUB338, EUB338-II and EUB338-III are used in a mix called EUB mix and nucleotides in boldface indicate differences to EUB338 in this position. b

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

Table 2.

Probes designed and the organisms used as their negative controls to ensure the specificity of probes.

Probe and negative control organism

16S rRNA probe target sequence and corresponding negative control 16S rRNA sequencea

SOH1252 Stygiolobus azoricus

50 -GGGAAGCTACCCCGAAAG-30 50 -. . . .U. . . . . . . .. . . . . . . . . . .-30

STY1255 Stygiolobus azoricus

50 -ATGCTACCCCGAAAGAGG-30 50 -. . . . . . . . . . . . . . . . . . . .g. . -30

SSHI263 Sulfolobus solfataricus

50 -GGGCCCCCCAAGCCGATAACGGG-30 50 -. . . . . . . . . . . . . . . . . . . . .U. . . . . . . -30

MET631 Propionibacterium acnes

50 -CGGCGGTGATACTTACAG-30 50 -.C. . . . . . . . . . . . . . . g. . Gg.-30

ACI862 Acidianus brierleyi

50 -GAAACCGGTAAGCCTGCC-30 50 -. . . . . . . . . . . . . . . . . . . C. . .-30

a

505

Only mismatching nucleotides are indicated.

order to which almost all presently known thermophilic bioleaching microorganisms belong, and the order previously demonstrated to dominate the MTC-B sample [32]. Initially, fixation times of 1, 2, 3, 5, 9 and 18 h were tested for the positive control cultures. The effect of fixation duration on each pure culture was determined by conducting FISH using the Cy3-labelled ARC915 probe. Subsequently, the positive control cultures and the MTC-B sample were prepared for in situ hybridisation at the optimal conditions of fixing for 9 h at 4 1C, in a solution of 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS; 130 mM sodium chloride, 10 mM sodium phosphate buffer, pH 7.2) solution. Samples were washed with PBS, and each resuspended in the same volume of absolute ethanol and PBS, and stored at 20 1C [1]. For the negative control, the P. acnes bacterial culture, the fixation protocol for Gram-positive organisms was followed [1]. The culture was fixed (6 h at 4 1C) and stored at 20 1C. For the MTC-B sample, 3 mL of diluted (1 in 10 with PBS) fixed sample was spotted onto ethanol-cleaned Teflon-coated slides (Cel-Line, USA). For the fixed reference cultures, 3 mL of undiluted fixed cell suspension was applied to the slides. Slides were air-dried and all samples were dehydrated in a 50%, 80% and 100% ethanol series for 3 min each [30]. Slides were allowed to air-dry at room temperature prior to hybridisation. Hybridisations were set up in 8 mL of a hybridisation buffer (0.9 M NaCl, 0.01% SDS and 20 mM Tris/HCl, pH 7.2), in the presence of either 15% (SOH1252 probe), 25% (STY1255 probe) or 35% (ACI862, MET631 and SSHI263 probes) formamide, and a final concentration of 25 ng mL1 for each probe [30]. Hybridisation was carried out for 90 min at 46 1C in a hybridisation oven, followed by a 10 min wash in pre-warmed wash buffer (0.08 M or 0.159 M or 0.318 M NaCl, for 35% or 25% or 15% formamide, respectively) (0.01% SDS, 5 mM EDTA and 20 mM Tris/HCl, pH 7.2) of the same stringency as the hybridisation buffer [30]. Slides were rinsed with cold distilled water and were immediately air-dried.

Prior to microscopy, slides were mounted with DABCO solution (10 mg 1,4-diazabicyclo[2.2.2]octane triethylenediamine in 0.5 M sodium carbonate buffer and 90% glycerol, pH 9.0). Fluorescence microscopy was carried out using a Zeiss Axioplan 2 epifluorescence microscope with a high pressure 100 W mercury bulb and Kontron KS200 analysis software, version 3.0. After images were collected in the FITC and Cy3 channels, they were overlapped and printed using Adobe Photoshop version 7.0 (Adobe Systems Inc., USA). Quantification of probe-hybridised microorganisms was performed for replicate representative fields. The number of archaeal cells that hybridised to each of the specific CY3-labelled probes were counted and expressed as a percentage of the total number of archaea that hybridised to the FITC-labelled ARC915 probe.

Modifications to FISH protocol In an attempt to increase the probe signal intensities observed for MTC-B analyses, samples were pre-treated with either proteinase K or lysozyme or a proteinase K/lysozyme mix, in order to aid entry of the probes into the cells of the samples. Each enzyme was made up at a concentration of 10 mg mL1 in 100 mM Tris/HCl and 50 mM EDTA (pH 7.4). After the MTC-B samples were applied to the slide and dehydrated, 20 mL of each solution was added to the appropriate sample well. The slide was incubated at 37 1C for 1 min, rinsed in distilled water, dried and dehydrated again in the ethanol series.

