- Email: [email protected]
Production and characterisation of transgenic cauliflower plants containing abnormal chloroplasts
Scientia Horticulturae 164 (2013) 409–413
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Production and characterisation of transgenic cauliflower plants containing abnormal chloroplasts Veera R.N. Chikkala ∗ , Gregory D. Nugent, David M. Stalker, Trevor W. Stevenson School of Applied Sciences, Biotechnology and Environmental Biology, RMIT University, Building 223, Level 1, Plenty Road, Bundoora, Victoria 3083, Australia
a r t i c l e
i n f o
Article history: Received 6 February 2013 Received in revised form 5 September 2013 Accepted 22 September 2013 Keywords: Chloroplasts Chloroplast division Protoplasts PEG mediated transformation
a b s t r a c t Macrochloroplasts, which can be produced by the imbalance expression of plastid division genes, may act as an alternative target tissue for the transformation of foreign genes especially by particle bombardment. This paper reports the production of stable transgenic cauliflower plants expressing cauliflower plastid division gene, BoMinD by using PEG mediated transformation of mesophyll protoplasts. Stable transgenic BoMinD cauliflower plants had abnormally shaped chloroplasts but these did not exhibit a true macrochloroplast or minichloroplast phenotype. Transgene number did not relate to the expression of the BoMinD transgene. Detection of total BoMinD by western blot suggests that the slight increase in total BoMinD levels resulted in honey-comb or doughnut shaped chloroplasts and irregular surface membrane chloroplasts. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Cauliflower (Brassica oleracea var. botrytis) is one of the most important vegetable brassicas, in a family that includes broccoli, Brussels sprouts, cabbage, kale and kohlrabi. Transforming plant cells, often with agronomically important traits, has become a powerful tool for crop improvement and to study gene function and regulation (Cardoza and Stewart, 2004; Dunwell, 2000; Herbers and Sonnewald, 1999; Mazur et al., 1999). Since the first report of transgenic vegetable brassicas in the late 1980s, genetic engineering of vegetable brassicas has now progressed to the stage where agronomically useful traits have been introduced into both the nuclear and plastid genomes (Cardoza and Stewart, 2004; Hou et al., 2003; Liu et al., 2007). Cauliflower has been transformed via Agrobacterium tumefaciens (Bhalla and Nicole, 1998; Chakrabarty et al., 2002), A. rhizogenes (David and Tempé, 1988) and through direct DNA uptake into hypocotyl protoplasts (Mukhopadhyay et al., 1991; Xue et al., 1997) or mesophyll protoplasts (Eimert and Siegemund, 1992; Nugent et al., 2006; Radchuk et al., 2002). Apart from transient expression data in broccoli (Puddephat et al., 1999) there are no reports of nuclear transformants of Brassica oleracea via biolistics, although biolistics has been used to produce plastid transformants of B. napus (Hou et al., 2003) and B. campestris (Liu et al., 2007). Nevertheless, cauliflower plastid transformation has been reported using PEG-mediated transformation in mesophyll protoplasts (Nugent et al., 2006).
MinD1 is one of the important components of the plastid division apparatus required for the correct chloroplast division in A. thaliana and tobacco (Chikkala et al., 2012; Colletti et al., 2000; Dinkins et al., 2001; Kanamaru et al., 2000). Overexpression of AtMinD1 in transgenic A. thaliana and tobacco resulted in a phenotype of only a few large chloroplasts per cell (Chikkala et al., 2012; Colletti et al., 2000; Dinkins et al., 2001; Kanamaru et al., 2000), whereas antisense expression of AtMinD1 in A. thaliana resulted in smaller chloroplasts due to FtsZ-ring misplacement and asymmetric plastid division (Colletti et al., 2000). MinD has been identified in A. thaliana (Colletti et al., 2000), tobacco (Jin et al., 2007), marigold (Moehs et al., 2001) and cauliflower (Chikkala et al., 2012). We are interested in generating altered plastid division phenotypes in crop plants that may provide an alternative target tissue for the transformation of foreign genes to achieve homoplasmy efficiently, especially by particle bombardment (Bogorad, 2000; Chikkala et al., 2012) and have chosen Brassica as a model. In this study we describe the generation of stable transgenic cauliflower plants with the plastid division gene from cauliflower, BoMinD by PEG-mediated mesophyll protoplast transformation. Stable BoMinD transgenic cauliflower plants had abnormally shaped chloroplasts but do not display a true macrochloroplast phenotype due to insufficient total increase of BoMinD protein.
2. Materials and methods 2.1. Plant material
∗ Corresponding author. Tel.: +61 39925 7141; fax: +61 39925 7100. E-mail address: [email protected] (V.R.N. Chikkala). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.09.041
Cauliflower cultivar, Thalassa was obtained from Clause Tezier Australia (Melbourne, Australia). Surface sterilised seeds were
410
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
germinated on half strength MS (Murashige and Skoog, 1962) medium and the shoot cultures were maintained on MS medium in vented glass containers (C956, Phytotechnology Labs, US) (Chikkala et al., 2009).
then CDP-Star (Roche Applied Sciences) was used as a chemiluminescent substrate and the signals were visualised by exposure to Amersham HyperfilmTM ECL film for 5–10 min and the film was then developed.
