Probing the heat shock response of Corynebacterium pseudotuberculosis: The major virulence factor, phospholipase D, is downregulated at 43 °C

Research in Microbiology 158 (2007) 279e286 www.elsevier.com/locate/resmic

Probing the heat shock response of Corynebacterium pseudotuberculosis: The major virulence factor, phospholipase D, is downregulated at 43 C Sandra C. McKean a,b, John K. Davies b,c, Robert J. Moore a,b,* a

CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Geelong, Victoria 3220, Australia Bacterial Pathogenesis Research Group, Department of Microbiology, Monash University, Victoria 3800, Australia c Victorian Bioinformatics Consortium, Monash University, Victoria 3800, Australia

b

Received 20 October 2006; accepted 18 December 2006 Available online 13 January 2007

Abstract Heat shock response genes have been characterised in many organisms. Such genes are often induced not only following heat stress but also following a range of other stresses. In pathogenic bacteria, the common heat shock genes are usually induced during the initial infection process. The identification of other genes regulated during heat shock, besides the classical heat shock genes such as those of the dnaK and groEL operons, may provide information about other cellular responses such as membrane remodelling and nutrient scavenging that may be important in the early stages of infection. In this study, macroarray analysis has been used to identify a number of genes of Corynebacterium pseudotuberculosis that are either upregulated (e.g. clpB, dnaK ) or downregulated (e.g. fagC, fas) in vitro following a heat shock. The major virulence factor, phospholipase D, was found to be highly downregulated. Ó 2007 Elsevier Masson SAS. All rights reserved. Keywords: Phospholipase D; Heat shock response; Macroarray analysis; Corynebacterium pseudotuberculosis

1. Introduction Corynebacterium pseudotuberculosis is a Gram-positive, mesophilic bacterium that causes disease principally in sheep, goats and horses, although occasionally other mammalian species such as cattle and humans may be infected [1]. In sheep and goats, C. pseudotuberculosis is the aetiological agent of caseous lymphadenitis (CLA), while in horses the disease is manifested as ulcerative lymphangitis. CLA is characterised by caseous abscesses primarily in the superficial lymph nodes of infected animals. In some cases, other organs such as the lungs may also be infected [1]. Infection typically occurs via skin or mucous membrane wounds * Corresponding author. CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Geelong, Victoria 3220, Australia. Tel.: þ61 3 5227 5760; fax: þ61 3 5227 5555. E-mail address: [email protected] (R.J. Moore). 0923-2508/$ - see front matter Ó 2007 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2006.12.006

[1]. Knowledge regarding the mechanisms by which disease is then established has, in general, been based on experimental studies in which bacteria have been administered by subcutaneous inoculation. Pepin et al. [28,29] have demonstrated that experimental infection in sheep is typically associated with a transient temperature increase, localised inflammation and abscess formation at the site of infection [28]. It is likely that bacteria replicate extracellularly at the site of infection prior to lymph node localisation. Alternatively, bacteria are taken up by phagocytic cells and then actively transported to the lymph nodes. Within the lymph node, massive immune cell infiltration occurs [27]. This is followed by repetitive cycles of bacterial phagocytosis, intracellular bacterial replication and phagocytolysis which plays an essential role in the formation of abscesses that may eventually reach a diameter of 10 cm [27]. Although the gross pathogenesis of CLA is relatively well understood, little is known about how this is controlled at

280

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

the molecular level. Two genes which have been shown to be essential for establishment of CLA are fagB and pld [2,12e 14,22,37]. These code for an iron permease component and a secreted phospholipase D with sphingomyelinase activity, respectively. Studies with pld mutant strains indicate that Pld may aid in dissemination of the bacteria from the site of infection to the lymph node [13,22], while the attenuation of the fagB mutant in vivo has been suggested to be due to reduced ability of the mutant strain to obtain iron within the in vivo environment [2]. C. pseudotuberculosis strains carrying genetically attenuated mutants of the pld gene cause minimal disease and can induce strong protection against CLA, indicating the central role Pld has in the pathogenic processes [41]. It is likely that other proteins play an important role in CLA pathogenesis. For a variety of bacterial pathogens the expression of heat shock genes has been observed to be upregulated following host cell infection, for example, following infection of the human epithelial cell line McCoy A with Staphylococcus aureus [30], J774 macrophages with Salmonella [4] or Yersinia enterocolitica [43] and murine bone marrow macrophages with Mycobacterium tuberculosis [34]. That a similar response may occur during infection of the intact host is suggested by the observation that heat shock proteins are immunodominant antigens for a number of infectious organisms including M. leprae, M. tuberculosis [44], Legionella pneumophilia [15], S. aureus [31], S. typhi [42] and Leptospira [10]. Interestingly, the exact role of heat shock proteins during infection has not been clearly demonstrated. A number of studies have shown that a range of other genes are differentially regulated during heat shock. These genes include many involved in aspects of basic cellular metabolism such as protein synthesis and DNA replication as well as genes that may play more direct roles in bacterial survival in vivo, such as those encoding proteins involved in nutrient uptake and cell membrane formation [11,25]. In recent years, DNA microarray technology has become the method of choice for transcriptional profiling. DNA microarrays, which allow for the simultaneous measurement of relative gene expression under two or more sets of conditions for large numbers of genes, are, however, generally dependent on the availability of genome sequences and expensive equipment and reagents for their construction. DNA macroarrays, which contain macroscopic spots of DNA arrayed onto a nylon membrane, either robotically or by hand-held array-making devices [35], are relatively inexpensive to fabricate, are often constructed using PCR products [23] and may be analysed using the types of protocols used during northern or Southern blot analysis. Macroarrays are particularly suitable for situations in which an ordered array is not possible due to a lack of genome sequence information. A full genome sequence of C. pseudotuberculosis has not yet been produced and there are very few sequence entries in the publicly accessible databases. Without extensive sequence information it was not possible to produce a defined, non-redundant probe set for array analysis; therefore, we have produced a random clone array. In this paper, we describe the construction of a DNA macroarray using plasmids with cloned genomic DNA and