Results TGGE analysis of MTC-B sample As a TGGE protocol had not been previously reported for the profiling of the thermoacidophilic bioleaching members of the Sulfolobales, we developed

ARTICLE IN PRESS 506

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

a protocol that allowed a rapid and reproducible analysis of the MTC-B archaeal community. This culture had previously been shown to consist of four phylotypes belonging to the Sulfolobales (Fig. 1) [32]. Initially, pure cultures of the type strains of A. brierleyi, M. sedula, S. acidocaldarius, S. metallicus and S. solfataricus were used to establish the optimum conditions for TGGE. The universal archaeal primers 25F and 519R were used to generate a 550 bp fragment, incorporating the V1, V2 and part of the V3 region of the 16S rRNA gene to maximise the phylogenetic information contained in the DNA fragment. A perpendicular TGGE gel of pure culture TGGE-PCR products indicated that a temperature gradient of 37–45 1C would successfully separate the partial 16S rRNA gene amplicons of these type species. When the pure culture samples were applied to a parallel TGGE gel (with a temperature gradient of 37–45 1C), a good separation of the PCR products was achieved and

Fig. 2. Greyscale image of a silver-stained parallel TGGE gel displaying the profiles of the TGGE-16S rRNA gene PCR fragments amplified from reference cultures. Lane 1: M. sedula; lane 2: S. metallicus; lane 3: A. brierleyi; lane 4: S. acidocaldarius; and lane 5: S. solfataricus.

all five type strains occupied unique positions on the TGGE gel (Fig. 2). Multiple bands were observed for the M. sedula sample, possibly due to microvariation in the DNA sequences [51]. The TGGE parameters obtained from the pure culture work were then used to investigate 12 single 16S rRNA gene clones representative of each OTU obtained from the MTC-B clone library constructed in a previous study [32] (Fig. 3). Clones belonging to Phylotypes I and V (Sf. ohwakuensis-like and A. infernus-like) appeared as well-defined bands at unique positions on the gel (Fig. 3, lanes 2 and 7). Phylotype II (St. azoricus-like) MTC-B clones resolved poorly, appearing as smears on the gel (Fig. 3, lanes 3–5). Each of these clones had a slightly different gel location. The resolution of these bands could not be improved by changes in the electrophoresis conditions. The Metallosphaera-like MTC-B clone belonging to Phylotype IV displayed a well-defined triplicate banding pattern (Fig. 3, lane 6), similar to what was seen for the pure culture of M. sedula (Fig. 2). This is an important finding as the resolution of one strain into multiple bands can lead to an overestimation of microbial diversity when interpreting DGGE/TGGE gel profiles and may only be solved by sequencing all of the bands observed. Having successfully established that the dominant phylotypes present in MTC-B could be separated using

Fig. 3. Greyscale image of a silver stained parallel TGGE gel displaying profiles of the TGGE-16S rRNA gene PCR fragments amplified from the MTC-B thermophilic bioleaching sample, and MTC-B 16S rRNA gene clones representing Phylotypes I, II, IV and V (Fig. 1). Lane 1: MTC-B community DNA sample; lane 2: Sf. ohwakuensis-like MTC-B clone 1A; lanes 3–5: St. azoricus-like MTC-B clones 33B, 8A and 48C; lane 6: Metallosphaera sp. J1-like MTC-B clone 20C; and lane 7: A. infernus-like MTC-B clone 35A.

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

TGGE, TGGE-PCR products generated directly from MTC-B community genomic DNA were analysed. The purpose here was to investigate if TGGE could be used directly to determine the phylotypes present in the bioleaching community. DNA-banding patterns corresponding to the phylotypes identified during analysis of individual clones were readily obtained (Fig. 3, lane 1).