2.2. Construction of cauliflower nuclear transformation plasmid
2.4.3. Western blotting To estimate total BoMinD levels in transgenic cauliflower plants, total soluble protein (TSP) was extracted from the leaves of WT A. thaliana, tobacco and cauliflower and also from the transgenic cauliflower leaves by snap freezing in liquid nitrogen and crushing them with a conical grinder in 400 l of ice cold protein extraction buffer (60 mM Tris–HCl pH 8.0, 500 mM NaCl, 10 mM EDTA, 30 mM -mercaptoethanol, 0.1 mM PMSF). After centrifugation for 15 min at 10,000 × g at 4 ◦ C, the supernatant was recovered and TSP was quantified by using the Bio-Rad Protein Assay (Bio-Rad, USA). Proteins were denatured by heating at 95 ◦ C for 5 min and then loaded onto a 12% (w/v) SDS-PAGE. Proteins separated by SDS-PAGE, were transferred onto a nitrocellulose membrane using an iBlotTM Gel Transfer System (Invitrogen). Membranes were blocked for 1 h in blocking solution [1× TBST pH 7.4, 4% (w/v) dried skim milk powder]. The primary antibody wash was performed with the rabbit polyclonal anti-MinD antibody (1:5000) (Nakanishi et al., 2009) for 1 h, followed by 1 h incubation with anti-rabbit Ig G Fc HRP Conjugate (Promega). The blot was rinsed twice in TBST for 5 min in between each step and at the end before adding the detection substrate, which contained luminol, iodophenol and H2 O2 (Sigma). Blots were then exposed to Amersham HyperfilmTM ECL film for 5 min and then developed.
Cauliflower nuclear transformation plasmid was constructed using pBluescript (3 kb) (Agilent Technologies, US), an hptII cassette (2.9 kb) from pCAMBIA1303 and a BoMinD cassette (3 kb) from pNAV42 + BoMinD (Chikkala et al., 2012). Firstly, the hptII cassette from pCAMBIA1303 was cloned into pBluescript using SacI and SacII restriction enzymes, then the BoMinD cassette from pNAV42 + BoMinD was cloned into pBluescript + hptII using XbaI and Asp7181 restriction enzymes (Fig. 1A). 2.3. PEG-mediated nuclear transformation of cauliflower Cauliflower leaf mesophyll protoplast isolation of cv. Thalassa and PEG mediated transformation were performed as described in Chikkala et al. (2009) and Nugent et al. (2006) respectively. 2.4. Molecular analysis of transgenic cauliflower plants 2.4.1. PCR and RT-PCR Putative cauliflower shoots were screened via PCR with primers specific to hptII and BoMinD. For RT-PCR analysis, total RNA from transgenic cauliflower plants was isolated using RNeasy Plant mini kit (Qiagen Inc., Valencia, CA, USA) with on-column DNase digestion. Complementary DNA (cDNA) was synthesised from 1 g of total RNA using MMLV reverse transcriptase (Promega, USA) with an oligo(dT)18 primer and RT-PCR was initiated using BoMinD For 5 GCCCTAGCAGCAGACGGC 3 and Rev 5 CGTGACCCTGTCCGCGTC 3 and also using BoMinDRT For 5 TCTGCGGCCATGGCGATTAGTCCGTTGGCCCAGC 3 and E9 ter Rev 5 GCCGCCAAAGAAAGAGAAGAAG 3 primers. A control gene fragment (Brassica actin) was amplified using actin For 5 CCGAGAGAGGTTACATGTTCACCAC 3 and actin Rev 5 GCTGTGATCTCTTTGCTCATACGGTC 3 primers. 2.4.2. Southern blotting Genomic DNA was isolated from transgenic cauliflower leaves according to a modified Frey method (Frey, 1999). Total genomic DNA (25 g) was digested overnight with XbaI restriction enzyme. The digested DNA was ethanol-precipitated and resuspended in 20 l of TE, then fractionated in a 0.8% agarose 1× TAE gel at 59 V for 5 h and transferred overnight onto a nylon membrane (Hybond-N+, Amersham) using 0.4 M NaOH (Alkali transfer). Five microlitres of DIG-labelled DNA molecular weight marker was used for band size detection along with the positive control (cloning vector harbouring BoMinD). Digoxygenin (DIG) labelled probes were generated from plasmid DNA by PCR using the DIG High Prime kit (Roche Applied Sciences, Mannheim, Germany). DIG labelled probe (20 ng) was denatured by heating to 95 ◦ C for 5 min and then rapidly chilled. The denatured probe