demonstrate that it is suitable for use in the identification of regulated genes of C. pseudotuberculosis. Macroarray analysis of RNA samples from heat-shocked and unshocked samples demonstrated upregulation of a number of heat shock genes, as expected. It was found that transcription of the gene for the major virulence determinant, pld, was downregulated at 43  C. 2. Materials and methods 2.1. Strains and growth conditions The wild-type C. pseudotuberculosis strain, C231 [5] was grown in brain heart infusion (BHI) broth at 37  C with shaking at 300 rpm or maintained on BHI agar. Escherichia coli XL2 Blue MRF0 (Stratagene) was used as the host for library construction. E. coli strains were grown in beaut broth (BB; 2% (w/v) tryptone, 4% (w/v) yeast extract, 0.5% (w/v) RNA (type VI from Torula Yeast, Sigma), 1% (w/v) fish sperm DNA (ICN), 0.7% (w/v) glycerol, 100 mM MOPS, 39.5 mM KNO3, 30 mM glucose, 10 mg ml1 RNaseA (Sigma)) or maintained on Luria Bertani agar [33]. Ampicillin (100 mg ml1), X-Gal (10 mM) or IPTG (50 mg ml1) was added to the media as required. For heat shock experiments exponentially growing cultures were split into two, one being placed at 37  C and the other transferred to 43  C and incubated for 30 min. 2.2. Construction of the C. pseudotuberculosis macroarray Genomic DNA was isolated from C231 as previously described [45]. DNA (200 ng ml1) was randomly fragmented by sonication. DNA ends were repaired by treatment with mung bean nuclease (Promega) and fragments in the size range of 0.7 to 1.4 kb were size-selected on an agarose gel. Purified DNA fragments were ligated into SmaI-digested pUC18 treated with bacterial alkaline phosphatase (Amersham) and then transformed into E. coli XL2-Blue MRF0 ultracompetent cells (Stratagene) and plated onto IPTG/X-Gal indicator plates. White colonies were picked from the library plates into round-bottomed 96-well plates containing 100 ml BB. After incubation at 37  C for 24 h these cultures were used to inoculate 96 deep-well plates (2.2 ml, Advanced Biotechnologies) containing 1.2 ml BB and one soda lime glass ball (3 mm) per well. The deep-well plates were covered with an AirPoreÔ tape (Qiagen) and incubated at 37  C for 24 h with vigorous shaking (300 rpm). To extract DNA from the cultures the bacteria were first pelleted by centrifugation (1250  g, 5 min), washed with 0.5 ml 0.5 M NaCl, then subjected to an alkaline lysis protocol adapted to the 96-well plate format. Bacterial pellets were resuspended in 0.3 ml Solution I (TE pH 8 supplemented with 50 mg ml1 RNaseA). To lyse the bacteria 0.3 ml of Solution II (0.2 M NaOH, 1% (w/v) SDS) was added to each well. Plates were inverted several times to mix. Following 10 min

