Process of reductive evolution during 10 years in plasmids of a non-insect-transmissible phytoplasma

Gene 446 (2009) 51–57

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e

Process of reductive evolution during 10 years in plasmids of a non-insect-transmissible phytoplasma Yoshiko Ishii a, Kenro Oshima b, Shigeyuki Kakizawa a, Ayaka Hoshi a, Kensaku Maejima a, Satoshi Kagiwada c, Yasuyuki Yamaji a, Shigetou Namba a,b,⁎ a

Laboratory of Plant Pathology, Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan Laboratory of Clinical Plant Science, Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan c Department of Clinical Plant Science, Faculty of Bioscience and Applied Chemistry, Hosei University, 3-7-2 Kajinocho, Koganei Tokyo, 184-8584, Japan b

a r t i c l e

i n f o

Article history: Received 8 May 2009 Received in revised form 1 July 2009 Accepted 14 July 2009 Available online 22 July 2009 Received by R. Britton Keywords: Phytoplasma Plasmid Reductive evolution Environmental adaptation

a b s t r a c t A non-insect-transmissible phytoplasma strain (OY-NIM) was obtained from insect-transmissible strain OYM by plant grafting using no insect vectors. In this study, we analyzed for the gene structure of plasmids during its maintenance in plant tissue culture for 10 years. OY-M strain has one plasmid encoding orf3 gene which is thought to be involved in insect transmissibility. The gradual loss of OY-NIM plasmid sequence was observed in subsequent steps: first, the promoter region of orf3 was lost, followed by the loss of then a large region including orf3, and finally the entire plasmid was disappeared. In contrast, no mutation was found in a pseudogene on OY-NIM chromosome in the same period, indicating that OY-NIM plasmid evolved more rapidly than the chromosome-encoded gene tested. Results revealed an actual evolutionary process of OY plasmid, and provide a model for the stepwise process in reductive evolution of plasmids by environmental adaptation. Furthermore, this study indicates the great plasticity of plasmids throughout the evolution of phytoplasma. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Plasmid is an element that is capable of autonomous replication independent of chromosomal DNA inside bacterial cell (Thomas, 2004). Plasmids typically encode non-essential genes but are often important for the growth of their host bacteria. Common examples of this are genes related to antibiotic resistance or genes related to the synthesis of antimicrobial agents (Panopoulos and Peet, 1985; Vivian et al., 2001). In phytopathogenic bacteria, plasmids often encode genes related to pathogenicity or insect transmissibility, and play important roles in the spread of the bacteria (Berho et al., 2006a,b; Killiny et al., 2006; Panopoulos and Peet, 1985; Vivian et al., 2001). Plasmids typically evolve more rapidly in response to environmental changes than the chromosomal DNA (Eberhard, 1990; Sundin, 2007). Most bacteria adapt to environmental changes through the gain and loss of functions that are encoded on plasmids (Sundin, 2007).

Abbreviations: AY-WB, aster yellows phytoplasma strain of witches' broom; Ca., Candidatus; OY, onion yellows phytoplasma; OY-M, mildly pathogenic line of OY; OYNIM, non-insect-transmissible line of OY; rep, replication initiation genes. ⁎ Corresponding author. Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan. Tel.: +81 3 5841 5053; fax: +81 3 5841 5090. E-mail address: [email protected] (S. Namba). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.07.010

Phytoplasmas are phytopathogenic bacteria that cause diseases in many plants, which results in drastic declines in agricultural productivity (Lee et al., 2000). These pathogens inhabit phloem sieve elements in infected plants, and are transmitted by sap-sucking insect vectors, leading to the expansion of the disease (Hogenhout et al., 2008; Lee and Davis, 1992). ‘Candidatus (Ca.) Phytoplasma asteris’, OY strain (OY), is a common causal agent of onion yellows. The complete 860 kb genome sequence of a mild-symptom strain of OY (OY-M) has been assembled and annotated (Oshima et al., 2004). Genomic analysis revealed that the OY-M strain has lost many of the metabolic genes that were previously thought to be essential for all living organisms. Recently, the complete genome sequence of the aster yellows witches' broom (AY-WB) phytoplasma was determined (Bai et al., 2006). Isolate AY-WB appears to be further along in the reductive evolution process than OY-M because the AY-WB genome lacks genes that are truncated in the OY-M genome (Bai et al., 2006). The existence of plasmids has been reported in numerous phytoplasma strains (Tran-Nguyen and Gibb, 2006). Among these strains, the complete nucleotide sequences have been determined for OY (Nishigawa et al., 2003), beet leafhopper-transmitted virescence agent (BLTVA) (Liefting et al., 2004), tomato big bud (Tran-Nguyen and Gibb, 2006), ‘Ca. P. australiense’ (Liefting et al., 2006; TranNguyen and Gibb, 2006; Tran-Nguyen et al., 2008), and AY-WB (Bai et al., 2006). However, the functions of most of these plasmids are still

