Processing of bacteriophage T4 tRNAs

J. Mol. Biol.

(1981)

153, 619-636

Processing

of Bacteriophage The Role of RNAase

T4 tRNAs III

BELA PRAGAI University

Institute Medical

of Microbiology School of Szeged, Hungary AND

DAVID APIRIONt Department of Microbiology and Immunology Division of Biology and Biomedical Sciences Washington University School of Medicine, Box 8093 St. Louis, MO 63110, U.S.A. (Received

22 May

1981)

In order to assess the contribution of the processing enzyme RNAase III to the maturation of bacteriophage T4 transfer RNA, RNAase III+ and RNAase IIIstrains were infected with T4 and the tRNAs produced were analyzed. Infection of the RNAase III+ strains of Escherichiu coli with T4427, a deletion strain missing seven of the ten genes in the T4 tRNA cluster, results in the appearance of a transient l@l S RNA molecule as well as the three stable RNAs encoded by T4427, species 1, rRNAL’” and tRNAG’“. Infection of an RNAase III- strain results in the appearance of a larger, transient RNA molecule, 105 S, and a severe reduction in the accumulation of tRNAG’“. The 105 S RNA is similar to 1@1 S RNA but contains extra nucleotides (about 50) at the 5’ end. (l@l S contains all the three final molecules plus about 70 extra nucleotides at the 3’ end.) Both 1@5 S and 101 S RNAs can be processed in vitro into the three final molecules. When 101 S is the substrate, the three final molecules are obtained whether extracts of RNAase III+ or RNAase III- cells are used. However, when 1@5 S is the substrate RNAase III+ extracts bring out normal maturation, while using RNAase III- extracts the level of tRNAG’” .IS severely reduced. When 105 S is used with RNAase III+ extracts maturation proceeds via 101 S RNA, while when RNAase III- extracts were used l@l S is not detected. The 165 S RNA can be converted to 10.1 S RNA by RNAase III in a reaction which produces only two fragments. The sequence at the 5’ end of the 1@5 S suggests a secondary structure in which the RNAase III cleavage site is in a stem. These experiments show that the endonucleolytic RNA processing enzyme RNAase III is required for processing at the 5’ end of the T4 tRNA cluster where it introduces a cleavage six nucleotides proximal to the first tRNA, tRNAG’“, in the cluster. t Author to whom all correspondence should be addressed. 619 0022-2336/81/350619-12

$02.00/O

0 1981 Academic Press Inc. (London) Ltd

620

B. PRAGAI

AND

D. APIRION

1. Introduction Bacteriophage T4 carries in a single cluster the genesfor eight transfer RNAs and two stable RNAs (species1 and 2) of unknown function (Hsu et al., 1967 ; Daniel & Littauer, 1970; Guthrie et al., 1974; Abelson, 1979). This system has been used successfully to study the biosynthesis of tRNAs, especially to show the role of the host cell processing enzyme RNAase P in the maturation of virus-coded tRNAs (Guthrie et al., 1974; Abelson et al., 1974). From the three endonucleolytic RNA processing enzymes which are known to participate in the processing of host RNA, RNAase III (Apirion et al., 1980; Apirion & Gegenheimer, 1981), RNAase E (Ghora & Apirion, 1978; Ray & Apirion, 1981), and RNAase P (Schedl & Primakoff, 1973; Altman, 1975), only the role of the latter is well established in processing of T4 tRNA (Guthrie et al., 1974; Abelson, 1979). Recently a function for RNAase III in processing T4 tRNA was suggested, when it was observed that in an RNAase III- strain the production of tRNAG’” as compared to other tRNAs was unusually low (McClain, 1979). This observation, while interesting, was also puzzling, since in these experiments a putative precursor molecule which contains tRNA”” sequenceswas not identified, even though tRNAG”’ sequences are the most proximal to the promoter in the T4 tRNA cluster (Guthrie et al., 1974; Abelson, 1979). Recently it was shown that it is indeed feasible to isolate in an mc (RNAase III-) strain an RNA molecule which contains tRNAG’” and tRNAL”” (Pragai et al., 1980). Here we show that the same molecule contains also species1 RNA, and the experiments presented here demonstrate that RNAase III is required to introduce a cleavage in the RNA transcript just before the first tRNA, which is tRNA”“. 2. Materials and Methods (a) Bucteriuzstrains Escherichia coEi RNAase III+ strains N2076 (Apirion & Watson, 1975), N7060 (Weatherford et al., 1972); and RNAase III- strains N2077, N2069 (Apirion & Watson, 1975), and N2859 (Misra & Apirion, 1979) were used, as well aa T4427 and T4433 (Wilson & Abelson, 1972; Wilson et al., 1972). (b) Othxrs Labeling cells with 32Pi, preparation of [32P]RNAs, fingerprinting, oligonucleotide analysis, and in. vitro processing: all these procedures were carried out according to established protocols (Pragai et al., 1980; Gegenheimer et al., 1977 ; Gegenheimer & Apirion, 1978,198Oa; Volckaert et aZ., 1976; Volckaert & Fiers, 1977).