Probe specificity and FISH of the MTC-B sample In addition to the PCR-based TGGE method developed, we also designed and developed a FISH protocol, a molecular tool independent of the biases associated

507

with DNA extraction and PCR, to visualise the archaeal cells present in the MTC-B sample. Through the exploitation of conserved and variable regions of 16S rRNA gene sequences, five oligonucleotide probes with varying levels of specificity were designed. The SOH1252, STY1255 and SSHI263 probes are highly specific, designed to target only the Sf. ohwakuensis-like, the St. azoricus-like and the S. shibatae-like phylotypes (Tables 1 and 2, Fig. 1). The MET631 and ACI862 probes have broader specificities (Tables 1 and 2, Fig. 1). Due to the close relationship between the known reference strains of these species and the MTC-B clones, it was impossible to construct probes specific for only

Fig. 4. Whole cell fluorescence in situ hybridisation of the MTC-B sample probed with (A) ARC915-Cy3-labelled probe and EUBMix-FITC-labelled probe; MTC-B sample probed with ARC915-FITC-labelled probe and (B) SOH1252-Cy3-labelled probe (Sf. ohwakuensis-like Phylotype I cells appear yellow); (C) STY1255-Cy3-labelled probe (St. azoricus-like Phylotype II cells appear yellow); (D) ACI862-Cy3-labelled probe (Acidianus-species group cells appear yellow); (E) MET631-Cy3-labelled probe (Metallosphaera-species group cells appear yellow); and (F) SSHI263-Cy3-labelled probe (S. shibatae-like Phylotype III cells appear yellow). The FITC fluorochrome has an excitation wavelength of 492 nm and an emission wavelength of 528 nm. Hence, cells in the sample that bind the FITC-labelled probes appear green and those that bind the Cy3-labelled probes appear red. Those cells that bind both FITC- and Cy3-labelled probes appear yellow. Arrows indicate autofluorescence detected in the Cy3 and FITC channels. Images were captured using an epifluorescence microscope at 1000  magnification. For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.

ARTICLE IN PRESS 508

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

the MTC-B clones closely related to Metallosphaera sp. J1 and A. infernus. Thus these probes are ‘group’ probes targeting not only the Metallosphaera sp. J1-like and A. infernus-like phylotypes, respectively, but also all the known Metallosphaera and Acidianus species (except A. brierleyi) to which the members of the Sulfolobales in the reactor samples were closely related. All five probes had good relative fluorescence hybridisation intensities, indicating high accessibility of each probe to the 16S rRNA, based on the relative fluorescence hybridisation intensity ratings published by Behrens et al. [3]. The probes SOH1252, STY1255, MET631 and ACI862 had relative fluorescence hybridisation intensities of 81–100% (i.e. Class I Brightness). The SSHI263 probe had a relative fluorescence hybridisation intensity of 61–80% (i.e. Class II Brightness), and thus all of the newly designed FISH probes were found in the top two classes of the fluorescence brightness range [3]. Each of the probes was found to hybridise exclusively with the rRNA of the target phylotype/group under optimum stringency conditions. For SSHI263, MET631 and ACI862, a formamide concentration of 35% provided sufficient stringency, while the optimum formamide concentrations for the specific binding of the SOH1252 and STY1255 probes were 15% and 25%, respectively. Low levels of autofluorescence due to the presence of metal ore particles in the sample were observed, but did not interfere with the detection of cells in the samples, as these particles were jagged in appearance and of bigger size than the cells in the sample (Fig. 4). Although it is a commonly known phenomenon that can complicate FISH analysis of some archaeal species such as the Methanogens [50], cell autofluorescence did not complicate the analysis of the MTC-B sample. Initially, the MTC-B sample was probed with the archaeal domain ARC915-Cy3 probe and the bacterial domain EUBMix-FITC probe. The results confirmed that all the cells present in the sample were Archaea (Fig. 4A). Simultaneous hybridisation experiments were then carried out with the ARC915-FITC probe and each of the five specific Cy3-labelled probes. When MTC-B was probed with ARC915 and SOH1252 specific for the Sf. ohwakuensis-like organisms, the majority (73%) of cells bound both probes (Fig. 4B), indicating that Sf. ohwakuensis-like organisms were the dominant group within the MTC-B microbial community. This observation is supported by the strong TGGE band for Phylotype I that represents the Sf. ohwakuensis-like organisms and the dominance of this Phylotype in the 16S rRNA clone library [32]. Further simultaneous probing of MTC-B with ARC915 and STY1255 (Fig. 4C), ACI862 (Fig. 4D) or MET631 (Fig. 4E) was carried out and confirmed that St. azoricus, the Acidianus group (excluding A. brierleyi) and the

Metallosphaera group were each minor members of the community, making up 8%, 8% and 3%, respectively. Phylogenetic analysis of the MTC-B community [32] had shown that unlike the related MTC-A community, S. shibatae-like Phylotype III Archaea (Fig. 1) were not present in the MTC-B sample, and the TGGE results appeared to confirm this finding. To investigate this issue further, FISH analysis of MTC-B was conducted using the SSHI263 probe designed to target S. shibataelike organisms. Interestingly, S. shibatae-like cells (Fig. 4F) were detected in the sample using FISH, but were present in very low numbers (3%) similar to those seen in Fig. 4E for Metallosphaera species-like organisms. Apart from the detection of S. shibatae-like organisms in MTC-B, the overall results obtained from the FISH analysis of this sample supported and confirmed the results obtained during the TGGE analysis.