52

Y. Ishii et al. / Gene 446 (2009) 51–57

unclear. In the insect-transmissible bacteria there have been several reports of plasmids encoding genes related to their insect transmissibility (Berho et al., 2006a,b; Grimm et al., 2004; Killiny et al., 2006; Neelakanta et al., 2007; Pal et al., 2004; Stewart et al., 2005; Yang et al., 2004). In addition, there have been several studies in phytoplasmas examining the relationship between plasmids and their insect transmissibility potential. For example, extensive rearrangement of plasmids in clover phyllody phytoplasma was observed between the wild-type line and the non-insect-transmissible line (Denes and Sinha, 1992). A non-insect-transmissible line (OY-NIM) was obtained after maintenance of OY-M through plant grafting, without the use of insect vectors for approximately 2 years (Ishii et al., 2009; Oshima et al., 2001b). OY phytoplasmas have 2 types of plasmids, termed “EcOYDNA” and “pOY-plasmid”. These plasmids encode different types of replication initiation genes (rep): EcOY-DNA, which encodes a homologue of the geminivirus rep (repEC), and the pOY-plasmid, which encodes a homologue of a bacterial plasmid rep (repBP) (Fig. S1) (Kuboyama et al., 1998; Oshima et al., 2001a). Both OY-M and O YNIM have an EcOY-DNA (EcOYM and EcOYNIM, respectively) and a pOY-plasmid (pOYM and pOYNIM, respectively) (Nishigawa et al., 2002a,b, 2003). Both EcOYM and pOYM encode a putative membrane protein, ORF3. Interestingly, pOYNIM contains no orf3 gene, and the 157-bp region containing the orf3 promoter is absent from EcOYNIM (Fig. S1) (Ishii et al., 2009). These gene structures are consistent with the observation that non-expression of ORF3 was detected using immunohistochemistry of the OY-NIM infected plants. These results suggest that ORF3 is not necessary for growth and replication in a plant. Since OY-NIM developed from OY-M in a short period of time (Nishigawa et al., 2002b), it was hypothesized that the DNA sequences of the OY-NIM plasmids may be further changed during the maintenance of OY-NIM by plant tissue culture. In this study, changes of the gene structures of EcOYNIM and pOYNIM that occurred over a period of 10 years were analyzed, and process of reductive evolution of these plasmids during the maintenance of OY-NIM were illustrated. 2. Material and methods 2.1. Phytoplasma lines ‘Ca. P. asteris’ OY strain (OY) was isolated in Saga Prefecture, Japan (Shiomi et al., 1996). One derivative line of OY phytoplasma (OY-M) was maintained in garland chrysanthemum (Chrysanthemum coronarium) with the use of the leafhopper vector Macrosteles striifrons (Oshima et al., 2001b). Plants infected with OY-M produce many lateral shoots, although they exhibit only mild leaf yellowing and almost no stunting. A non-insect-transmissible and mild-symptom line (OY-NIM) was obtained after maintaining strain OY-M in plants with periodic grafting, without the use of insect vectors for more than 2 years (Oshima et al., 2001b). The OY-NIM strain produces the same symptoms as OY-M. Afterward, OY-NIM-infected plants have been maintained in garland chrysanthemum by plant tissue culture. In the tissue culture, surface-sterilized shoots were cultured on Murasige– Skoog (MS) medium (Wako) supplemented with 2% sucrose. Both OYM-infected and OY-NIM-infected host plants were maintained at 25 °C in a greenhouse with a 16 h light/8 h dark photoperiod until analysis. The OY-M inoculative leafhoppers that fed on OY-M-infected plants for 40 days were used. Healthy plants and non-inoculative leafhoppers were used as negative controls for the analysis. 2.2. PCR amplification and DNA sequencing Phytoplasma-enriched fractions from OY-M-infected plants sampled in 2006 and OY-NIM-infected plants sampled yearly from 1998 to 2006 except for 2001 were extracted as previously described (Lee et al., 1988). Each of the total DNA sample was used as a

template in PCR assays of orf3, repEC (a rep encoded on EcOY-DNA), repBP (a rep encoded on pOY-plasmid), and recA. DNA was also used for inverse PCR of repEC and repBP. Table 1 lists the DNA sequence of each primer used. The PCRs of orf3, repEC, and repBP were carried out under the following conditions: denaturation at 94 °C for 30 s (1 min in the first cycle), annealing at 53 °C for 30 s, and extension at 72 °C for 1.5 min for 35 cycles (8.5 min in the final cycle). The inverse PCRs of repEC and repBP to amplify outwards of them and the PCR of recA were carried out under the following conditions: denaturation at 94 °C for 30 s (1 min in the first cycle), and annealing and extension at 60 °C for 5 min for 35 cycles (12 min in the final cycle). The amplifications were performed in a thermal cycler (Gene Amp PCR System 9700; Applied Biosystems). Each PCR mixture contained 0.5 μM of each primer, 2.5 mM MgCl2,10 mM Tris– HCl (pH 8.3), 50 mM KCl, 2.5 U/50 μl LA Taq DNA polymerase (Takara, Shiga, Japan), and 1 ng/μl template DNA in a total volume of 50 μl. The amplified PCR products were visualized by electrophoresis with a 0.7% agarose gel and Tris–acetate–EDTA buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.3). The nucleotide sequences were determined by primer walking using the dideoxynucleotide chaintermination method with an automatic DNA sequencer (PRISM 3130 DNA Sequencer with 96-well upgrade; Applied Biosystems). 2.3. Southern blot analysis orf3, repEC, and repBP probes were prepared as previously described (Arashida et al., 2008). The orf3 probe was designed based on 193 bp sequence of its N-terminal end, the repEC probe was designed based on 486 bp sequence of its N-terminal end, and the repBP probe was designed based on 836 bp sequence covering most of the corresponding gene. The PCR products of these genes were inserted into pGEM-T Easy Vector (Promega) according to the manufacturer's protocol. With a clone carrying each gene as a template, PCR was performed with a PCR DIG Probe Synthesis Kit (Roche). Table 1 lists the sequences of primers used. For Southern blot analysis, total DNA was extracted from OY-M-infected plants sampled in 2006. OY-NIM-infected plants were harvested annually from 1998 through 2000 and from 2002 through 2006, as were the healthy plants. All plants were stored at − 80 °C, and DNAs from them were extracted in 2006 and stored at − 20 °C. All DNA was separated on a 0.5% agarose gel and transferred to a nylon membrane. Prehybridization and hybridization with each probe were performed at 39 °C in the presence of 50% formamide and 5× SSC (saline sodium citrate: 750 mM NaCl and 75 mM Na3(C6H5O7)). Prehybridization was carried out for 30 min. After 12 h hybridization at 39 °C, the membrane was washed twice with 2× SSC at room temperature for 5 min and with 0.5× SSC at 65 °C for 15 min. The signal was detected using the DIG wash and block buffer set (Roche), and the ECL Direct Nucleic Acid Labeling and Detection System (Amersham).