3. Results (a) RNA

synthesis

in vivo after infection

with

T4

Since we knew from previous experiments (M&lain, 1979; Pragai et al., 1980) that the accumulation of tRNAG” is affected in an RNAase III- strain, we infected

RNAase

III

AND

T4

621

tRNA

an isogenic pair (mc’/rnc) of E. coli strains with T4A27 and followed RNA synthesis. As can be seen in Figure 1 in the rnc+ strain a molecule appears which we refer to as 191 S. This molecule disappears at later times, while the level of the three mature RNAs species1, tRNAL”“, and tRNAG’” increases. Below the tRNAs two small RNAs appear. The only three molecules which can be synthesized from the tRNA cluster in T4A27 are species1, tRNAL”“, and tRNAGi” (Wilson & Abelson, 1972; Wilson et al., 1972). The three distinct RNA bands which appear between species1 and 10-l S RNA are not products from the tRNA cluster, since they appear also when both strains are infected with T4433, a strain in which all the tRNA cluster is deleted. When T4427 infects the mc strain the 191 S RNA is not observed, but a larger molecule can be seenwhich we refer to as 105 S RNA. (In a previous publication (Pragai et al., 1980) we referred to it as 10 S RNA.) All the RNAoselII Time

+

RNAaseIU-

(min)

IO.1s

Species

10.5 s

I

Leu tRNA Gin.

Nucleotides

-

FIG. 1. Formation of RNA in rnc+ (N2076, RNAase III+) and 17~: (N2077, RNAase III-) strains after infection with T4427. The cells were grown in Tris based medium containing @S% (w/v) peptone at 37°C. “Pi (2 mCi/ml) was added to the cultures 5 min after infection. Samples were withdrawn at the indicated times (time after labeling) and were treated as described by Gegenheimer et al., (1977). The picture shown here. and in Figs 3,4, and 5 are of an autoradiogram of the 10% portion of the gel. The top fifth of the gel which consists of 5% (w/v) polyacrylamide was removed after the gel was dried. The gel contained 7 M-urea, and each slot was lo&xl with about 250,000 cts/min. Below the tRNA”” band there are 2 smaller RNAs (XI and XI), the one which migrates slower is referred to as Xl. (For further details, see the text.)

622

B.

PRAGAI

AND

D.

APIRION

mature species appear, albeit at a slower rate, and the level of tRNAG” is considerably reduced. In addition, species 1 RNA seems to be much less stable in the rnc strain as compared to the rnc+ strain. Notice that the small RNAs below the tRNA region do appear. To find out to what extent the loss of tRNAG’” as compared to tRNAL”” is a unique feature of the mc mutation, we compared the levels of the three mature RNAs in rnc’ and mc strains after different labeling times, and in all caseswe found that even in the rnc+ strain there is some underproduction of tRNAG’“. In one particular experiment after 20 minutes of labeling in the rnc strain the ratio of tRNAL”“, tRNAG1” and species 1 was 1 : 027 : 0.83, respectively, while in the rnc+ strain it was 1 : 0.87 : 1.05. Thus, it is clear that the relatively low level of tRNAG1” is not a novel feature of the rnc mutation but this differential is further exacerbated in the absence of the RNAase III enzyme. (b) Structural