Optimisation of probe signal intensities for the MTC-B sample to enable quantitative FISH analysis Throughout the FISH analysis of the MTC-B sample, it was evident that the signal intensities observed for all probe-conferred fluorescence were low compared to those of the control cultures. This precluded the use of quantification of FISH data on the MTC-B sample, as this requires relatively high fluorescence intensities (above a threshold value of between 110 and 200% [43]) and it was attempted to increase the signal intensities of this sample. One possible reason for the low fluorescence could have been that the fixation protocol that was optimised using the pure cultures failed to render the cells in the MTC-B sample sufficiently permeable for the probes. Therefore, various pre-treatments of MTC-B samples prior to FISH analysis were investigated in an attempt to increase the permeability of the cells and thereby increase the probe signal intensities. To visualise the effects of the treatments on all cell types present, the treated samples were then probed with the FITC-labelled archaeal ARC915 probe. The results showed that the low probe signals visualised for the untreated MTC-B sample (Fig. 5A) were not improved by pre-treatment with proteinase K (Fig. 5B), or lysozyme (Fig. 5C) or a proteinase K/lysozyme solution (Fig. 5D). A fixed sample of A. brierleyi was also treated and probed during the experiment to demonstrate that the FITC-labelled ARC915 probe was not degraded as a result of the treatment and that the quality of the fluorochrome was not the cause of poor signal strength (Fig. 5E). After treatment with proteinase K the fixed sample of A. brierleyi (Fig. 5F) showed brighter probe signal intensity compared to the untreated sample (Fig. 5E),

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

509

Fig. 5. Whole cell fluorescence in situ hybridisation of the MTC-B sample and A. brierleyi probed with the ARC915-FITC-labelled probe after various treatments. (A) MTC-B sample untreated; (B) MTC-B sample treated with proteinase K prior to FISH; (C) MTC-B sample treated with lysozyme prior to FISH; (D) MTC-B sample treated with a solution of proteinase K and lysozyme prior to FISH; (E) A. brierleyi sample untreated; and (F) A. brierleyi treated with proteinase K. All images were captured with an epifluorescence microscope at 1000  magnification using the same exposure settings.

indicating that the treatment did have the potential to achieve the desired effect. Thus the low intensities of probe-conferred fluorescence for the MTC-B samples were not due to insufficient permeability of the cells in the sample. Another possible reason why the MTC-B sample possessed low probe-conferred fluorescence was that the cells present in the sample contained low levels of, or degraded, rRNA. This was thought to be a possibility as the MTC-B sample, usually maintained at 78 1C, was transported at ambient temperature (25 1C) from South Africa over the course of 7 days. To investigate this hypothesis, pure cultures of A. brierleyi and M. sedula, grown for 3 days were sampled and fixed immediately, while the remainder of each culture was left at room temperature and additional samples were fixed at 1 and 2 week intervals. From the results (data not shown), it was evident that leaving the cultures at

room temperature for these periods of time caused a striking decrease in the probe signal intensities detected for the samples. Several papers have shown that in bacterial cultures, there is a link between the growth rate/physiological state of cells, their rRNA contents and the detection of these cells using FISH [13,21,39]. Thus, it is likely that due to the MTC-B sample being shipped at ambient temperature to Australia, the cells had a low rRNA content, which resulted in low probe signal intensities and a subsequent inability to undertake quantitative FISH.

Discussion Bioleaching is a rapidly growing biotechnology for the extraction and recovery of metals from low-grade ores [40,46,47]. As the numbers and sizes of these

ARTICLE IN PRESS 510

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

bioleaching operations increase, it is desirable to develop tools for the rapid screening of the microbial populations essential for the optimum operation of such processes. This study has pioneered the use of TGGE and FISH methods to rapidly monitor the microbial communities in extreme thermophilic bioleaching processes. We chose to use these two methods in an attempt to overcome intrinsic methodological limitations such as PCR-bias, and to increase the accuracy and significance of the results obtained. Unlike Coram-Uliana et al.’s [10] study of microbial diversity in heap leaching environments, where microorganisms were removed from ore surfaces by repeated washing of samples prior to 16S rRNA gene and FISH analyses, the TGGE and FISH protocols reported here allow for the analyses of samples in their native state.