Table 1 Oligonucleotide primers used in this study. Primer name

Primer sequence

orf3 (F) orf3 probe (F) orf3 (R) repEC (F) repEC (R) repEC probe (R) repEC inverse (F) repEC inverse (R) repBP (F) repBP (R) repBP inverse (F) repBP inverse (R) recA (F) recA (R)

AGAATTCCATATGAATAAAAAAAGAAAAATTATATTAA TAACTTAATTAATGACTTAATTATA TGAGCTCGAGAGCTAATAAAGCAAGAGGAGCTGCT ATGAAAAAAACAAATAATATTAAAA TTAACTTTCATTTTCTTGGTCTAAA AGTTAAACTTTCTAATTCAGTAGGT ACGAACAAGCTGTAATTCAACATTT AGATAAATCACACTGGGAATAAGTT TATTTATCAAAATGATAAAGAGGCTC CAACGACGTTTTAATTGAGTAATAC TATTAAAGATGTTAGATAATAATACT CTTTTATATCTCCTACTTTTTTACC ATTCTTTTACCAGATCACGTTTTGG TCTACTTTTGCTTGTGATGCAAATT

Y. Ishii et al. / Gene 446 (2009) 51–57

2.4. Nucleotide sequence accession numbers Sequences of EcOYNIM and pOYNIM have been deposited in the GenBank database under accession numbers AB479508 (EcOYNIM_1998), AB479509 (EcOYNIM_1999), AB479510(EcOYNIM_2000), AB479511 (EcOYNIM_2002–2004), AB479512 (EcOYNIM_2005), AB480166 (pOYNIM_1998–2000), and AB480167 (pOYNIM_2002– 2006). 3. Results 3.1. PCR amplification of orf3, repEC, and repBP Total DNA was extracted from OY-M and OY-NIM-infected plants and used for the PCR amplification of orf3, repEC, and repBP. Fragments of orf3 were amplified from 7 both OY-M-infected and OY-NIMinfected plants sampled from 1998 to 2000, but not from OY-NIMinfected plants sampled from 2002 to 2006 (Fig. 1). In the PCR and inverse PCR of repEC, fragments were amplified from OY-M-infected and OY-NIM-infected plants sampled from 1998 to 2005, but not from OY-NIM-infected plants sampled during the 2006 season (Fig. 1). For both PCR and inverse PCR of repBP, fragments were amplified from all samples (Fig. 1). Inverse PCR of repBP resulted in the amplification of fragments with different lengths between OY-M and OY-NIM (Fig. 1).

53

from 2004 to 2005. In contrast, no gene rearrangement was observed in any of the pOYNIM sequences. However, 44 nucleotide mutations (corresponding to 21 amino acid substitutions) were observed in the orf2 regions of pOYNIM from the samples collected from 1998 to 2000 and from 2002 to 2005 (Fig. 3). The gene structures of the EcOYM and the pOYM samples in 2006 were identical to those previously sequenced in 1998. Subsequently, the regions around the missing sequences were analyzed. Direct-repeat tracts of 34 bp were found in EcOYM (Fig. 2B (a); I regions). However, in the EcOYNIM samples harvested from 1998 to 2000, only one 34 bp tract was observed, and the region between the 34 bp direct-repeat tracts in EcOYM was missing (Fig. 2B (a)). Direct-repeat tracts of 13 bp were also found in the EcOYNIM of samples collected from 1998 to 2000 (Fig. 2B(b); II regions). However, in the EcOYNIM of samples harvested from 2002 to 2005, only one 13 bp tract was observed, and the regions between the 13 bp directrepeat tracts present in the EcOYNIM from 1998 to 2000 were absent (Fig. 2B(b)). Moreover, a partial pOYNIM sequence including repBP was inserted in the EcOYNIM of samples collected from 2002 to 2005 (Fig. 2B(c)). Interestingly, the upstream sequence of repBP in EcOYNIM was shown to be identical to that in pOYNIM (Fig. 2B(c); III region). Similarly, the downstream sequence of repBP in EcOYNIM is identical to the corresponding sequence seen in pOYNIM (Fig. 2B(c); IV region). These results suggest that the large deletion and inter-plasmid recombination occurred via a homologous recombination event.