studies

Both 10.1 S and 105 S were purified and fingerprinted after T, and pancreatic RNAase digestion. The composition of the oligonucleotides was determined by further digestion with pancreatic or T, RNAsse, as necessary. Oligonucleotides were further analyzed, when required, by digestion with T, and P, n&eases. In Figure 2 the fingerprint of 195 S RNA after T, digestion is presented. These analyses showed that 105 S is similar to 191 S RNA but it contains extra nucleotides at its 5’ end. A molecule like the 10.1 S RNA accumulates in larger amounts when an me mutant is infected with T4427. Detailed analysis of the 10.1 S RNA will be presented elsewhere (B. Pragai & D. Apirion, unpublished results). Briefly, 101 S RNA contains all the three final molecules which are left in the tRNA cluster in strain 427, i.e. species1, tRNAL”” and tRNAG’“. The structure of 10.1 S RNA can be written as follows : A-A-U-A-A-U-tRNA”“-tRNAL”“-A-A-U-UA-U-Spl (from the 5’ to the 3’ end) plus a tail of about 70 nucieotides. (The first part of the molecule is exactly the K dimer, attached to pSp1, both of which can be found when an rnp strain is infected with T4 (Guthrie et al., 1974; Abelson et al.. 1974; Guthrie, 1975).) The two bands which appear below the tRNA region were also analyzed; one corresponds to the 3’ end of the 10.5 and 10.1 S RNA. (This molecule will be

FE. 2. A fingerprint of 105 S RNA after digestion with T, RNA=. N2077 (VW) was infected with A27 and labeled f2 mCi ‘*P/ml) for 10 min. The 105 S was purified by two steps: 5%/10% acrylamide, first dimension; I2% acrylamide, second dimension in the presence of”7 M-urea-The wet gel was-exposed to an X-ray film and the proper portion of the gel w&s cut out, extracted twice with extraction buffer and precipitated withyeast RNA (phenol extracted). The RNA was precipitated overnight with 3 vol. 95% ethanol, 92 M-sodium acetate (pH 5.2) centrifuged and washed with 75% and 95% ethanol, dried in vacz~*) and dissolved in distilled (sterilized) water. A total of 650,009 cts/min were used for the fingerprinting. The fingerprint wa8 exposed for 2 days and the compositions of the oligonucleotides were determined by RNA&se A, and RNAeae T2 and nuclease P, redigestion when necessary. The oligonucleotides identical to those appearing in 101 S RNA are indicated by open circles and the 105 S unique oligonucleotides by filled circles.

RNAase

III

AND

T4

tRNA

623

Ektrophoresis (bl

0

14

&J 13

FIG. 2.

624

B. PRAGAI

AND

D.

APIRION

discussed in some detail in a paper which describes the 10-l S RNA and the effect of RNAase E on T4 tRNA maturation.) The other molecule contains the 5’ end of the 10-5 S RNA plus a part of tRNAG’“. The unique T, oligonucleotides which appear in 1@5 S but not in 10.1 S RNA are shown in Figure 2 (filled circles) and their composition is presented in Table 1. Since some of the DNA sequences in this region are known (K. Fukada & J. Abelson, personal communication) all the extra unique oligonucleotides found in 10-5 S RNA, but for the 5’ end oligonucleotide, could be arranged in a particular secondary structure as discussed below. (The 5’ end oligonucleotide presented in Table 1 does not fit in the suggested DNA sequence.) TABLE Compositional

Oligonucleotede t4i t48 t49 t50 t51 5’

analysis

of RNAase

1

T,-generated

oligonucleotides

from

10.5 S RNA

Composition

Suggested

U,AGP CC. U,)GP VA, U,)GP F’s WWZIGP [C,, U,, AC, (AU),, pAU (C, AC)Gp

UUAGp UUCUUGp CCUUUGp UUAAUAAUUGp AUUAAUACCCUCUAUCAUCAAGp

AAUlAAGp

sequence

pAU(C,WGp

Only the oligonucleotides which appear in 10.5 S but not in l@l S RNA are depicted The suggested Jequence is according to a DNA sequence (see text). Hyphens have clarity.