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

at room temperature, 0.3 ml of Solution III (3 M potassium acetate, pH 4.8) was added to each well and the plate contents mixed by vigorous shaking of the plate. Following incubation at 20  C for 20 min the plates were centrifuged. The supernatant was then filtered through a filtration plate (96-well plate with a 2 mm hole in the bottom of each well and a 1.5 cm2 piece of gauze wedged into each well) into a clean 96-deepwell plate. 650 ml propan-2-ol was added to each well of the plate. Following mixing and subsequent centrifugation, the pelleted DNA was washed with 70% (v/v) ethanol and then resuspended in 100 ml TE containing 125 U ml1 RNase T1 (Life Technologies). Following transfer of the resuspended DNA to shallow round-bottomed 96-well plates the samples were stored at 4  C. For macroarray printing DNA samples were diluted 30-fold in 0.4 M NaOH and consolidated into a 384-well plate format. The macroarray was printed on Hybond Nþ (Amersham) using a 384-well solid pin Multi-blotÔ replicator (V&P Scientific). Each array clone was arrayed in duplicate such that the 1536 clones were represented within two 7  11 cm membranes. The DNA was fixed to the membrane by a 2 min incubation of the membrane on Whatmann 3MM Chr paper that had been pre-wetted with 0.4 M NaOH/3 M NaCl. The membrane was then washed in 2 SSC for 5 min. 2.3. RNA extraction Bacterial RNA was extracted using RNAzolÔ (Tel-Test) as recommended by the supplier with minor modifications. Bacterial pellets containing approximately 109 cells were resuspended in 1 ml RNAzol and transferred to a 2 ml screw-cap tube containing 1 ml of 0.1 mm diameter glass beads (Daintree Scientific). The sample was homogenised in a Mini-BeadBeater-8 (Biospec Products) at maximum speed for 3 min. RNA isolation from the homogenate was then performed exactly as per the RNAzol B protocol. RNA was resuspended in DEPC-treated water and then treated with RNase-free DNaseI (DNA-freeÔ, Ambion) to remove trace DNA contamination. 2.4. DIG-labelled RNA preparation and probing of macroarray

281

CDP-Star (Roche) as the alkaline phosphatase substrate, as per the manufacturer’s instructions. Developed blots were exposed to Lumi-Film chemiluminescent detection film (Roche). 2.5. Reverse transcription Reverse transcription was performed using a TaqMan reverse transcription reagents kit (Applied Biosystems). 1 mg of DNase-I-treated RNA was reverse-transcribed in a 50 ml reaction containing 1 RT buffer (Applied Biosystems), 5.5 mM MgCl2, 445 mM dNTPs, 2.5 mM random hexamers, 20 U RNase inhibitor and 75 U Multiscribe reverse transcriptase. The reaction was incubated for 10 min at 25  C, 45 min at 48  C and 5 min at 95  C. For each RNA sample an identical control reaction was performed without Multiscribe reverse transcriptase. cDNA was diluted 1 in 10 with water prior to use in PCR reactions. 2.6. Quantitative PCR Quantitative PCR reactions of 50 ml were performed in a 96-well plate format in an ABI PRISMÒ 7700 sequence detector under universal cycling conditions (2 min at 50  C, followed by 10 min at 95  C to activate the DNA polymerase, followed by 40 cycles of 15 s at 95  C and 1 min at 60  C). Primers for quantitative PCR were designed using Primer ExpressÒ v1.5 software (Applied Biosystems, Table 1). PCR reactions contained 1 SYBR green master mix (Applied Biosystems), 50 nM of forward and reverse primers and 10 ml of diluted cDNA and were set up in triplicate. Two negative controls were routinely performed. DNA contamination was determined by performing the PCR on negative control RT reactions (in which no enzyme had been added to the reverse transcription reaction). Environmental contamination was monitored in no template controls in which water was added to the reaction instead of DNA. Data were analysed using Sequence Detector v1.7 software (Applied Biosystems). The relative amount of target mRNA was calculated using the comparative CT method (Applied Biosystems User Bulletin #2), with 16S rRNA values being used to correct for differences in the amount of RNA in each RT reaction. 3. Results

Total RNA was labelled with digoxigenin (DIG) using the Roche DIG-Chem Link labelling and detection kit as per the manufacturer’s instructions. One microlitre of DIG-Chem link was used per microgram of RNA. Prior to hybridisation probes were denatured by incubation at 100  C for 5 min. Membranes were pre-hybridised in Ultrahyb (Ambion) for 1 h at 42  C in a rotary hybridisation oven. Denatured probe was added directly to the pre-hybridisation solution and the hybridisation reaction allowed to proceed overnight at 50  C. Following removal of the hybridisation solution, membranes were washed in 2 SSC/0.1% (w/v) SDS at room temperature (2  5 min), then in 0.1 SSC/0.1% (w/v) SDS at 68  C (2  15 min). The bound DIG-labelled probe was detected using the DIG-Chem Link Labelling and Detection set, with

3.1. Construction of a C. pseudotuberculosis macroarray For organisms in which the genome sequence is available, it is possible to construct a DNA array in which each gene is uniquely represented. Relatively few genes of C. pseudotuberculosis have been sequenced, thus precluding this approach. Instead, a random library was generated and plasmid DNA used to construct the array. C. pseudotuberculosis DNA fragments of 0.7e1.4 kb were generated by sonication, then ligated into pUC18. A library of 4000 clones, each with an average insert size of 1.3 kb, resulted. DNA was extracted from 1536 library colonies then arrayed in duplicate onto positively charged nylon membrane to generate the macroarray.