3.2. Sequence analysis of EcOYNIM and pOYNIM

3.3. Southern blot analysis of orf3, repEC, and repBP

The amplified fragments illustrated in Fig. 1 were fully sequenced, with the addition of nucleotide sequence comparisons. The EcOYNIM samples harvested from 1998 to 2000 lacked the 157 bp region upstream of orf2, while this region was present in the EcOYM as previously described and reported (Fig. 2A) (Ishii et al., 2009). In the EcOYNIM samples harvested from 2002 to 2005, two regions (the 530 bp region containing the entire orf8 and the 746-bp region from the C-terminal end of orf2 to the N-terminal end of orf3) were missing, while the repBP was inserted (Fig. 2A). In addition, other single mutations were observed: twelve mutations in samples from 1998 to 1999, one mutation in samples from 1999 to 2000, one mutation in samples from 2000 to 2002, and one mutation in samples

Total DNA was extracted from each of the OY-M-infected plant sampled in 2006 and OY-NIM-infected plants sampled from 1998 to 2006. Southern blot analyses were performed using probes for orf3, repEC, and repBP. With the orf3 probe, bands of plasmids were clearly detected in both OY-M-infected and OY-NIM-infected plants sampled from 1998 to 2000, but not in OY-NIM-infected plants sampled from 2003 to 2006 (Fig. 4). Because plasmids can take several forms, e.g., supercoiled and open circular, several bands were observed in each lane. With the repEC probe, bands of EcOY-DNA were detected in both OY-M-infected and OY-NIM-infected plants sampled from 1998 to 2005, but not in OY-NIM-infected plants sampled in 2006 (Fig. 4). In contrast, with the repBP probe, bands of the pOY-plasmid were detected in all samples (Fig. 4). No bands were detected in healthy control plants using any of the three probes. 3.4. PCR amplification and sequence analysis of recA in OY-NIM To compare the evolutionary rates of the chromosomal DNA and plasmid DNA, sequence analysis was performed for the recA gene. This gene exists as a pseudogene and is separated into three fragments in the OY-M genome. A primer set was designed to cover a 2 kb region that contained all three fragments of recA (Table 1). PCR was performed with total DNA extracted from OY-NIM-infected plants sampled in 2006. An approximately 2 kb fragment was amplified (data not shown) and sequenced. The nucleotide sequence of this fragment was identical to the genomic region encoding recA in the OYM genome, suggesting that the recA gene still exists as a pseudogene in the OY-NIM genome (Acc. No. AP006628; PAM715-717). 4. Discussion 4.1. Stepwise process of reductive evolution in phytoplasmal plasmid

Fig. 1. PCR amplification of orf3, repEC, and repBP. PCR amplification of orf3, repEC, and repBP, and inverse PCR amplification of repEC and repBP. Total DNA extracted from OYM-infected and OY-NIM-infected plants sampled from 1998 to 2006 were used as a template.

In this study, we showed that one of the plasmids of OY-NIM, EcOYNIM, was gradually changed by plant tissue culture, and was finally lost from OY-NIM after over 8 years. During this time, the upstream region of orf2 containing the orf3 promoter was lost in samples collected from 1998 to 2000, and a large region including

54

Y. Ishii et al. / Gene 446 (2009) 51–57

Fig. 2. (A) The evolutionary process of EcOYNIM. Schematic diagrams representing the gene structures of EcOYM and EcOYNIMs from 1998 to 2006. Open arrow boxes indicate ORFs. Rep and ssb indicate genes encoding replication initiation protein and single-strand DNA binding protein, respectively. The grey arrow box indicates a rep gene that is identical to the rep gene of pOYNIM. In 2006, the entire EcOY-DNA was lost from OY-NIM. Solid lines connect the identical sites of each EcOY-DNA. (B) Repeat tracts of EcOY-DNAs. Schematic diagrams representing the gene structures of EcOYM and EcOYNIM. Open arrow boxes indicate ORFs. (a) and (b): Roman numerals under arrows indicate identical sequences (repeat tracts). Solid lines connect identical sites in each EcOY-DNA. (c): Rep and ssb indicate genes encoding single-strand DNA binding protein and replication initiation protein, respectively. The grey arrow box indicates a rep gene that is identical to the rep gene in pOYNIM. Dotted and solid lines indicate the EcOYNIM and pOYNIM sequences, respectively. Each Roman numeral under the arrows indicates a sequence that is identical between EcOYNIM and pOYNIM.