was added to 20 ml of pre-heated DIG Easy Hyb Buffer and used as the hybridisation solution. After the 16 h incubation of membrane with probe, the membrane was washed twice in low stringency buffer (2% SSC + 0.1% SDS) at room temperature and twice in high stringency buffer (0.5% SSC + 0.1% SDS) at 65 ◦ C. Then the membrane was blocked in 100 ml of blocking solution (Roche Applied Sciences) for 30 min and 20 ml of antiDigoxigenin-antibody (Roche Applied Sciences) diluted 1:5000 in blocking solution was added to the membrane for 30 min. The antibody solution was poured off and the membrane was washed for 30 min in washing buffer (Roche Applied Sciences). Membrane was incubated for 5 min in a detection buffer (Roche Applied Sciences),
2.4.4. Microscopy Protoplasts were isolated from cauliflower plants using an enzyme solution [10 mM CaCl2 , 0.6 M mannitol, 10 mM MES, macerozyme (1%, w/v) and Cellulase Onozuka R-10 (2% w/v)]. Cellulases were sourced from Austratec Pty. Ltd. (Kilsyth, Australia). Leaf slices were incubated in the enzyme solution at 24 ◦ C for 16 h. Protoplasts were pelleted at 60 × g then resuspended in W5 solution (Menczel et al., 1981). Chloroplast phenotypes were observed in protoplasts, leaf samples or epidermal peels of leaves via a BH2 Epi-fluorescence microscope (Olympus) using UV or bright field illumination. Images were captured with a MOTIC camera and software (DC Imaging, LLC, USA). 3. Results and discussion Chloroplast division in stable BoMinD transgenic cauliflower has been disrupted due to the imbalanced expression of total BoMinD; however a true macrochloroplast phenotype was not obtained in transgenic cauliflower probably due to insufficient BoMinD expression levels in the transgenics. Leaf mesophyll protoplasts from cv. Thalassa were used for PEG-mediated transformation with the BoMinD plasmid. A total of 2 × 106 protoplasts were treated with BoMinD plasmid resulting in 6 hygromycin resistant putative transgenic plants (Fig. 1B and C) giving an absolute transformation frequency (number of transgenic shoots per number of treated protoplasts) of 0.3 × 10−5 , which is equal to or slightly lower than the frequency of 0.3 to 1.3 × 10−5 reported by Nugent et al. (2006) but is however much higher than the frequency of 0.05 × 10−5 as reported by Radchuk et al. (2002). Furthermore, fully developed transformed BoMinD cauliflower plants exhibited no morphological/physiological differences to WT cauliflower plants (Fig. 1C). Analysis via PCR with hptII and BoMinD specific primers indicated that all 6 BoMinD transgenic cauliflower lines (CM1–CM6) were positive for the presence of the two transgenes (data not shown). Further analysis of stable BoMinD transgenic cauliflower plants by Southern blotting and RTPCR was performed using BoMinDRT For and E9-ter Rev primers
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
411
Fig. 1. Generation and molecular analysis of stable BoMinD transgenic cauliflower plants. (A) Cauliflower nuclear transformation plasmid. (B) Hygromycin resistant embryos at 45 days (Bar = 1 cm) resulted by the PEG mediated transformation of the BoMinD. (C) Fully developed plantlets of WT (MS0) and BoMinD transgenic cauliflower line, CM5 (MS0 + hygromycin). (D) Southern blot of XbaI digested genomic DNA extracts of the BoMinD transgenic lines to determine copy number probed with BoMinDRT2 For and E9 ter Rev primers. (E) RT-PCR analysis of BoMinD transgenic plants with actin (Brassica), BoMinD and BoMinDRT For and E9 ter Rev primers. (F) Western blot analysis of BoMinD transgenic cauliflower plants with AtMinD antibodies. M = 1 kb ladder, + = positive control, WT = non-transgenic plant, CM1, CM2, CM3, CM4, CM5 & CM6 are the BoMinD transgenic cauliflower lines. For Western blot analysis, 50 g of total soluble protein from WT A. thaliana, tobacco and cauliflower TSP was used and 20 g of TSP from transgenic cauliflower lines was used.