282

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

Table 1 Real-time PCR primers used in this study Gene

Forward primer sequence (50 /30 )

Reverse primer sequence (50 /30 )

Clonea

pld 16s rRNA dnaK aspartokinase Hypothetical protein (Rv0433 homologue) Hypothetical metabolite transport protein fagC fas clpB dnaJ hspR

gattgcccaccgcgttt cctgtataagaagcaccggctaa cccgctgttcttggatgaga agaacgtgctttacgacgat aactgagcgtcgcgcttt gggcactcggctggatt

tcgcaccgatcgcaact acgctcgcaccctacgtatt tcaagcagatcctgggtga ctgggtgcgatttcatacc catactttgagccccaattcct tggcggaaccactaattacaaag

L16587 X84255 Q4-E5 Q4-E5 Q7-B6 Q7-D6

cacaaacgcgtgaccgatt cggcggacgtagatctgtct gcatcatggtgtgcgtattca tgatgagttcaaggccatgatc cccgctcggacgtagaacta

agaaccattgcaagccatacg cgaatgggcgggctactag cgtgatatagcgatccgagaga cgcctccgttctgtccaa ccaggttaacgccttcttcttg

AF401634 Q4-A3 Q7-C2 Q12-C5 Q12-C5

a

Primer pairs were designed on the basis of the sequence found in the listed clone. Alternatively, an accession number is listed for those genes whose sequences are in the NCBI databases.

The size of the C. pseudotuberculosis genome is not known; however, other corynebacterial species have genome sizes of 2.5e3.3 Mb [6,8,16]. Assuming that C. pseudotuberculosis has a genome of approximately 3.1 Mb then the macroarray is expected to provide 0.67-fold coverage of the genome. 3.2. Identification of clones carrying genes regulated during heat shock In C. pseudotuberculosis expression of the heat shock gene dnaK is induced following a 6  C temperature increase from 37  C to 43  C [21]. Expression of dnaK is maximal at 30 min following initiation of the shock. We therefore chose to use the C. pseudotuberculosis macroarray to identify other genes that showed differences in the transcript level after the same period of temperature shock. Replica macroarrays were hybridised with RNA from bacteria grown continuously at 37  C or grown at 37  C then incubated at 43  C for 30 min. Following exposure of the probed arrays to film, positive clones could be detected (Fig. 1). Fifteen spots were identified whose spot intensity differed greatly between the replica arrays. The inserts of these clones were sequenced and then analysed by BLASTX to assign putative function (Table 2). Of the eight clones that were strongly upregulated at 43  C, seven contained sequence that showed identity to proteins that have been classified as heat shock proteins in other bacterial species. Clones Q1-F11, Q4-E9, Q5-E10 and Q11-G7 each contained sequence with identity to dnaK, clone Q16-G1 contained sequence with identity to dnaJ and Q12-C5 contained sequence with identity to both dnaJ and hspR, while clone Q7-C2 contained sequence with identity to clpB. Seven clones were identified that showed reduced spot intensity with heat shock. Two clones contained a sequence coding for pld and fagC (Q3-B2 and Q2-G12) and two clones coded for a fatty acid synthase ( fas) (Q4-A3, Q11-G1). Although dnaK, dnaJ, pld and fagC were each identified on more than one clone, sequence analysis indicated that each clone was unique. Several clones were found to contain

concatameric sequences as indicated by incomplete open reading frames and abrupt changes in sequence identity (for example Q3-B2). 3.3. Confirmation of macroarray data with quantitative RTePCR Quantitative RTePCR was used to confirm the heat regulation of a number of genes. The selected genes were chosen because they had been shown to be heat shock genes in other bacterial species, virulence determinants for C. pseudotuberculosis, or involved in other metabolic activities. Using 37°C

43°C

Q3-B2 Q4-C2 Q3-C1 Q7-C2

Q4-A3

Q5-E10

Q1-F11

Fig. 1. Macroarrays probed with RNA derived from C. pseudotuberculosis incubated at 37  C or 43  C. Cells were grown continuously at 37  C or at 37  C, then heat-shocked for 30 min at 43  C. RNA was extracted from the cells, labelled with DIG and then used to probe replica macroarrays. Duplicate spots are side-by-side. Bound probe was detected using an anti-DIG AP conjugate and the AP substrate CDP Star. Examples of some of the selected clones are identified. Differences in spot intensity between the two different conditions are highlighted.

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

283

Table 2 Sequence analysis of clones from the pUC18-Q library that were regulated by heat shock Clone

Regulationa

Insert size (kb)

Species and % identityb

Gene homologyb

Q1-F11 Q2-G12

Up Down

0.8 1.9

Mycobacterium paratuberculosis, 85% Yersinia enterocolitica, 55%

Q3-B2

Down

2.2

C. pseudotuberculosis, 100% C. pseudotuberculosis, 100% E. coli, 44%

dnaK fagC (iron permease component) pld pld fagC (iron permease component)

Q4-A3

Down

1.2

Corynebacterium ammoniagenes, 71%

Q4-C2

Down

1.0

Q4-E9

Up

1.2

Q5-E10 Q7-C2 Q7-B6

Up Up Down

0.9 1.3 2.2

Q7-D6

Up

2.2

Corynebacterium. glutamicum, 81% C. glutamicum, 72% M. paratuberculosis, 79% Corynebacterium flavescens, 78% M. paratuberculosis, 84% C. glutamicum, 76% Mycobacterium tuberculosis, 41% M. tuberculosis, 41% Bacillus. subtilis, 50%