most of orf2 and orf3 was lost in samples from 2002 to 2005. Additionally, PCR amplification and Southern blot analysis showed that repEC was not detected in the OY-NIM-infected plants sampled in 2006. All plasmids that have been isolated from phytoplasmas encode rep or dnaG as a replication gene (Tran-Nguyen and Gibb, 2006). Therefore, the lack of detection of repEC indicates that EcOYNIM was lost from OY-NIM in 2005–2006. These results suggest that this part of EcOYNIM was gradually lost through its maintenance in plants, and finally the whole plasmid was lost from OY-NIM (Fig. S2). In contrast, both PCR and Southern blot analysis detected repBP in all OY-NIM-

infected plants, showing that pOYNIM was retained in OY-NIM. While dynamic gene rearrangements were observed in EcOYNIM in recent years, the gene structures of the EcOYM sampled in 2006 were identical to that previously sequenced in 1998. Since samples used in this study were obtained during plant grafting and plant tissue culture, the degradation of EcOYNIM would be caused by the environmental adaptation. orf3 is thought to be involved in insect transmissibility because 1) ORF3 is a transmembrane protein and is exposed on the surface of phytoplasma cells, 2) orf3 is lacked from pOYNIM (Fig. S1) (Nishigawa

Fig. 3. Amino acid sequence alignment of orf2 encoded on pOYNIM from 1998 to 2000 and pOYNIM from 2002 to 2006. Black and grey boxes indicate identical and similar residues, respectively; hyphens indicate gaps. A transmembrane region predicted by the SOSUI program is underlined. The arrowhead indicates a cleavage point of the secretion system, as predicted by SignalP software.

Y. Ishii et al. / Gene 446 (2009) 51–57

Fig. 4. Southern blot analysis of orf3, repEC, and repBP. Southern blot analysis was performed using the total DNA extracted from OY-M-infected and OY-NIM-infected plants sampled from 1998 to 2006. The orf3, repEC, and repBP genes were used as probes. The plasmid vector harboring each gene was detected and used as the corresponding positive control.

et al., 2002b, 2003), and 3) orf3 on EcOYNIM lacks the promoter region (Fig. S1) (Ishii et al., 2009). The gradual loss of EcOYNIM was observed in subsequent steps: first, the promoter region of orf3 was lost, followed by the loss of then a large region including orf3, and finally the entire plasmid disappeared (Fig. S2). Although EcOYNIM was lost from OY-NIM, among EcOYNIM-encoded genes (orf1-3, ssb and repEC), homologues of orf1 and orf2 were still encoded on pOYNIM. Therefore, these results imply that orf3, ssb and repEC are not necessary for phytoplasmal survival under continuous tissue culturing, and thus these genes could be related to the insect transmissibility of phytoplasmas. 4.2. Chromosomal stasis versus plasmid plasticity in phytoplasma In addition to the OY-M genome, the complete genomic sequence of Ca. Phytoplasma asteris AY-WB strains has been determined (Bai et al., 2006). AY-WB appears to be further along in the reductive evolution process than OY-M (Bai et al., 2006). For example, AY-WB lacks genes that were truncated and retained as pseudogenes in OY-M, including asnB, hsdR, hsdM, recA, and sucP (Bai et al., 2006; Oshima et al., 2004). Therefore, these genes would probably be biased toward deletion from the genome. In this study, the recA gene encoded on the OY-NIM genome of samples in 2006 was sequenced to compare the evolutionary rates of the chromosomal DNA and the plasmid. There was no difference between OY-M and OY-NIM during 2006. Thus, the period from the divergence point of OY-M and OY-NIM is probably too short to correct any mutations in their chromosomes. In contrast, extensive rearrangements of EcOYNIM and pOYNIM were observed during the same time period. These results suggest that the plasmid exhibited greater plasticity than the chromosomal DNA in the phytoplasma. Chromosomal DNA generally encodes housekeeping genes, whereas plasmids often contain genes that facilitate host adaptation to specific environments (Eberhard, 1990). Genes on plasmids tend to evolve rapidly in response to changes in the environment of host bacteria (Eberhard, 1990). For example, the genome of the aphid endosymbiont Buchnera aphidicola has been extraordinarily stable for about 50 million years, and has not undergone either chromosomal rearrangement or gene acquisition by horizontal gene transfer (Dale and Moran, 2006; Latorre et al., 2005; Tamas et al., 2002). In contrast to the stasis of the chromosomal DNA, plasmid of B. aphidicola has undergone frequent gene rearrangements (Bracho et al., 1995; Latorre et al., 2005; Plague et al., 2003; Sabater-Munoz et al., 2002; Sabater-