Prokaryotic biodiversity in an extreme thermophilic bioleaching reactor sample TGGE and FISH analyses of the MTC-B sample revealed low biodiversity, with all identified microorganisms grouping exclusively with Archaea belonging to the order Sulfolobales. This was in agreement with our previous findings where we investigated the archaeal diversity in two thermophilic chalcopyrite bioleaching reactor samples, MTC-A and MTC-B, using a cultureindependent molecular approach [32]. While MTC-A was dominated by a unique phylotype related to S. shibatae (69% of total clones), with remaining clones affiliated with St. azoricus (11%), Metallosphaera sp. J1 (8%), Acidianus infernus (2%) and a novel phylotype related to Sf. ohwakuensis (10%), the MTC-B sample only appeared to contain clones of four phylotypes, related to Sf. ohwakuensis (73.9%; FISH count 73%), St. azoricus (13%; FISH count 8%)), Metallosphaera sp. J1 (3.3%; FISH count 3%) and A. infernus (9.8%; FISH count 8%). Furthermore, the results from the present work were also in agreement with findings from previous studies of the microbial ecology in extremely acidic bioleaching environments by culture-independent nucleic acid methods, which revealed low biodiversity [14,16,17,23]. To date, Archaea predominantly belonging to the Sulfolobales are known to be capable of leaching mineral ores [18,37,38,45]. The fact that all five phylotypes/groups (Sf. ohwakuensis-like, St. azoricuslike, S. shibatae-like, Metallosphaera sp. J1-like and A. infernus-like) identified in our study belong to this order supports this view. TGGE profiling of 16S rRNA gene fragments of the thermoacidophilic archaeal bioleachers in MTC-B gave a reproducible TGGE fingerprint for the different Sulfolobales species in the sample. The appearance of ‘fuzzy’ TGGE bands for Phylotype II (St. azoricus-like) MTC-B clones could have been caused by the presence

of multiple melting domains within the 16S rRNA gene fragment analysed [24,31]. Such domains may have been present in the St. azoricus-like clones as indicated by the slightly wave-like appearance of the sigmoidal perpendicular TGGE profile (data not shown). To overcome this phenomenon, the size or region of the 16S rRNA gene fragment to be analysed could be changed [24,41]. While TGGE, clone library and FISH results largely complemented and supported each other, the FISH analysis showed superior sensitivity to detect a minor member of the MTC-B community, revealing that S. shibatae-like cells made up 3% of the community. Unlike FISH, the PCR-based methods TGGE and a previously constructed 16S rRNA gene clone library [31] failed to detect S. shibatae-like organisms in the MTC-B sample, probably due to the small numbers of S. shibatae-like cells. DGGE, the variation of TGGE that uses a linear chemical gradient instead of a linear temperature gradient to separate DNA fragments, is reported to not detect populations in communities whose abundance is less than 0.3–1% of the total cell count [9]. Another study that reported problems with DGGE analysis underestimating microbial diversity in a similar extreme environment included the characterisation of a thermophilic sulphur oxidizing enrichment culture (VS2) obtained from underground hot spring run-off stream sediments (pH 1.8–4.5; 60–80 1C) located at an underground mine in Japan [49]. DGGE analysis detected only one archaeal species, Thermoplasma acidophilum, although it was known from the partial 16S rRNA gene analysis of the 70 1C fraction of the enrichment culture grown in the temperature gradient incubator at a temperature range of 35–75 1C, that the culture contained S. metallicus-related archaeal organisms as well [49]. Based on our results and using the metabolic properties of their closest known phylogenetic relatives as the basis of comparison, the MTC-B sample appears to be a mixture of sulphur oxidizers (St. azoricus, S. shibatae, Metallosphaera sp. J1 and A. infernus), iron oxidizers (Metallosphaera sp. J1) and possible heterotrophs (Sf. ohwakuensis), representing the range of metabolic capabilities also found in mesophilic, moderately thermophilic and extreme thermophilic bioleaching environments [10,14,16,17,23,49]. This community structure is in agreement with the current views on bioleaching mechanisms that involve recycling of iron (III) ions and the breakdown of accumulating sulphur compounds by iron and sulphur oxidizers [48]. The presence of heterotrophic organisms has been described for mesophilic leaching environments and these organisms are thought to grow as chemolithotrophs [19,20]. To date, no published literature is available on the presence and role of heterotrophs in extreme thermophilic mineral leaching environments, although it is

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

encouraging. Perhaps the heterotrophs could be utilising the organic compounds produced by the iron and sulphur oxidizers in the bioleaching microbiota. In conclusion, the present work has demonstrated that the archaeal composition of the MTC-B bioleaching sample which we previously established using a clone library approach can be reproducibly analysed and determined with TGGE. By extending the reference cultures to include all known Sulfolobales species, TGGE analyses will prove to be a valuable tool for the elucidation of the archaeal composition of other thermophilic bioleaching and environmental communities. This study has also been the first to report the design and optimised use of five archaeal FISH probes for thermoacidophilic microorganisms of the order Sulfolobales, thereby enabling studies of the archaeal diversity present in both natural and/or commercial acidic, thermophilic metal-rich environments.