(c) Processing

here (see Fig. 2). been omitted for

in vitro

The 1@5 S and l@l S RNA were digested with extracts of RNAase III+ and RNAase IIIstrains (Fig. 3) and in all cases when 10-l S RNA was used both tRNAL”” and tRNAG’” appeared in about equal amounts, regardless of the extract used. However, when 10-5 S RNA was used as a substrate tRNAG’” appeared in appreciable amounts only when RNAase III+ extracts were used ; but when RNAase IIIextracts were used, tRNAG’” appeared only in relatively low quantities. To further analyze this situation a kinetic RNA processing experiment was carried out using 1@5 S RNA as the substrate and extracts from RNAase III+ and RNAase IIIstrains (Fig. 4). When RNAase III+ extracts were used, the l@l S RNA appeared early, followed later by the three mature RNAs; no 10.1 S RNA appeared when the RNAase IIIextract was used and the level of tRNAG’” was very low indeed. Thus, it is clear that 101 S RNA is most likely the natural precursor of the three final RNAs, that 10~5 S has to be converted to 101 S by RNAase III in order to obtain the three final molecules in equal molar yields, and that in the absence of this conversion there is a significant loss of tRNAG’“. Indeed RNAase III can convert 10.5 S to 10.1 S as can be seen in Figure 5. Interestingly in this reaction only two products are observed, l@l S, plus a small fragment, which suggests that RNAase III introduces a single cleavage into the 10.5 S RNA.

RNAase

t c : c.i

III

AND

T4

625

tRNA

RNAosellI +-

RNAaselII +--

104 s-

Species

I

-

LW tRNA Gln-

Nucleotides 123

45

-

6

FIG. 3. Processing of 105 S and 10.1 S RNA molecules in vitro using RNAase III’ and RNAase IIIextracts. Processing was carried out at 37°C for 1 h. Each assay, in 50 ~1, contained 20 pg of S30 protein and 1 rg of carrier (yeast) RNA. Lanes 1 and 7 contain substrates but no enzyme. In lanes 1 to 6,1@5 S RNA was the substrate, while in lanes 7 to 12, l@l S RNA was the substrate. The reaction mixtures were pre-incubated at 37°C for 5 min without enzyme. To each slot 3000 cts/min were applied. Lanes 2 and 8 contained extracts from strain N2076 (mc+); 3 and 9 contained extracts from strain N2077 (vz); 4 and 10. N7060 (me’); 5 and 11, N2069 (me); 6 and 12, N2859 (me). The samples were applied to a 5°?0/109/, tandem polyacrylamide gel containing 7 iv-urea; only the 10% portion of the gel is shown, The gel was dried and exposed for 10 h to an X-ray film in the presence of an intensifying acreen at - 80°C.

4. Discussion The experiments presented here clearly suggest that RNAase III has a role in processing of T4 tRNA. These experiments show that RNAase III introduces a cleavage in the T4 transcript of the tRNA cluster j:r:t six nucleotides before the start of the first tRNA (Fig. 6). We believe that a similar cleavage is introduced by RNAase III in the wild-type T4 into the RNA transcript from the tRNA cluster. We assume this, since A27 is an internal deletion which does not affect the first two tRNAs of the cluster. Moreover, using wild-type T4, only the production of tRNA”‘” is diminished as compared to the other tRNAs (M&lain, 1979; and our own unpublished observations), an effect that is also seen in T4427. We interpret the under-production of tRNAG’” as the result of competition between alternative pathways for the processing of the initial transcript: one pathway involves

626

B.

Time (min)

I

IO

20

PRAGAI

RNAaseDI+ 30 40

AND

D.

APIRION RNAaseItI-

50

60

I I

IO

20

30

40

50

IO.5 s IO-1s -

P2Spl-

KplSplSPl Spl-

Gin -

)tides

-

Frc. 4. Kinetic analysis of processing of 105 S RNA in vitro using extracts from +-nc+ (N7060) and rnc (N2069) strains. The 10.5 S RNA was incubated at 30°C (Gegenheimer & Apirion, 198Oa), the protein concentration was 200 pg/ml in the presence of 20 pg carrier RNA/ml. At the indicated times samples were withdrawn and the reaction was terminated by adding 6 x sample buffer (Ray & Apirion, 1981) followed immediately by heating the reaction mixtures at 90°C for 3 min.