55

Munoz et al., 2004). The changes in the OY-NIM plasmids presented in this study also support the relative plasticity of bacterial plasmids. In addition to OY-NIM, a non-insect-transmissible line was isolated in clover phyllody phytoplasma by plant grafting in the absence of insect vectors, and extensive rearrangement of its plasmid was also observed (Denes and Sinha, 1992). The translational process generally consumes more than half of the total cell energy (Maaloe, 1979). For example, it has been suggested that the translational machinery of bacteria comprises approximately half of the total dry weight of a cell (Maaloe, 1979). Therefore, in most bacteria, the levels of transcription and translation are strictly regulated to express only necessary amounts of products when they are needed (Dekel and Alon, 2005; Ibarra et al., 2002; Liebermeister et al., 2004). However, in the low-GC bacteria, AT-rich sequences potentially serve as promoter sites, and even the degraded remnants on the genome, such as pseudogenes, appear to be transcribed in an unpredictable manner (Davids et al., 2002; Ogata et al., 2001). Therefore, deletion of unneeded genes would reduce transcription and translation costs in these bacteria, thus saving energy (Moran, 2002). The stepwise deletions of orf3, encoded on EcOYNIM, may reduce unneeded transcriptional products. Moreover, plasmids can be burdens to bacteria because they require energy for maintenance (Thomas, 2004). The tick-borne bacterium Borrelia burgdorferi, the causative agent of Lyme disease, encodes genes essential for host infection on its plasmids, but the plasmids are often lost during in vitro cultivation (Grimm et al., 2003; Strother and de Silva, 2005). Similarly, EcOYNIM might be expelled from OY-NIM because it is not necessary in its current environment of continuous plant tissue culture without the use of insect vectors. 4.3. RecA-independent homologous recombination in phytoplasma In this study, the direct-repeat tracts were observed at the ends of the missing sequences (Fig. 2B(a) and (b)), suggesting that the lack of the sequence on the plasmid occurred via a homologous recombination event. Most homologous recombination events require the recA gene, and RecA needs repeat tracts of at least 25 bp to function efficiently (Shen and Huang, 1986). However, the recA gene exists as a pseudogene in the OY-NIM genome. In addition, the repeat tracts flanking the sequence missing from EcOYNIM in samples collected from 2000 to 2002 contained only repeat units of 13 bp (Fig. 2B(b)), suggesting that RecA-dependent homologous recombination may not have occurred in OY-NIM. Although most organisms have recA genes, they are not essential for bacterial viability (Hutchison et al., 1999; Kobayashi et al., 2003). While loss of recA gene was thought to cause genomic stasis (Tamas et al., 2002), RecA-independent homologous recombination was observed in many bacteria. For example, B. aphidicola lacks recA, but recombination between its chromosomal DNA and plasmid DNA has been observed (Shigenobu et al., 2000; van Ham et al., 2003; Zientz et al., 2004). In addition, RecA-independent recombination has been reported in other bacteria such as Salmonella enterica and Campylobacter fetus (Albertini et al., 1982; Halliday and Glickman, 1991; Ishiura et al., 1990; Ray et al.,2000; Schaaper and Dunn, 1991), although the mechanism is unknown. In phytoplasmas, it has been suggested that RecA does not function in either OY-M or AYWB (Bai et al., 2006). However, multiple redundant genes exist in their genomes, and intermolecular recombination among their plasmids has been postulated (Arashida et al., 2008; Bai et al., 2006; Nilsson et al., 2005; Nishigawa et al., 2003; Oshima et al., 2004). Taken together, RecA-independent homologous recombination could have occurred in multiple phytoplasmas, including OY-NIM. This study revealed that repBP was inserted in EcOYNIM in 2004, indicating that two types of rep were encoded on the same plasmid (Fig. 2B(c)). It has been reported that the BLTVA phytoplasma has a plasmid encoding two rep genes (Liefting et al., 2004), suggesting that BLTVA plasmids have undergone recombination between themselves

56

Y. Ishii et al. / Gene 446 (2009) 51–57

(Liefting et al., 2004). Therefore, recombination between plasmids is a relatively common phenomenon in the phytoplasmas. 5. Conclusions This study revealed the further degradation of the plasmid caused by the loss of insect transmissibility. Furthermore, this study indicates the great plasticity of plasmids throughout the evolution of phytoplasmas. For a better understanding of phytoplasma diversity, it will be important to compare plasmid sequences among the related phytoplasmas that have close phylogenies. Acknowledgments This work was supported by the Japan Society for the Promotion of Science and a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (category S of Scientific Research Grant 16108001). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.gene.2009.07.010. References Albertini, A.M., Hofer, M., Calos, M.P., Miller, J.H., 1982. On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions. Cell 29, 319–328. Arashida, R., et al., 2008. Heterogeneic dynamics of the structures of multiple gene clusters in two pathogenetically different lines originating from the same phytoplasma. DNA Cell Biol. 27, 209–217. Bai, X., et al., 2006. Living with genome instability: the adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J. Bacteriol. 188, 3682–3696. Berho, N., Duret, S., Danet, J.L., Renaudin, J., 2006a. Plasmid pSci6 from Spiroplasma citri GII-3 confers insect transmissibility to the non-transmissible strain S. citri 44. Microbiology 152, 2703–2716. Berho, N., Duret, S., Renaudin, J., 2006b. Absence of plasmids encoding adhesion-related proteins in non-insect-transmissible strains of Spiroplasma citri. Microbiology 152, 873–886. Bracho, A.M., Martinez-Torres, D., Moya, A., Latorre, A., 1995. Discovery and molecular characterization of a plasmid localized in Buchnera sp. bacterial endosymbiont of the aphid Rhopalosiphum padi. J. Mol. Evol. 41, 67–73. Dale, C., Moran, N.A., 2006. Molecular interactions between bacterial symbionts and their hosts. Cell 126, 453–465. Davids, W., Amiri, H., Andersson, S.G., 2002. Small RNAs in Rickettsia: are they functional? Trends Genet. 18, 331–334. Dekel, E., Alon, U., 2005. Optimality and evolutionary tuning of the expression level of a protein. Nature 436, 588–592. Denes, A., Sinha, R., 1992. Alteration of clover phyllody mycoplasma DNA after in vitro culturing of phyllody-diseased clover. Can. J. Plant Pathol. 14, 189–196. Eberhard, W.G., 1990. Evolution in bacterial plasmids and levels of selection. Q. Rev. Biol. 65, 3–22. Grimm, D., Elias, A.F., Tilly, K., Rosa, P.A., 2003. Plasmid stability during in vitro propagation of Borrelia burgdorferi assessed at a clonal level. Infect. Immun. 71, 3138–3145. Grimm, D., et al., 2004. Outer-surface protein C of the Lyme disease spirochete: a protein induced in ticks for infection of mammals. Proc. Natl. Acad. Sci. U. S. A. 101, 3142–3147. Halliday, J.A., Glickman, B.W., 1991. Mechanisms of spontaneous mutation in DNA repair-proficient Escherichia coli. Mutat. Res. 250, 55–71. Hogenhout, S.A., Oshima, K., Ammar, E.-D., Kakizawa, S., Kingdom, H.N., Namba, S., 2008. Phytoplasmas: bacteria that manipulate plants and insects. Mol. Plant Pathol. 9, 403–423. Hutchison, C.A., et al., 1999. Global transposon mutagenesis and a minimal Mycoplasma genome. Science 286, 2165–2169. Ibarra, R.U., Edwards, J.S., Palsson, B.O., 2002. Escherichia coli K-12 undergoes adaptive evolution to achieve in silico predicted optimal growth. Nature 420, 186–189. Ishii, Y., et al., 2009. In the non-insect-transmissible line of onion yellows phytoplasma (OY-NIM), the plasmid-encoded transmembrane protein ORF3 lacks the major promoter region. Microbiology 155, 2058–2067. Ishiura, M., Hazumi, N., Shinagawa, H., Nakata, A., Uchida, T., Okada, Y., 1990. RecAindependent high-frequency deletion of recombinant cosmid DNA in Escherichia coli. J. Gen. Microbiol. 136, 69–79. Killiny, N., Batailler, B., Foissac, X., Saillard, C., 2006. Identification of a Spiroplasma citri hydrophilic protein associated with insect transmissibility. Microbiology 152, 1221–1230.