Acknowledgements This research was supported by a Strategic Partnership with Industry – Research and Training (SPIRT) Grant from the Australian Research Council (ARC) to A.G. M., L.I.S. and BHP-Billiton-Johannesburg Technology Centre. The authors wish to acknowledge the permission of BHP-Billiton to publish this paper. Drs. C. du Plessis, D. Dew and R. Muhlbauer (BHPBilliton-Johannesburg Technology Centre, Randburg, South Africa) are thanked for helpful discussions and the organisation of shipment of the samples used in this study.

[6] [7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

References [1] R. Amann, W. Ludwig, K. Schleifer, Phylogenetic identification and in situ detection of individual microbial cells without cultivation, Microbiol. Rev. 59 (1995) 143–169. [2] R.I. Amann, B.J. Binder, R.J. Olson, S.W. Chisholm, R. Devereux, D.A. Stahl, Combination of 16S rRNAtargeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations, Appl. Environ. Microbiol. 56 (1990) 1919–1925. ´ . Fonseca, [3] S. Behrens, C. Ru¨hland, J. Ina´cio, H. Huber, A I. Spencer-Martins, B. Fuchs, R.I. Amann, In situ accessibility of small-subunit rRNA of members of the domains bacteria, archaea, and eucarya to Cy3-labeled oligonucleotide probes, Appl. Environ. Microbiol. 69 (2003) 1748–1758. [4] P.L. Bond, J.F. Banfield, Design and performance of rRNA targeted oligonucleotide probes for in situ detection and phylogenetic identification of microorganisms inhabiting acid mine drainage environments, Microb. Ecol. 41 (2001) 149–161. [5] P.L. Bond, G.K. Druschel, J.F. Banfield, Comparison of acid mine drainage microbial communities in physical and

[15]

[16]

[17]

[18]

[19]

511

geochemically distinct ecosystems, Appl. Environ. Microbiol. 66 (2000) 4962–4971. K. Bosecker, Bioleaching: metal solubilization by microorganisms, FEMS Microbiol. Rev. 20 (1997) 591–604. J. Brosius, T.L. Dull, D.D. Steeter, H.F. Noller, Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli, J. Mol. Biol. 148 (1981) 107–127. N.P. Burton, P.R. Norris, Microbiology of acidic, geothermal springs of Montserrat: environmental rDNA analysis, Extremophiles 4 (2000) 315–320. E.O. Casamayor, H. Schafer, L. Baneras, C. Pedro´s-Alio´, G. Muyzer, Identification of and spatio-temporal differences between microbial assemblages from two neighboring sulfurous lakes: comparison by microscopy and denaturing gradient gel electrophoresis, Appl. Environ. Microbiol. 66 (2000) 499–508. N.J. Coram-Uliana, R.P. van Hille, W.J. Kohr, S.T.L. Harrison, Development of a method to assay the microbial population in heap bioleaching operations, Hydrometallurgy 83 (2006) 237–244. N.J. Coram, D.E. Rawlings, Molecular relationship between two groups of the genus Leptospirillum and the finding that Leptospirillum ferriphilum sp. nov. dominates South African commercial biooxidation tanks that operate at 40 1C, Appl. Environ. Microbiol. 68 (2002) 838–845. H. Daims, A. Bruhl, R.I. Amann, K.H. Schleifer, M. Wagner, The domain-specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set, Syst. Appl. Microbiol. 22 (1999) 434–444. E.F. DeLong, G.S. Wickham, N.R. Pace, Phylogenetic stains: ribosomal RNA based probes for the identification of single cells, Science 243 (1989) 1360–1363. C.S. Demergasso, P.A. Galleguillos P, L.V. Escudero G, V.J. Zepeda A, D. Castillo, E.O. Casamayor, Molecular characterisation of microbial populations in a low-grade copper ore bioleaching test heap, Hydrometallurgy 80 (2005) 241–253. K.J. Edwards, B.M. Goebel, T.M. Rodgers, M.O. Schrenk, T.M. Gihring, M.M. Cardona, B. Hu, M.M. McGuire, R.J. Hamers, N.R. Pace, J.F. Banfield, Geomicrobiology of pyrite (FeS2) dissolution: case study at Iron Mountain, California, Geomicrobiol. J. 16 (1999) 155–179. E. Gonza´lez-Toril, F. Go´mez, N. Rodrı´guez, D. Ferna´ndez-Remolar, J. Zuluaga, I. Marı´n, R. Amils, Geomicrobiology of the Tinto River, a model of interest for biohydrometallurgy, Hydrometallurgy 71 (2003) 301–309. E. Gonza´lez-Toril, E. Llobet-Brossa, E.O. Casamayor, R.I. Amann, R. Amils, Microbial ecology of an extreme acidic environment, the Tinto River, Appl. Environ. Microbiol. 69 (2003) 4853–4865. D.B. Johnson, Biodiversity and ecology of acidophilic microorganisms, FEMS Microbiol. Ecol. 27 (1998) 307–317. D.B. Johnson, K.B. Hallberg, The microbiology of acid mine waters, Res. Microbiol. 154 (2003) 466–473.