that detects only transgene BoMinD but not endogenous BoMinD (Fig. 1D and E). Southern blotting of transgenic lines showed that, CM1 and CM6 lines contained five and three copies of the BoMinD transgene respectively, while CM4 and CM5 lines contained two transgene inserts (Fig. 1D). Gene expression analysis, by RT-PCR (Fig. 1E) and also measurement of BoMinD by western blot (Fig. 1F)
indicated that the transgene number did not relate to the BoMinD transgene expression, particularly in transgenic events CM4, CM5 and CM6 lines as the transgene expression is dependent on many factors such as; promoter strength, transgene integration site and also on the number of transgene integrations (Stam et al., 1997; Matzke and Matzke, 1998). Though there were good levels of total
412
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
BoMinD transcript in transgenic cauliflower (CM1–CM6) lines using RT-PCR with BoMinD primers, there was only weak BoMinD transgene expression detected in CM4, CM5 and CM6 lines with BoMinD For and E9-ter Rev primers (Fig. 1E). Examination of BoMinD levels by western blotting with anti-MinD antibody also showed very low BoMinD levels in stable BoMinD transgenic cauliflower lines (Fig. 1F). Abnormal (honeycomb shaped) chloroplasts and irregular membrane shaped chloroplasts were not observed in the transgenic tobacco plants with BoMinD (Chikkala et al., 2012). However, macrochloroplast phenotypes were obtained by using the same BoMinD expression cassette when used to transform tobacco (Chikkala et al., 2012). This may be due to use of the tobacco NtrbcS promoter for the BoMinD transgene expression in the heterologous species, in this case cauliflower. It has been shown that rbcS promoters from different sources express recombinant genes at different levels in heterologous species, depending upon the promoter length and the presence or absence of regulatory sequences like matrix-attachment regions (MAR), cis-acting elements, I-box and G-box, all of which are important for tissue specific gene expression (Song et al., 2000). Heterologous expression of gus by the tomato rbcS promoter in cauliflower was 10 times lower than the CaMV35S promoter (Baranski and Puddephat, 2004). The NtrbcS promoter used in this study for BoMinD transgene expression in cauliflower may lack some regulatory factors required for the correct regulation of expression in cauliflower. However, BoMinD transgenic cauliflower chloroplasts look slightly larger than WT chloroplasts but the number of chloroplasts per cell was similar to WT plants. It has been reported that in order to generate chloroplast abnormality, transgene expression must produce 3 times the level of native plastid division protein levels (Stokes et al., 2000). Out of the six BoMinD transgenic cauliflower lines, three lines (CM1, CM2 and CM3) showed no difference to WT chloroplast phenotype but the other three lines (CM4, CM5 and CM6) showed abnormal chloroplasts with a doughnut-like shape or with an irregular chloroplast membrane (Fig. 2A and B). The abnormal chloroplasts in transgenic cauliflower plants were typically dispersed throughout the cells, whereas the WT chloroplasts were mainly on the cell periphery (Fig. 2A and B). Chloroplasts with irregularly shaped membranes were observed in A. thaliana arc11 mutants complemented with AtMinD1 and expression of the AtMinD1 was at level slightly higher than those in the WT plants (Fujiwara et al., 2004). In addition, AtMinD1 (A296G) transgenic plants showed vacuolated chloroplasts (Fujiwara et al., 2004). Though BoMinD does not have a sequence difference at the 296 position (A296G) when compared to AtMinD1, the honey-comb shaped chloroplasts and irregular surface membrane chloroplasts may have arisen due to the slight increase of BoMinD expression levels. This tends to indicate that BoMinD functions similarly to AtMinD1 and regulates chloroplast division and chloroplast envelope membrane morphology, either directly or indirectly, depending upon expression levels (Chikkala et al., 2012; Fujiwara et al., 2004). In conclusion, stable transgenic cauliflower plants carrying BoMinD were obtained that exhibited honey-comb shaped chloroplasts and irregular membrane shaped chloroplasts that appear to be due to an insufficient total increase of BoMinD. Macrochloroplasts in cauliflower might be generated a number of ways; by expressing plastid division genes at higher levels, perhaps by using a stronger constitutive promoter such as the CaMV35S or using a BoMinD promoter (Dinkins et al., 2001; Stokes et al., 2000), by the antisense expression of plastid division genes (Osteryoung et al., 1998; Colletti et al., 2000) or by RNAi technology (Khraiwesh et al., 2008; Raynaud et al., 2005). Transgenic cauliflower plants bearing abnormal chloroplast phenotypes may prove useful in various fundamental studies of cell biology and plant biotechnology
Fig. 2. Fluorescence microscopy images of leaf samples of mesophyll chloroplasts and isolated protoplasts of WT and BoMinD transgenic cauliflower. (A) Leaf samples of WT mesophyll chloroplasts and BoMinD transgenic cauliflower honeycomb shaped chloroplasts. (B) Bright and fluorescence images of WT mesophyll chloroplasts and BoMinD transgenic cauliflower (CM5) mesophyll chloroplasts with serrated edges. Arrow shows the serrate edged chloroplasts. Magnification = 100× (leaf samples) and 1000× (protoplasts), Bar = 10 M.