RNAase III cleavage while the other relies on a non-specific nuclease(s) (see below). In Figure 6 a possible secondary structure is suggested for the 5’ end of 10.5 S RNA ; we do not know whether or not such a structure actually exists. However, it is rather certain that the RNAase III cleavage occurs at or near a double-stranded region in the RNA molecule. All the unique T, oligonucleotides which appear in 16.5 S, but not in 161 S RNA (Fig. 1 and Table 1). but for the 5’ end of the 165 S RNA. can bederived from this structure. (The sequence of the RNA was derived from a DNA sequence; K. Fukada & J. Abelson, personal communication.) We would like to suggest that the cut by RNAase III is obligatory for further processing the RNA molecule by the next enzyme which cleaves the molecule at or near the 3’ end of tRNAL”” (Fig. 6) giving rise to the tRNAGlnmL”” dimer (species K). We refer to this enzyme as RNAase F. In the absence of RNAase III another enzyme(s) must cut some part of the 165 S RNA to make it accessible to the next processing enzyme (RNAase F). This “other enzyme(s)” is probably a non-specific nuclease which can digest the 165 S RNA in a number of places. When the

RNAase

III

AND

T4

627

tRNA

SPl

LeU tRNA Glt-l

5’

Fragment

- Nucleotides I

2

3

4

5

FIG. 5. Processing of 10.5 S RNA in vitro by partially purified RNAase III. The assay was conducted at 37°C for 30 min using 05 pg carrier RNA. The RNAase III enzyme was a fraction (V) prepared from an RNAase III’ strain (N7060) by going through the first steps of the purification procedure of RNAase III (Dunn, 1976). Each lane contains about 5009 cts/min of 10.5 S RNA. The dried gel was exposed with an intensifying screen for 6 h at -80°C. The gel contained 7 M-urea. Lane 1, substrate incubated without enzyme; lanes 2,3, and 4 contain samples taken from reactions which include 05, 1.0 and 15 pg of the RNAase III preparation, respectively; lane 5, products of the 10.5 S RNA proceaeed by an nze+ extract (N7060). The 191 S RNA purified from an me mutant infected with T4A27 was also added to this lane.

digestion takes place before the tRNAG’” part of the molecule, tRNAG’” can be produced: when the digestion is inside the tRNAG’” part of the 105 S RNA, only tRNAL”” is produced. The data presented here indicate that also in the presence of RNAase III this non-specific nuclease(s) can attack the 195 S RNA. This is suggested by the appearance of the small fragment (below tRNAG”, see Fig. 1) in rnc+ as well as in rnc strains. (This fragment contains sequences from the 5’ end of 105 S RNA, see above.) Moreover, the level of tRNA”” is significantly lower than that of tRNAL”” even in mc+ strains (see Results and Guthrie & Scholla, 1980). This other enzyme(s) could also be responsible for the relative underproduction of tRNA”” as compared to other tRNAs in wild-type E. co& (Guthrie & Scholla, 1980). The maturation of 195 S RNA proceeds by an RNAase III cleavage forming 191 S and a 5’ fragment (Fig. 5), followed by cleavage of 101 S RNA by RNAase F, forming band K and p2Spl (Fig. 4) (p2Spl contains Spl plus the 3’ end of the 105 S molecule). The lack of RNAase III affects this reaction ; this is indicated by the fact

628

B.

AJ C c ‘C

F

- G,

C\

PRAGAI

AND

D.

C

MU b - v RNAase V’F Leu g-u /I A-@ o-4 p 1 I 8 \ y=eF RN? 4-s / ‘. A-A-WC-C- f--A-&A-UC)-/&

RNAaseF -65Nucleotides

c

A-C-A-A-AC-A-CX-U-G

/

RNAaseP

7!?