ARTICLE IN PRESS 512

D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

[20] D.B. Johnson, F.F. Roberto, Heterotrophic acidophiles and their role in bioleaching of sulfide minerals, in: D.E. Rawlings (Ed.), Biomining: Theory, Microbes and Industrial Processes, Springer and Landes Bioscience, New York, 1997, pp. 259–279. [21] L. Kerkhof, B.B. Ward, Comparison of nucleic acid hybridization and fluorometry for measurement of the relationship between RNA/DNA ratio and growth rate in a marine bacterium, Appl. Environ. Microbiol. 59 (1993) 1303–1309. [22] W.A. Kibbe, OligoCalc: an online oligonucleotide properties calculator, Nucleic Acids Res. 35 (2007) W43–W46. [23] P.H.-M. Kinnunen, J.A. Puhakka, Characterisation of iron- and sulfide mineral-oxidising moderately thermophilic acidophilic bacteria from an Indonesian autoheating copper mine waste heap and a deep South African gold mine, J. Ind. Microbiol. Biotechnol. 31 (2004) 409–414. [24] V. Kisand, J. Winker, Limited resolution of 16S rDNA DGGE caused by melting properties and closely related DNA sequences, J. Microbiol. Methods 54 (2003) 183–191. [25] S. Kleinsteuber, F.-D. Mu¨ller, A. Chatzinotas, K. WendtPotthoff, H. Harms, Diversity and in situ quantification of Acidobacteria subdivision 1 in an acid mining lake, FEMS Microbiol. Ecol. 63 (2008) 107–117. [26] A.I. Lo´pez-Archilla, E. Ge´rard, D. Moreira, P. Lo´pezGarcı´a, Macrofilamentous microbial communities in the metal-rich and acidic River Tinto, Spain, FEMS Microbiol. Lett. 235 (2004) 221–228. [27] A. Loy, R. Arnold, P. Tischler, T. Rattei, M. Wagner, M. Horn, Probecheck – a central resource for evaluating oligonucleotide probe coverage and specificity, Environ. Microbiol. 10 (2008) 2894–2898. [28] W. Ludwig, O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T. Lai, S. Steppi, G. Jobb, W. Fo¨rster, I. Brettske, S. Gerber, A. Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Ko¨nig, T. Liss, R. Lu¨ßmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N. Struckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, K.-H. Schleifer, ARB: a software environment for sequence data, Nucleic Acids Res. 32 (2004) 1363–1371. [29] K.K. Mahmoud, L.G. Leduc, Detection of Acidithiobacillus ferrooxidans in acid mine drainage environments using fluorescent in situ hybridisation (FISH), J. Microbiol. Methods 61 (2005) 33–45. [30] W. Manz, R.I. Amann, W. Ludwig, M. Wagner, K.-H. Schleifer, Phylogenetic oligonucleotide probes for the major subclasses of Proteobacteria: problems and solutions, Syst. Appl. Microbiol. 15 (1992) 593–600. [31] R. Meyers, V. Scheffield, D. Cox, Detection of single base changes in DNA: ribonuclease cleavage and denaturing gradient gel electorphoresis, in: K. Davies (Ed.), Genome Analysis. A Practical Approach, IRL Press, Oxford, 1988, pp. 95–139. [32] D. Mikkelsen, U. Kappler, A.G. McEwan, L.I. Sly, Archaeal diversity in two thermophilic chalcopyrite bioleaching reactors, Environ. Microbiol. 8 (2006) 2050–2055.