Kobayashi, K., et al., 2003. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U. S. A. 100, 4678–4683. Kuboyama, T., et al., 1998. A plasmid isolated from phytopathogenic onion yellows phytoplasma and its heterogeneity in the pathogenic phytoplasma mutant. Mol. Plant Microbe Interact. 11, 1031–1037. Latorre, A., Gil, R., Silva, F.J., Moya, A., 2005. Chromosomal stasis versus plasmid plasticity in aphid endosymbiont Buchnera aphidicola. Heredity 95, 339–347. Lee, I.M., Davis, R.E., 1992. Mycoplasmas which infect plant and insects. In: Maniloff, J., McElhansey, R.N., Finch, L.R., Baseman, J.B. (Eds.), Mycoplasmas: Molecular Biology and Pathogenesis. ASM Press, Washington DC, pp. 379–390. Lee, I., Davis, R., Hammond, R., Kirkpatrick, B., 1988. Cloned riboprobe for detection of a mycoplasmalike organism. Biochem. Biophys. Res. Commun. 155, 443–448. Lee, I.M., Davis, R.E., Gundersen-Rindal, D.E., 2000. Phytoplasma: phytopathogenic mollicutes. Annu. Rev. Microbiol. 54, 221–255. Liebermeister, W., Klipp, E., Schuster, S., Heinrich, R., 2004. A theory of optimal differential gene expression. Biosystems 76, 261–278. Liefting, L.W., Shaw, M.E., Kirkpatrick, B.C., 2004. Sequence analysis of two plasmids from the phytoplasma beet leafhopper-transmitted virescence agent. Microbiology 150, 1809–1817. Liefting, L.W., Andersen, M.T., Lough, T.J., Beever, R.E., 2006. Comparative analysis of the plasmids from two isolates of “Candidatus Phytoplasma australiense”.. Plasmid 56, 138–144. Maaloe, O., 1979. Regulation of the protein-synthesizing machinery in ribosomes, tRNA, factors and so on. In: Goldberger, R.F. (Ed.), Biological Regulation and Development. Plenum Press, New York., pp. 487–542. Moran, N.A., 2002. Microbial minimalism: genome reduction in bacterial pathogens. Cell 108, 583–586. Neelakanta, G., et al., 2007. Outer surface protein B is critical for Borrelia burgdorferi adherence and survival within Ixodes ticks. PLoS Pathog. 3, e33. Nilsson, A.I., Koskiniemi, S., Eriksson, S., Kugelberg, E., Hinton, J.C., Andersson, D.I., 2005. Bacterial genome size reduction by experimental evolution. Proc. Natl. Acad. Sci. U. S. A. 102, 12112–12116. Nishigawa, H., et al., 2002a. Evidence of intermolecular recombination between extrachromosomal DNAs in phytoplasma: a trigger for the biological diversity of phytoplasma? Microbiology 148, 1389–1396. Nishigawa, H., et al., 2002b. A plasmid from a non-insect-transmissible line of a phytoplasma lacks two open reading frames that exist in the plasmid from the wildtype line. Gene 298, 195–201. Nishigawa, H., Oshima, K., Miyata, S., Ugaki, M., Namba, S., 2003. Complete set of extrachromosomal DNAs from three pathogenic lines of onion yellows phytoplasma and use of PCR to differentiate each line. J. Gen. Plant Pathol. 69, 194–198. Ogata, H., et al., 2001. Mechanisms of evolution in Rickettsia conorii and R. prowazekii. Science 293, 2093–2098. Oshima, K., et al., 2001a. A plasmid of phytoplasma encodes a unique replication protein having both plasmid- and virus-like domains: clue to viral ancestry or result of virus/plasmid recombination? Virology 285, 270–277. Oshima, K., et al., 2001b. Isolation and characterization of derivative lines of the onion yellows phytoplasma that do not cause stunting or phloem hyperplasia. Phytopathology 91, 1024–1029. Oshima, K., et al., 2004. Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nat. Genet. 36, 27–29. Pal, U., et al., 2004. OspC facilitates Borrelia burgdorferi invasion of Ixodes scapularis salivary glands. J. Clin. Invest. 113, 220–230. Panopoulos, N.J., Peet, R.C., 1985. The molecular-genetics of plant pathogenic bacteria and their plasmids. Annu. Rev. Phytopathol. 23, 381–419. Plague, G.R., Dale, C., Moran, N.A., 2003. Low and homogeneous copy number of plasmid-borne symbiont genes affecting host nutrition in Buchnera aphidicola of the aphid Uroleucon ambrosiae. Mol. Ecol. 12, 1095–1100. Ray, K.C., Tu, Z.C., Grogono-Thomas, R., Newell, D.G., Thompson, S.A., Blaser, M.J., 2000. Campylobacter fetus sap inversion occurs in the absence of RecA function. Infect. Immun. 68, 5663–5667. Sabater-Munoz, B., Gomez-Valero, L., van Ham, R.C., Silva, F.J., Latorre, A., 2002. Molecular characterization of the leucine cluster in Buchnera sp. strain PSY, a primary endosymbiont of the aphid Pemphigus spyrothecae. Appl. Environ. Microbiol. 68, 2572–2575. Sabater-Munoz, B., van Ham, R.C., Moya, A., Silva, F.J., Latorre, A., 2004. Evolution of the leucine gene cluster in Buchnera aphidicola: insights from chromosomal versions of the cluster. J. Bacteriol. 186, 2646–2654. Schaaper, R.M., Dunn, R.L., 1991. Spontaneous mutation in the Escherichia coli lacI gene. Genetics 129, 317–326. Shen, P., Huang, H.V., 1986. Homologous recombination in Escherichia coli: dependence on substrate length and homology. Genetics 112, 441–457. Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., Ishikawa, H., 2000. Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS. Nature 407, 81–86. Shiomi, T., Tanaka, M., Waki, H., Zenbayashi, R., 1996. Occurrence of welsh onion yellows. Ann. Phytopathol. Soc. Jpn. 62, 258–260. Stewart, P.E., Byram, R., Grimm, D., Tilly, K., Rosa, P.A., 2005. The plasmids of Borrelia burgdorferi: essential genetic elements of a pathogen. Plasmid 53, 1–13. Strother, K.O., de Silva, A., 2005. Role of Borrelia burgdorferi linear plasmid 25 in infection of Ixodes scapularis ticks. J. Bacteriol. 187, 5776–5781. Sundin, G.W., 2007. Genomic insights into the contribution of phytopathogenic bacterial plasmids to the evolutionary history of their hosts. Annu. Rev. Phytopathol. 45, 129–151. Tamas, I., et al., 2002. 50 million years of genomic stasis in endosymbiotic bacteria. Science 296, 2376–2379.