Q11-G1

Down

0.9

C. ammoniagenes, 68%

Q11-G7 Q12-C5

Up Up

1.1 1.5

Q13-G5

Down

0.6

M. paratuberculosis, 75% M. tuberculosis, 51% M. tuberculosis, 57% S. coelicolor, 43%

Q16-G1

Up

2.0

S. coelicolor, 43%

fas (fatty acid synthase) Cytochrome c1 Rieske ironesulfur protein dnaK Aspartokinase dnaK clpB serB2 (phosphoserine phosphatase) Hypothetical 42.3 kDa protein Rv0433 Hypothetical metabolite transport protein fas (fatty acid synthase) dnaK dnaJ hspR Probable substrate binding protein dnaJ

a

Regulation refers to whether clones were identified as up- or downregulated following heat shock compared to growth at 37  C. Sequences were scanned against the NCBI protein databases for protein homologies in all six reading frames using a translating BLAST program (BLASTX). Proteins or their encoding genes that showed the highest identity and the species in which this occurred are listed. b

independently prepared RNA (from a different heat shock experiment) the four heat shock genes were each shown to be induced 13-45-fold following heat shock at 43 C for 30 min (Table 3). pld, fagC and fas were each strongly downregulated (25-, 9- and 17-fold respectively, Table 3). The remaining genes demonstrated only a small degree of regulation. 4. Discussion In this study we have demonstrated that genes of C. pseudotuberculosis, regulated by a specific condition, can be identified without comprehensive genome data using inexpensive DNA macroarray technology. In particular, this approach identified pld, the major virulence factor of C. pseudotuberculosis, as being highly thermoregulated, an observation not previously made. The role of heat shock proteins during thermal stress is well understood and primarily involves the prevention or reversal of heat-induced protein denaturation and aggregation that may be lethal to the cell [19]. All but one of the genes identified as being upregulated belonged to the heat shock gene family. dnaK, dnaJ and hspR form part of the dnaK operon. In other closely related bacterial species the gene grpE is also found in this operon such that the gene order is dnaK, grpE, dnaJ and hspR [7,36]. By sequencing across the dnaKednaJ region we were able to demonstrate that grpE was also located between

these genes in C. pseudotuberculosis (data not shown). The first three genes of the operon code for proteins with chaperone function, while the last, hspR is a regulatory protein [39]. The fourth heat shock gene identified was clpB which also has a chaperonin function. The majority of other thermoregulated genes were downregulated by heat shock at 43  C. The three most strongly downregulated genes were pld, an iron permease component ( fagC ) and a fatty acid synthase ( fas). Corynebacteria possess a complex cell wall structure, part of which requires synthesis of fatty acids for its maintenance. Most bacteria have only one fatty acid synthase (FAS); however, some Gram-positive bacteria have at least two. The FAS identified in this study shows identity to type I FAS (FAS-I), which is a multidomain enzyme that encodes all the activities required for fatty acid biosynthesis on a single large polypeptide. Studies of the closely related Brevibacterium ammoniagenes and C. glutamicum have indicated that these species contain two FAS-I genes, which have been termed fasA and fasB [32,40]. In C. glutamicum the fasA gene is essential; however, fasB can be knocked out with little effect. Other related bacteria such as C. diphtheria and M. tuberculosis have single FAS-I genes. The C. pseudotuberculosis FAS identified shows greater identity to FasB than FasA (71% identity compared to 54% identity). Whether C. pseudotuberculosis contains more than one FAS remains to be determined.

284

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

Table 3 Induction of genes following heat shock Gene

Clone

Fold inductiona

clpB dnaJ hspR dnaK Aspartokinase Hypothetical protein (Rv0433 homologue) Rieske iron-sulfur protein Cytochrome c1 Hypothetical metabolite transport protein fagC (iron permease component) fas (fatty acid synthase) pld

Q7-C2 Q12-C5, Q12-G1 Q12-C5 Q1-F11, Q4-E9, Q5-E10, Q11-G7 Q4-E9 Q7-B6 Q4-C2 Q4-C2 Q7-D6

45.73 22.16 17.51 12.92 1.73 0.68 0.61 0.53 0.44

Q2-G12, Q3-B2

0.11

Q4-A3, Q11-G1

0.06

Q2-G12, Q3-B2

0.04

a

Fold induction was determined on RNA samples prepared in an analogous manner to those used to probe the macroarray and was determined by RTereal-time PCR.