Gill

4 -Speaes (140

+-----+ Nucleotides)

-K+ (167 Nucleotides)

p2 Species

IO-1 s

<

<

APIRION

IO-5 s

I

>

> >

FIG. 6. Suggested secondary structure at the 5’ end of 1@5 8 RNA and the possible cleavage site of RNAase III. The primary sequence of the nucleotides from the 5’ end up to the RNAase III cleavage site are according to unpublished results communicated to u8 by K. Fukada and J. Abelson. All the 105 S unique oligonucleotides (see Fig. 2 and Table 1) but for the 5 end do fit precisely into this structure. The position of the RNAase III cleavage is indicated by an arrow where the 5’ end of the 10.1 S RNA starts. The structure of the 161 S RNA and the cleavage sites are according to experiments carried out by us and are to be published separately.

that we do not observe these intermediates when mc extracts are used. For instance, if the absence of the RNAase III cut had interfered only with the formation of the RNAase P cleavage near to the RNAase III site (see Fig. 6), then in RNAase IIIextracts we would have expected to see at least one of the intermediates (p2Spl), but it was not observed. In order to process 191 S RNA to the three final molecules at least five cleavages are necessary ; three of them, at the 5’ ends of each of the mature molecules, are made by RNAase P (Guthrie et al., 1974; Abelson, 1979), the other two at or near the 3’ ends of tRNAL”” and Spl RNAs are carried out by another enzyme(s) which is not RNAase E or RNAase III (B. Pragai & D. Apirion, unpublished results). We named this enzyme(s) RNAase F. An activity which can process at these positions was identified and partially purified (Watson, Gurevitz & Apirion, unpublished results). It is interesting that the level of Spl in viva is low in the me strains and, unlike the caseof tRNAG’“, Spl RNA is made but is unstable in the absence of RNAase III (see Fig. 1). This is an interesting observation, which suggests that the presence of

RNAase

III

AND

T4 tRNA

629

a processing enzyme can protect a specific RNA from degradation. In the past, we have encountered a similar phenomenon with respect to ribosomal RNA during carbon starvation, when it was found that in rnc strains the rRNA is degraded faster than in rnc+ strains (Apirion & Watson, 1974; Apirion et al., 1976). We have explained this phenomenon by assuming that a processing enzyme can bind to an RNA molecule without cleaving it if it does not contain an appropriate cleavage site. This binding can prevent other degradative enzymes from attacking the RNA. Spl RNA can be cleaved by RNAase III in vitro (Paddock & Abelson, 1973). Indeed, when 105 S or 101 S RNA was processed in vitro the level of Spl was always higher in the RNAase IIIextracts (Figs 3 and 4); therefore, it is clear that RNAase III can bind to Spl, but apparently it does not attack it in vivo. It is interesting that the role of RNAase III in the maturation of T4 tRNA and E. coZi rRNA is somewhat comparable. In both cases maturation can proceed, albeit less efficiently, in the absence of RNAase III, and in both cases RNAase III introduces an early cleavage and is not involved in the formation of any of the ends of the final mature RNA molecules (Gegenheimer et al., 1977; Gegenheimer & Apirion, 1980u,b). Thus we would like to think of RNAase III as a coarse processing enzyme, which has to be followed by fine tuning processing enzymes. In the case of T4A27 the synthesis of the three RNAs precedes their separation one from the other: such a device ensures that the other enzymes will not digest the substrate before all the molecule is transcribed. Also it ensures that the other processing enzymes will have to deal only with relatively small RNAs, and thus could increase the efficiency of the processing reactions. Because the RNA fragment which contains the 5’ end of 105 S RNA accumulates in the wild-type strain it is quite likely that the cleavage which forms the 5’ end of 10.5 S RNA takes place also in the wild-type strain. Since the promoter is about 1000 nucleotides upstream from the 5’ end of 165 S RNA (Goldfarb & Daniel, 1981). it means that the 5’ end of 165 S is created by a processing enzyme which is apparently neither of the other two known processing endonucleases, RNAase P or RNAase E. since in the absence of these two enzymes and RNAase III 165 S RNA is still formed. Thus, these studies also indicate that at least one further RNA processing endoribonuclease besides the known ones is also required for the processing of the RNA from the T4 tRNA cluster. We are most grateful to Drs J. Abelson and K. Fukada for communicating to us DNA sequences prior to publication. This study was supported by Public Health Service grants from the National Institutes of Health (GM19821, and GM25890) and the National Cancer Institute (CA 24727).