such as imaging ion fluxes, targeting proteins to various internal chloroplast compartments, CO2 uptake studies, observing the effect of different abiotic stresses on these plants and expressing foreign proteins in macrochloroplast plants by plastid transformation.Acknowledgement Antibodies for AtMinD were generously provided by Dr. Shin-ya Miyagishima (RIKEN, Japan). References Baranski, R., Puddephat, I., 2004. Tissue specific expression of -glucuronidase gene driven by heterologous promoters in transgenic cauliflower plants. Acta Physiol. Plant 26, 307–315. Bhalla, P.L., Nicole, S., 1998. Agrobacterium tumefaciens-mediated transformation of cauliflower, Brassica oleracea var. botrytis. Mol. Breed. 4, 531–541. Bogorad, L., 2000. Engineering chloroplasts: an alternative site for foreign genes, proteins, reactions and products. Trends Biotechnol. 18, 257–263. Cardoza, V., Stewart, C., 2004. Brassica biotechnology: progress in cellular and molecular biology. In Vitro Cell Dev. Biol. Plant 40, 542–551. Chakrabarty, R., Viswakarma, N., Bhat, S., Kirti, P., Singh, B., Chopra, V., 2002. Agrobacterium-mediated transformation of cauliflower: Optimization of protocol and development of Bt-transgenic cauliflower. J. Biosci. 27, 495–502. Chikkala, V.R.N., Nugent, G., Stalker, D., Mouradov, A., Stevenson, T., 2012. Expression of Brassica oleracea FtsZ1-1 and MinD alters chloroplast division in Nicotiana tabacum generating macro- and mini-chloroplasts. Plant Cell Rep. 31, 917–928.
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413 Chikkala, V.R.N., Nugent, G., Dix, P., Stevenson, T., 2009. Regeneration from leaf explants and protoplasts of Brassica oleracea var. botrytis (cauliflower). Sci. Horti. 119, 330–334. Colletti, K.S., Tattersall, E.A., Pyke, K.A., Froelich, J.E., Stokes, K.D., Osteryoung, K.W., 2000. A homologue of the bacterial cell division site-determining factor MinD mediates placement of the chloroplast division apparatus. Curr. Biol. 10, 507–516. David, C., Tempé, J., 1988. Genetic transformation of cauliflower (Brassica oleracea L. var. Botrytis) by Agrobacterium rhizogenes. Plant Cell Rep. 7, 88–91. Dinkins, R., Reddy, S., Leng, M., Collins, G., 2001. Overexpression of the Arabidopsis thaliana MinD1 gene alters chloroplast size and number in transgenic tobacco plants. Planta 214, 180–188. Dunwell, J.M., 2000. Transgenic approaches to crop improvement. J. Exp. Bot. 51, 487–496. Eimert, K., Siegemund, F., 1992. Transformation of cauliflower (Brassica oleracea L. var. botrytis) – an experimental survey. Plant Mol. Biol. 19, 485–490. Frey, J.E., 1999. Genetic flexibility of plant chloroplasts. Nature 398, 115–116. Fujiwara, M.T., Nakamura, A., Itoh, R., Shimada, Y., Yoshida, S., Møller, S.G., 2004. Chloroplast division site placement requires dimerization of the ARC11/AtMinD1 protein in Arabidopsis. J. Cell Sci. 117, 2399–2410. Herbers, K., Sonnewald, U., 1999. Production of new/modified proteins in transgenic plants. Curr. Opin. Biotechnol. 10, 163–168. Hou, B.K., Zhou, Y.H., Wan, L.H., Zhang, Z.L., Shen, G.F., Chen, Z.H., Hu, Z.M., 2003. Chloroplast transformation in oilseed rape. Trans. Res. 12, 111–114. Jin, Y., Ma, D., Dong, J., Li, D., Deng, C., Jin, J., Wang, T., 2007. The HC-Pro protein of potato virus Y interacts with NtMinD of tobacco. Mol. Plant Microbe Interact. 20, 1505–1511. Kanamaru, K., Fujiwara, M., Kim, M., Nagashima, A., Nakazato, E., Tanaka, K., Takahashi, H., 2000. Chloroplast targeting, distribution and transcriptional fluctuation of AtMinD1, a eubacteria-type factor critical for chloroplast division. Plant Cell Physiol. 41, 1119–1128. Khraiwesh, B., Ossowski, S., Weigel, D., Reski, R., Frank, W., 2008. Specific gene silencing by artificial microRNAs in Physcomitrella patens: an alternative to targeted gene knockouts. Plant Physiol. 148, 684–693. Liu, C.W., Lin, C.C., Chen, J., Tseng, M.J., 2007. Stable chloroplast transformation in cabbage (Brassica oleracea L. var. capitata L.) by particle bombardment. Plant Cell Rep. 26, 1733–1744. Matzke, A.J.M., Matzke, M.A., 1998. Position effects and epigenetic silencing of plant transgenes. Curr. Opin. Plant Biol. 1, 142–148. Mazur, B., Krebbers, E., Tingey, S., 1999. Gene discovery and product development for grain quality traits. Science 285, 372–375.