Modulation of membrane composition in response to temperature is a common theme for all organisms, allowing the maintenance of membrane fluidity [20] and biochemical activity within the bilayer [18]. It is therefore likely that the observed change in gene expression of C. pseudotuberculosis fas occurs to mediate this type of response. Additionally, the expression of genes involved in fatty acid biosynthesis has been observed to decrease in response to reduced cell growth rate [20,24], presumably as a mechanism of ensuring that an appropriate amount of fatty acid is produced. Given that the growth rate of C. pseudotuberculosis is reduced at 43  C compared to 37  C (data not shown), the reduced expression of fas could also be growth-rate-related. fagC, which is located immediately downstream of the pld gene but on the complementary strand, is part of the fagBCD operon coding for the components of a putative iron uptake system [2]. Expression of proteins involved in iron acquisition is often tightly regulated such that they are only expressed in low iron concentration environments. Typically, this involves negative regulation by the iron-regulatory proteins Fur or DtxR [3] and as such the upstream region of the fagBCD operon contains a DtxR consensus sequence. Regulation by other mechanisms is much less common; however, there are examples of thermal regulation of iron transport and homeostasis genes. These include a four gene operon of Group A Streptococcus which codes for the components of a ferrichrome transport system that is upregulated at 40  C and 29  C compared to 37  C [38] and several genes involved in iron transport and storage in Yersinia pestis [17]. Both of these pathogens are exposed to a range of temperatures during their infection cycle. It has been suggested that at the more extreme temperatures the availability of iron is less, hence repression of expression is removed. It is unlikely that C. pseudotuberculosis is exposed to long periods of thermal stress during its infection cycle. Firstly, the route of infection is typically from the contaminated aerosols of one animal to the skin of a second [9,26]

and secondly, although experimental infections are associated with a transient increase in temperature, this is not maintained for more than a few days [28]. Given this, the biological implications of downregulation of an iron siderophore system during heat shock are not clear. Within its infection cycle, C. pseudotuberculosis is resident within a number of different locations. The external environment, blood, lymph nodes and intracellular environment of macrophages will each require adaptations from the bacteria to allow survival and the scavenging of nutrients required for viability and replication. To respond to such changes pathogenic bacteria have typically evolved regulatory systems to control gene expression in response to the external environment, thus leading to appropriate adaptation to it. Empirical evidence shows that for many bacterial pathogens, the expression of those genes that play a direct role in bacterial survival within the host is often tightly regulated, such that their expression is timed with certain aspects of infection. Although clearly required for establishment of CLA and hence expressed in vivo, it is not known whether Pld is essential during all stages of the disease process. The observation that Pld is thermoregulated raises the possibility that in vivo regulation may occur. It is not known whether naturally infected animals demonstrate an increased temperature following infection with C. pseudotuberculosis; however, experimentally infected sheep experience a transient temperature increase on the first day post-infection [28]. It has also been postulated that in the early stages of infection C. pseudotuberculosis replicates extracellularly [1]. It could be envisioned that pld expression may not occur during the early stages of infection as a result of low extracellular bacterial density and repression of pld expression by heat shock. This may be a way for the pathogen to replicate without causing excessive tissue damage that would result in the recruitment of immune cells before a sufficient number of bacteria were present to mount a successful infection.

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

Using simple methodologies, we have demonstrated that it is possible to perform broad transcriptional profiling on an unsequenced bacterial pathogen and identify genes involved in key aspects of pathogenesis. The novel finding that the major virulence factor, Pld, is strongly regulated warrants further study to elucidate the importance of this regulation for the pathogenic processes involved in the formation of caseous lymphadenopathy by C. pseudotuberculosis. References [1] R.G. Batey, Pathogenesis of caseous lymphadenitis in sheep and goats, Aust. Vet. J. 63 (1986) 269e272. [2] S.J. Billington, P.A. Esmay, J.G. Songer, B.H. Jost, Identification and role in virulence of putative iron acquisition genes from Corynebacterium pseudotuberculosis, FEMS Microbiol. Lett. 208 (2002) 41e45. [3] V. Braun, H. Killmann, Bacterial solutions to the iron-supply problem, Trends Biochem. Sci. 24 (1999) 104e109. [4] N.A. Buchmeier, F. Heffron, Induction of Salmonella stress proteins upon infection of macrophages, Science 248 (1990) 730e732. [5] D.H. Burrell, Experimental induction of caseous lymphadenitis in sheep by intralymphatic inoculation of Corynebacterium ovis, Res. Vet. Sci. 24 (1978) 269e276. [6] A.M. Cerdeno-Tarraga, A. Efstratiou, L.G. Dover, M.T. Holden, M. Pallen, S.D. Bentley, G.S. Besra, C. Churcher, K.D. James, A. De Zoysa, T. Chillingworth, A. Cronin, L. Dowd, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Moule, M.A. Quail, E. Rabbinowitsch, K.M. Rutherford, N.R. Thomson, L. Unwin, S. Whitehead, B.G. Barrell, J. Parkhill, The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129, Nucleic Acids Res. 31 (2003) 6516e6523. [7] S.T. Cole, R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S.V. Gordon, K. Eiglmeier, S. Gas, C.E. Barry 3rd, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M.A. Quail, M.A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J.E. Sulston, K. Taylor, S. Whitehead, B.G. Barrell, Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence, Nature 393 (1998) 537e544. [8] A. Correia, J.F. Martin, J.M. Castro, Pulsed-field gel electrophoresis analysis of the genome of amino acid producing corynebacteria: chromosome sizes and diversity of restriction patterns, Microbiology 140 (1994) 2841e2847. [9] T.M. Ellis, S.S. Sutherland, F.C. Wilkinson, A.R. Mercy, M.W. Paton, The role of Corynebacterium pseudotuberculosis lung lesions in the transmission of this bacterium to other sheep, Aust. Vet. J. 64 (1987) 261e263. [10] H. Guerreiro, J. Croda, B. Flannery, M. Mazel, J. Matsunaga, M. Galvao Reis, P.N. Levett, A.I. Ko, D.A. Haake, Leptospiral proteins recognized during the humoral immune response to leptospirosis in humans, Infect. Immun. 69 (2001) 4958e4968. [11] Y. Han, D. Zhou, X. Pang, L. Zhang, Y. Song, Z. Tong, J. Bao, E. Dai, J. Wang, Z. Guo, J. Zhai, Z. Du, X. Wang, J. Wang, P. Huang, R. Yang, DNA microarray analysis of the heat- and cold-shock stimulons in Yersinia pestis, Microbes Infect 7 (2005) 335e348. [12] A.L. Hodgson, K. Carter, M. Tachedjian, J. Krywult, L.A. Corner, M. McColl, A. Cameron, Efficacy of an ovine caseous lymphadenitis vaccine formulated using a genetically inactive form of the Corynebacterium pseudotuberculosis phospholipase D. Vaccine 17 (1999) 802e808. [13] A.L. Hodgson, J. Krywult, L.A. Corner, J.S. Rothel, A.J. Radford, Rational attenuation of Corynebacterium pseudotuberculosis: potential cheesy gland vaccine and live delivery vehicle, Infect. Immun. 60 (1992) 2900e 2905.