Y. Ishii et al. / Gene 446 (2009) 51–57 Thomas, C.M., 2004. Evolution and population genetics of bacterial plasmids. In: Funnell, G.J., Phillips, G.J. (Eds.), Plasmid Biology. ASM Press, Washington, DC., pp. 509–528. Tran-Nguyen, L.T., Gibb, K.S., 2006. Extrachromosomal DNA isolated from tomato big bud and Candidatus Phytoplasma australiense phytoplasma strains. Plasmid 56,153–166. Tran-Nguyen, L.T., Kube, M., Schneider, B., Reinhardt, R., Gibb, K.S., 2008. Comparative genome analysis of “Candidatus Phytoplasma australiense” (subgroup tuf-Australia I; rp-A) and “Ca. Phytoplasma asteris” strains OY-M and AY-WB. J. Bacteriol. 190, 3979–3991.

57

van Ham, R.C., et al., 2003. Reductive genome evolution in Buchnera aphidicola. Proc. Natl. Acad. Sci. U. S. A. 100, 581–586. Vivian, A., Murillo, J., Jackson, R.W., 2001. The roles of plasmids in phytopathogenic bacteria: mobile arsenals? Microbiology 147, 763–780. Yang, X.F., Pal, U., Alani, S.M., Fikrig, E., Norgard, M.V., 2004. Essential role for OspA/B in the life cycle of the Lyme disease spirochete. J. Exp. Med. 199, 641–648. Zientz, E., Dandekar, T., Gross, R., 2004. Metabolic interdependence of obligate intracellular bacteria and their insect hosts. Microbiol. Mol. Biol. Rev. 68, 745–770.