[33] A. Moter, U.B. Go¨bel, Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms, J. Microbiol. Methods 41 (2000) 85–112. [34] G. Muyzer, DGGE/TGGE a method for identifying genes from natural ecosystems, Curr. Opin. Microbiol. 2 (1999) 317–322. [35] G. Muyzer, K. Smalla, Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology, Antonie van Leeuwhoek 73 (1998) 127–141. [36] O. Nercessian, M. Prokofeva, A. Lebedinski, S. L’Haridon, C. Cary, D. Prieur, C. Jeanthon, Design of 16S rRNA-targeted oligonucleotide probes for detecting cultured and uncultured archaeal lineages in hightemperature environments, Environ. Microbiol. 6 (2004) 170–182. [37] P.R. Norris, N.P. Burton, N.A.M. Foulis, Acidophiles in bioreactor mineral processing, Extremophiles 4 (2000) 71–76. [38] P.R. Norris, D.B. Johnson, Acidophilic microorganisms, in: K. Horikoshi, W.D. Grant (Eds.), Extremophiles: Microbial Life in Extreme Environments, Wiley, New York, 1998, pp. 133–153. [39] Y. Oda, S.-J. Slagman, W.G. Meijer, L. Forney, J.C. Gottschal, Influence of growth rate and starvation on fluorescent in situ hybridization of Rhodopseudomonas palustris, FEMS Microbiol. Ecol. 32 (2000) 205–213. [40] G.J. Olson, J.A. Brierley, C.L. Brierley, Bioleaching review part B: progress in bioleaching: applications of microbial processes by the minerals industries, Appl. Microbiol. Biotechnol. 63 (2003) 249–257. [41] L. Øvrea( s, L. Forney, F.L. Daae, V. Torsvik, Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA, Appl. Environ. Microbiol. 63 (1997) 3367–3373. [42] J. Peccia, E.A. Marchand, J. Silverstein, M. Hernandez, Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium, Appl. Environ. Microbiol. 66 (2000) 3065–3072. [43] J. Pernthaler, A. Pernthaler, R.I. Amann, Automated enumeration of groups of marine picoplankton after fluorescence in situ hybridisation, Appl. Environ. Microbiol. 69 (2003) 2631–2637. [44] D. Radojkvic, J. Kusˇic, Silver staining of denaturing gradient gel electrophoresis gels, Clin. Chem. 46 (2000) 883–884. [45] D.E. Rawlings, Heavy metal mining using microbes, Annu. Rev. Microbiol. 56 (2002) 65–91. [46] D.E. Rawlings, Characteristics and adaptability of ironand sulfur- oxidizing microorganisms used for the recovery of metals from minerals and their concentrates, Microb. Cell Fact. 4 (2005) 13. [47] D.E. Rawlings, D.W. Dew, C. du Plessis, Biomineralization of metal-containing ores and concentrates, Trends Biotechnol. 21 (2003) 38–44. [48] T. Rohwerder, T. Gehrke, K. Kinzler, W. Sand, Bioleaching review part A: process in bioleaching: fundamentals and mechanisms of bacterial metal

ARTICLE IN PRESS D. Mikkelsen et al. / Systematic and Applied Microbiology 32 (2009) 501–513

sulfide oxidation, Appl. Microbiol. Biotechnol. 63 (2003) 239–248. [49] V.L.A. Salo-Zieman, T. Sivonen, J.J. Plumb, C.M. Haddad, K. Laukkanen, P.H.-M. Kinnunen, A.H. Kaksonen, P.D. Franzmann, J.A. Puhakka, Characterisation of a thermophilic sulfur oxidising enrichment culture dominated by a Sulfolobus sp. obtained from an underground hot spring for use in extreme bioleaching conditions, J. Ind. Microbiol. Biotechnol. 33 (2006) 984–994. [50] A.H. Sorensen, V.L. Torsvic, T. Torsvic, L.K. Poulsen, B.K. Ahring, Whole-cell hybridization of Methanosarcina cells with two new oligonucleotide probes, Appl. Environ. Microbiol. 63 (1997) 3043–3050.

513

[51] A. Speksnijder, G.A. Kowalchuk, S. De Jong, E. Kline, J.R. Stephen, H.J. Laanbroek, Microvariation artifacts introduced by PCR and cloning of closely related 16S rRNA gene sequences, Appl. Environ. Microbiol. 67 (2001) 469–472. [52] D.A. Stahl, R.I. Amann, Development and application of nucleic acid probes, in: E. Stackebrandt, M. Goodfellow (Eds.), Nucleic Acid Techniques in Bacterial Systematics, Wiley, Chichester, UK, 1991, pp. 205–248. [53] G.W. Tyson, I. Lo, B.J. Baker, E.E. Allen, P. Hugenholtz, J.F. Banfield, Genome-directed isolation of the key nitrogen fixer Leptospirillum ferrodiazotrophum sp. nov. from an acidophilic microbial community, Appl. Environ. Microbiol. 71 (2005) 6319–6324.