285

[14] A.L. Hodgson, M. Tachedjian, L.A. Corner, A.J. Radford, Protection of sheep against caseous lymphadenitis by use of a single oral dose of live recombinant Corynebacterium pseudotuberculosis, Infect. Immun. 62 (1994) 5275e8520. [15] P.S. Hoffman, C.A. Butler, F.D. Quinn, Cloning and temperature-dependent expression in Escherichia coli of a Legionella pneumophila gene coding for a genus-common 60-kilodalton antigen, Infect. Immun. 57 (1989) 1731e1739. [16] J. Kalinowski, B. Bathe, D. Bartels, N. Bischoff, M. Bott, A. Burkovski, N. Dusch, L. Eggeling, B.J. Eikmanns, L. Gaigalat, A. Goesmann, M. Hartmann, K. Huthmacher, R. Kramer, B. Linke, A.C. McHardy, F. Meyer, B. Mockel, W. Pfefferle, A. Puhler, D.A. Rey, C. Ruckert, O. Rupp, H. Sahm, V.F. Wendisch, I. Wiegrabe, A. Tauch, The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of L-aspartate-derived amino acids and vitamins, J. Biotechnol. 104 (2003) 5e25. [17] M.E. Konkel, K. Tilly, Temperature-regulated expression of bacterial virulence genes, Microbes Infect. 2 (2000) 157e166. [18] L. Kremer, A.R. Baulard, G.S. Besra, Molecular Genetics of Mycobacteria, ASM Press, USA, 2000 173e190. [19] P.A. Lund, Microbial molecular chaperones, Adv. Microb. Physiol. 44 (2001) 93e140. [20] K. Magnuson, S. Jackowski, C.O. Rock, J.E. Cronan Jr., Regulation of fatty acid biosynthesis in Escherichia coli, Microbiol. Rev. 57 (1993) 522e542. [21] S. McKean, J. Davies, R. Moore, Identification of macrophage induced genes of Corynebacterium pseudotuberculosis by differential fluorescence induction, Microbes Infect. 7 (2005) 1352e1363. [22] P.J. McNamara, G.A. Bradley, J.G. Songer, Targeted mutagenesis of the phospholipase D gene results in decreased virulence of Corynebacterium pseudotuberculosis, Mol. Microbiol. 12 (1994) 921e930. [23] A. Muffler, S. Bettermann, M. Haushalter, A. Horlein, U. Neveling, M. Schramm, O. Sorgenfrei, Genome-wide transcription profiling of Corynebacterium glutamicum after heat shock and during growth on acetate and glucose, J. Biotechnol. 98 (2002) 255e268. [24] Y. Oh-Hashi, A. Kawaguchi, Y. Seyama, H. Okuyama, Temperature- and growth-phase-dependent changes in membrane fatty acid compositions of Brevibacterium ammoniagenes, Arch. Biochem. Biophys. 248 (1986) 440e443. [25] C. Ojaimi, C. Brooks, S. Casjens, P. Rosa, A. Elias, A. Barbour, A. Jasinskas, J. Benach, L. Katona, J. Radolf, M. Caimano, J. Skare, K. Swingle, D. Akins, I. Schwartz, Profiling of temperature-induced changes in Borrelia burgdorferi gene expression by using whole genome arrays, Infect. Immun. 71 (2003) 1689e1705. [26] M.W. Paton, S.S. Sutherland, I.R. Rose, R.A. Hart, A.R. Mercy, T.M. Ellis, The spread of Corynebacterium pseudotuberculosis infection to unvaccinated and vaccinated sheep, Aust. Vet. J. 72 (1995) 266e269. [27] M. Pepin, J.J. Fontaine, P. Pardon, J. Marly, A.L. Parodi, Histopathology of the early phase during experimental Corynebacterium pseudotuberculosis infection in lambs, Vet. Microbiol. 29 (1991) 123e134. [28] M. Pepin, P. Pardon, F. Lantier, J. Marly, D. Levieux, M. Lamand, Experimental Corynebacterium pseudotuberculosis infection in lambs: kinetics of bacterial dissemination and inflammation, Vet. Microbiol. 26 (1991) 381e392. [29] M. Pepin, J.C. Pittet, M. Olivier, I. Gohin, Cellular composition of Corynebacterium pseudotuberculosis pyogranulomas in sheep, J. Leukoc. Biol. 56 (1994) 666e670. [30] M.W. Qoronfleh, C.A. Bortner, P. Schwartzberg, B.J. Wilkinson, Enhanced levels of Staphylococcus aureus stress protein GroEL and DnaK homologs early in infection of human epithelial cells, Infect. Immun. 66 (1998) 3024e3027. [31] M.W. Qoronfleh, W. Weraarchakul, B.J. Wilkinson, Antibodies to a range of Staphylococcus aureus and Escherichia coli heat shock proteins in sera from patients with S. aureus endocarditis, Infect. Immun. 61 (1993) 1567e1570.