REFERENCES Abelson, J. (1979). Annu. Rev. Biochem. 48, 1035-1969. Abelson, J., Fukada, K., Johnson, P., Lamfrom, H., Nierlich, D. P., Otsuka, A., Paddock, G. Y., Pinkerton, T. C., Sarabhai, A., Stahl, S., Wilson, J. H. & Yesian, H. (1974). Brookhaven Symp. Bid. 26, 77-88. Altman, S. (1975). Cell, 4, 21-29. Apirion, D. & Gegenheimer, P. (1981). FEBS Letters, 125, l-9.

630

B. PRAGAI

AND

D.

APIRION

Apirion, D. & Watson, N. (1974). MOE. Gen. Genet. 162, 89-104. Apirion, D. & Watson, N. (1975). J. Bacterial. 124, 317-324. Apirion, D., Neil, J. & Watson, N. (1976). Mol. Gen. Genet. 144, 185190. Apirion, D., Ghora, B. K., Pleutz, G., Misra, T. & Gegenheimer, P. (1980). In Transfer RNA : BioZogicuE Aspects (SSll, D., Abelson, J. & Schimmel, P., eds), pp. 139-154, Cold Spring Harbor Laboratory, New York. Daniel, V. & Littauer, U. Z. (1970). Science, 167, 1682-1688. Dunn, J. J. (1976). J. Biol. Chem. 251, 3807-3814. Gegenheimer, P. & Apirion, D. (1978). Cell, 15, 527-539. Gegenheimer, P. & Apirion, D. (1980s). J. Mol. Biol. 143, 227-257. Gegenheimer, P. & Apirion, D. (19805). Nucl. Acids Res. 8, 1873-1891. Gegenheimer, P., Watson, N. & Apirion, D. (1977). J. BioZ. Chem. 252, 3W-3073. Ghora, B. & Apirion, D. (1978). Cell, 15, 10551066. Goldfarb, A. & Daniel, V. (1981). J. Mol. BioE. 146, 393-412. Guthrie, C. (1975). J. Mol. Biol. 95, 529-547. Guthrie, C. & Scholla, C. A. (1980). J. Mol. Biol. 139, 349-375. Guthrie, C., Seidman, J. G., Comer, M. M., Bock, R. M., Schmidt, F. J., Barrel, B. G. & McClain, W. H. (1974). Brookhaven Symp. Biol. 26, 106123. Hsu, W. T., Foft, J. W. & Weiss, S. B. (1967). Proc. Nat. Auzd. Sci., U.S.A. 58, 2028-2035. McClain, W. H. (1979). Biochem. Biophys. Res. Commun. 86, 718-724. Misra, T. K. & Apirion, D. (1979). J. Biol. Chem. 254, 11154-11159. Paddock, G. & Abelson, J. (1973). Nature New Biol. 246, 2-6. Pragai, B., Ko, T. S. & Apirion, D. (1980). B&hem. Biophys. Res. Commun. 95, 1431-1436. Ray, B. K. & Apirion, D. (1981). Eur. J. Biochem. 114, 517-524. Schedl, P. & Primakoff, P. (1973). Proc. Nat. Acad. Sci., U.S.A. 70, 209-2095. Weatherford, S. C., Rosen, L., Gorelic, L. & Apirion, D. (1972). J. Biol. Chem. 247, 54045408. Wilson, J. H. & Abelson, J. N. (1972). J. Mol. Biol. 69, 57-73. Wilson, J. H., Kim, J. S. & Abelson, J. N. (1972). J. Mol. Biol. 71, 547-556. Volckaert, G. & Fiers, W. (1977). Anal. Biochem. 83, 228-239. Volckaert, G., Min-Jou, W. & Fiers, W. (1976). Anal. Biochem. 72, 433-446.

Edited by S. Brenner