413
Menczel, L., Nagy, F., Kiss, Z.R., Maliga, P., 1981. Streptomycin resistant and sensitive somatic hybrids of Nicotiana tabacum + Nicotiana knightiana: correlation of resistance to N. tabacum plastids. Theor. Appl. Genet. 59, 191–195. Moehs, C.P., Tian, L., Osteryoung, K.W., Dellapenna, D., 2001. Analysis of carotenoid biosynthetic gene expression during marigold petal development. Plant Mol. Biol. 45, 281–293. Mukhopadhyay, A., Töpfer, R., Pradhan, A., Sodhi, Y., Steinbiß, H.-H., Schell, J., Pental, D., 1991. Efficient regeneration of Brassica oleracea hypocotyl protoplasts and high frequency genetic transformation by direct DNA uptake. Plant Cell Rep. 10, 375–379. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15, 473–497. Nakanishi, H., Suzuki, K., Kabeya, Y., Miyagishima, S., 2009. Plant-specific protein MCD1 determines the site of chloroplast division in concert with cacteriaderived MinD. Curr. Biol. 19, 151–156. Nugent, G.D., Coyne, S., Nguyen, T.T., Kavanagh, T.A., Dix, P.J., 2006. Nuclear and plastid transformation of Brassica oleracea var. botrytis (cauliflower) using PEGmediated uptake of DNA into protoplasts. Plant Sci. 170, 135–142. Osteryoung, K.W., Stokes, K.D., Rutherford, S.M., Percival, A.L., Lee, W.Y., 1998. Chloroplast division in higher plants requires members of two functionally divergent gene families with homology to bacterial ftsZ. Plant Cell 10, 1991–2004. Puddephat, I.J., Thompson, N., Robinson, H.T., Sandhu, P., Henderson, J., 1999. Biolistic transformation of broccoli (Brassica oleracea var. italica) for transient expression of the -glucuronidase gene. J. Horti. Sci. Biotech. 74, 714–720. Radchuk, V.V., Ryschka, U., Schumann, G., Klocke, E., 2002. Genetic transformation of cauliflower (Brassica oleracea var. botrytis) by direct DNA uptake into mesophyll protoplasts. Physiol. Plant 114, 429–438. Raynaud, C., Perennes, C., Reuzeau, C., Catrice, O., Brown, S., Bergounioux, C., 2005. Cell and plastid division are coordinated through the prereplication factor AtCDT1. Proc. Natl. Acad. Sci. USA 102, 8216–8221. Song, P., Heinen, L.J., Burns, T.H., Allen, R.D., 2000. Expression of two tissue-specific promoters in transgenic cotton plants. J. Cotton Sci. 4, 217–223. Stam, M., Mol, J.N.M., Kooter, J.M., 1997. The silence of genes in transgenic plants. Ann. Bot. 79, 3–12. Stokes, K.D., McAndrew, R.S., Figueroa, R., Vitha, S., Osteryoung, K.W., 2000. Chloroplast division and morphology are differentially affected by overexpression of FtsZ1 and FtsZ2 genes in Arabidopsis. Plant Physiol. 124, 1668–1677. Xue, H.W., Wei, Z.M., Xu, Z.H., 1997. Regeneration of transgenic plants of Brassica oleracea via PEG-mediated gene transformation. Acta Bot. Sin. 39, 28–33 (in Chinese).
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Production and characterisation of transgenic cauliflower plants containing abnormal chloroplasts Veera R.N. Chikkala ∗ , Gregory D. Nugent, David M. Stalker, Trevor W. Stevenson School of Applied Sciences, Biotechnology and Environmental Biology, RMIT University, Building 223, Level 1, Plenty Road, Bundoora, Victoria 3083, Australia
a r t i c l e
i n f o
Article history: Received 6 February 2013 Received in revised form 5 September 2013 Accepted 22 September 2013 Keywords: Chloroplasts Chloroplast division Protoplasts PEG mediated transformation
a b s t r a c t Macrochloroplasts, which can be produced by the imbalance expression of plastid division genes, may act as an alternative target tissue for the transformation of foreign genes especially by particle bombardment. This paper reports the production of stable transgenic cauliflower plants expressing cauliflower plastid division gene, BoMinD by using PEG mediated transformation of mesophyll protoplasts. Stable transgenic BoMinD cauliflower plants had abnormally shaped chloroplasts but these did not exhibit a true macrochloroplast or minichloroplast phenotype. Transgene number did not relate to the expression of the BoMinD transgene. Detection of total BoMinD by western blot suggests that the slight increase in total BoMinD levels resulted in honey-comb or doughnut shaped chloroplasts and irregular surface membrane chloroplasts. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Cauliflower (Brassica oleracea var. botrytis) is one of the most important vegetable brassicas, in a family that includes broccoli, Brussels sprouts, cabbage, kale and kohlrabi. Transforming plant cells, often with agronomically important traits, has become a powerful tool for crop improvement and to study gene function and regulation (Cardoza and Stewart, 2004; Dunwell, 2000; Herbers and Sonnewald, 1999; Mazur et al., 1999). Since the first report of transgenic vegetable brassicas in the late 1980s, genetic engineering of vegetable brassicas has now progressed to the stage where agronomically useful traits have been introduced into both the nuclear and plastid genomes (Cardoza and Stewart, 2004; Hou et al., 2003; Liu et al., 2007). Cauliflower has been transformed via Agrobacterium tumefaciens (Bhalla and Nicole, 1998; Chakrabarty et al., 2002), A. rhizogenes (David and Tempé, 1988) and through direct DNA uptake into hypocotyl protoplasts (Mukhopadhyay et al., 1991; Xue et al., 1997) or mesophyll protoplasts (Eimert and Siegemund, 1992; Nugent et al., 2006; Radchuk et al., 2002). Apart from transient expression data in broccoli (Puddephat et al., 1999) there are no reports of nuclear transformants of Brassica oleracea via biolistics, although biolistics has been used to produce plastid transformants of B. napus (Hou et al., 2003) and B. campestris (Liu et al., 2007). Nevertheless, cauliflower plastid transformation has been reported using PEG-mediated transformation in mesophyll protoplasts (Nugent et al., 2006).