286

S.C. McKean et al. / Research in Microbiology 158 (2007) 279e286

[32] E. Radmacher, L.J. Alderwick, G.S. Besra, A.K. Brown, K.J. Gibson, H. Sahm, L. Eggeling, Two functional FAS-I type fatty acid synthases in Corynebacterium glutamicum, Microbiology 151 (2005) 2421e 2427. [33] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 1989. [34] D. Schnappinger, S. Ehrt, M.I. Voskuil, Y. Liu, J.A. Mangan, I.M. Monahan, G. Dolganov, B. Efron, P.D. Butcher, C. Nathan, G.K. Schoolnik, Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment, J. Exp. Med. 198 (2003) 693e704. [35] M. Schummer, W. Ng, P.S. Nelson, R.E. Bumgarner, L. Hood, Inexpensive handheld device for the construction of high-density nucleic acid arrays, Biotechniques 23 (1997) 1087e1092. [36] P. Servant, P. Mazodier, Negative regulation of the heat shock response in Streptomyces, Arch. Microbiol. 176 (2001) 237e242. [37] C.P. Simmons, S.J. Dunstan, M. Tachedjian, J. Krywult, A.L. Hodgson, R.A. Strugnell, Vaccine potential of attenuated mutants of Corynebacterium pseudotuberculosis in sheep, Infect. Immun. 66 (1998) 474e479. [38] L.M. Smoot, J.C. Smoot, M.R. Graham, G.A. Somerville, D.E. Sturdevant, C.A. Migliaccio, G.L. Sylva, J.M. Musser, Global differential gene expression in response to growth temperature alteration in group A Streptococcus, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 10416e10421.

[39] G.R. Stewart, V.A. Snewin, G. Walzl, T. Hussell, P. Tormay, P. O’Gaora, M. Goyal, J. Betts, I.N. Brown, D.B. Young, Overexpression of heatshock proteins reduces survival of Mycobacterium tuberculosis in the chronic phase of infection, Nat. Med. 7 (2001) 732e737. [40] H.P. Stuible, C. Wagner, I. Andreou, G. Huter, J. Haselmann, E. Schweizer, Identification and functional differentiation of two type I fatty acid synthases in Brevibacterium ammoniagenes, J. Bacteriol. 178 (1996) 4787e4793. [41] M. Tachedjian, J. Krywult, R.J. Moore, A.L. Hodgson, Caseous lymphadenitis vaccine development: site-specific inactivation of the Corynebacterium pseudotuberculosis phospholipase D gene, Vaccine 13 (1995) 1785e1792. [42] S.W. Tang, S. Abubakar, S. Devi, S. Puthucheary, T. Pang, Induction and characterization of heat shock proteins of Salmonella typhi and their reactivity with sera from patients with typhoid fever, Infect. Immun. 65 (1997) 2983e2986. [43] T. Yamamoto, T. Hanawa, S. Ogata, Induction of Yersinia enterocolitica stress proteins by phagocytosis with macrophage, Microbiol. Immunol. 38 (1994) 295e300. [44] D. Young, R. Lathigra, R. Hendrix, D. Sweetser, R.A. Young, Stress proteins are immune targets in leprosy and tuberculosis, Proc. Natl. Acad. Sci. USA. 85 (1988) 4267e4270. [45] Y. Zhang, J. Praszkier, A. Hodgson, A.J. Pittard, Molecular analysis and characterization of a broad-host-range plasmid, pEP2, J. Bacteriol. 176 (1994) 5718e5728.