MinD1 is one of the important components of the plastid division apparatus required for the correct chloroplast division in A. thaliana and tobacco (Chikkala et al., 2012; Colletti et al., 2000; Dinkins et al., 2001; Kanamaru et al., 2000). Overexpression of AtMinD1 in transgenic A. thaliana and tobacco resulted in a phenotype of only a few large chloroplasts per cell (Chikkala et al., 2012; Colletti et al., 2000; Dinkins et al., 2001; Kanamaru et al., 2000), whereas antisense expression of AtMinD1 in A. thaliana resulted in smaller chloroplasts due to FtsZ-ring misplacement and asymmetric plastid division (Colletti et al., 2000). MinD has been identified in A. thaliana (Colletti et al., 2000), tobacco (Jin et al., 2007), marigold (Moehs et al., 2001) and cauliflower (Chikkala et al., 2012). We are interested in generating altered plastid division phenotypes in crop plants that may provide an alternative target tissue for the transformation of foreign genes to achieve homoplasmy efficiently, especially by particle bombardment (Bogorad, 2000; Chikkala et al., 2012) and have chosen Brassica as a model. In this study we describe the generation of stable transgenic cauliflower plants with the plastid division gene from cauliflower, BoMinD by PEG-mediated mesophyll protoplast transformation. Stable BoMinD transgenic cauliflower plants had abnormally shaped chloroplasts but do not display a true macrochloroplast phenotype due to insufficient total increase of BoMinD protein.
2. Materials and methods 2.1. Plant material
∗ Corresponding author. Tel.: +61 39925 7141; fax: +61 39925 7100. E-mail address: [email protected] (V.R.N. Chikkala). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.09.041
Cauliflower cultivar, Thalassa was obtained from Clause Tezier Australia (Melbourne, Australia). Surface sterilised seeds were
410
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
germinated on half strength MS (Murashige and Skoog, 1962) medium and the shoot cultures were maintained on MS medium in vented glass containers (C956, Phytotechnology Labs, US) (Chikkala et al., 2009).
then CDP-Star (Roche Applied Sciences) was used as a chemiluminescent substrate and the signals were visualised by exposure to Amersham HyperfilmTM ECL film for 5–10 min and the film was then developed.
2.2. Construction of cauliflower nuclear transformation plasmid
2.4.3. Western blotting To estimate total BoMinD levels in transgenic cauliflower plants, total soluble protein (TSP) was extracted from the leaves of WT A. thaliana, tobacco and cauliflower and also from the transgenic cauliflower leaves by snap freezing in liquid nitrogen and crushing them with a conical grinder in 400 l of ice cold protein extraction buffer (60 mM Tris–HCl pH 8.0, 500 mM NaCl, 10 mM EDTA, 30 mM -mercaptoethanol, 0.1 mM PMSF). After centrifugation for 15 min at 10,000 × g at 4 ◦ C, the supernatant was recovered and TSP was quantified by using the Bio-Rad Protein Assay (Bio-Rad, USA). Proteins were denatured by heating at 95 ◦ C for 5 min and then loaded onto a 12% (w/v) SDS-PAGE. Proteins separated by SDS-PAGE, were transferred onto a nitrocellulose membrane using an iBlotTM Gel Transfer System (Invitrogen). Membranes were blocked for 1 h in blocking solution [1× TBST pH 7.4, 4% (w/v) dried skim milk powder]. The primary antibody wash was performed with the rabbit polyclonal anti-MinD antibody (1:5000) (Nakanishi et al., 2009) for 1 h, followed by 1 h incubation with anti-rabbit Ig G Fc HRP Conjugate (Promega). The blot was rinsed twice in TBST for 5 min in between each step and at the end before adding the detection substrate, which contained luminol, iodophenol and H2 O2 (Sigma). Blots were then exposed to Amersham HyperfilmTM ECL film for 5 min and then developed.
Cauliflower nuclear transformation plasmid was constructed using pBluescript (3 kb) (Agilent Technologies, US), an hptII cassette (2.9 kb) from pCAMBIA1303 and a BoMinD cassette (3 kb) from pNAV42 + BoMinD (Chikkala et al., 2012). Firstly, the hptII cassette from pCAMBIA1303 was cloned into pBluescript using SacI and SacII restriction enzymes, then the BoMinD cassette from pNAV42 + BoMinD was cloned into pBluescript + hptII using XbaI and Asp7181 restriction enzymes (Fig. 1A). 2.3. PEG-mediated nuclear transformation of cauliflower Cauliflower leaf mesophyll protoplast isolation of cv. Thalassa and PEG mediated transformation were performed as described in Chikkala et al. (2009) and Nugent et al. (2006) respectively. 2.4. Molecular analysis of transgenic cauliflower plants 2.4.1. PCR and RT-PCR Putative cauliflower shoots were screened via PCR with primers specific to hptII and BoMinD. For RT-PCR analysis, total RNA from transgenic cauliflower plants was isolated using RNeasy Plant mini kit (Qiagen Inc., Valencia, CA, USA) with on-column DNase digestion. Complementary DNA (cDNA) was synthesised from 1 g of total RNA using MMLV reverse transcriptase (Promega, USA) with an oligo(dT)18 primer and RT-PCR was initiated using BoMinD For 5 GCCCTAGCAGCAGACGGC 3 and Rev 5 CGTGACCCTGTCCGCGTC 3 and also using BoMinDRT For 5 TCTGCGGCCATGGCGATTAGTCCGTTGGCCCAGC 3 and E9 ter Rev 5 GCCGCCAAAGAAAGAGAAGAAG 3 primers. A control gene fragment (Brassica actin) was amplified using actin For 5 CCGAGAGAGGTTACATGTTCACCAC 3 and actin Rev 5 GCTGTGATCTCTTTGCTCATACGGTC 3 primers. 2.4.2. Southern blotting Genomic DNA was isolated from transgenic cauliflower leaves according to a modified Frey method (Frey, 1999). Total genomic DNA (25 g) was digested overnight with XbaI restriction enzyme. The digested DNA was ethanol-precipitated and resuspended in 20 l of TE, then fractionated in a 0.8% agarose 1× TAE gel at 59 V for 5 h and transferred overnight onto a nylon membrane (Hybond-N+, Amersham) using 0.4 M NaOH (Alkali transfer). Five microlitres of DIG-labelled DNA molecular weight marker was used for band size detection along with the positive control (cloning vector harbouring BoMinD). Digoxygenin (DIG) labelled probes were generated from plasmid DNA by PCR using the DIG High Prime kit (Roche Applied Sciences, Mannheim, Germany). DIG labelled probe (20 ng) was denatured by heating to 95 ◦ C for 5 min and then rapidly chilled. The denatured probe was added to 20 ml of pre-heated DIG Easy Hyb Buffer and used as the hybridisation solution. After the 16 h incubation of membrane with probe, the membrane was washed twice in low stringency buffer (2% SSC + 0.1% SDS) at room temperature and twice in high stringency buffer (0.5% SSC + 0.1% SDS) at 65 ◦ C. Then the membrane was blocked in 100 ml of blocking solution (Roche Applied Sciences) for 30 min and 20 ml of antiDigoxigenin-antibody (Roche Applied Sciences) diluted 1:5000 in blocking solution was added to the membrane for 30 min. The antibody solution was poured off and the membrane was washed for 30 min in washing buffer (Roche Applied Sciences). Membrane was incubated for 5 min in a detection buffer (Roche Applied Sciences),
2.4.4. Microscopy Protoplasts were isolated from cauliflower plants using an enzyme solution [10 mM CaCl2 , 0.6 M mannitol, 10 mM MES, macerozyme (1%, w/v) and Cellulase Onozuka R-10 (2% w/v)]. Cellulases were sourced from Austratec Pty. Ltd. (Kilsyth, Australia). Leaf slices were incubated in the enzyme solution at 24 ◦ C for 16 h. Protoplasts were pelleted at 60 × g then resuspended in W5 solution (Menczel et al., 1981). Chloroplast phenotypes were observed in protoplasts, leaf samples or epidermal peels of leaves via a BH2 Epi-fluorescence microscope (Olympus) using UV or bright field illumination. Images were captured with a MOTIC camera and software (DC Imaging, LLC, USA). 3. Results and discussion Chloroplast division in stable BoMinD transgenic cauliflower has been disrupted due to the imbalanced expression of total BoMinD; however a true macrochloroplast phenotype was not obtained in transgenic cauliflower probably due to insufficient BoMinD expression levels in the transgenics. Leaf mesophyll protoplasts from cv. Thalassa were used for PEG-mediated transformation with the BoMinD plasmid. A total of 2 × 106 protoplasts were treated with BoMinD plasmid resulting in 6 hygromycin resistant putative transgenic plants (Fig. 1B and C) giving an absolute transformation frequency (number of transgenic shoots per number of treated protoplasts) of 0.3 × 10−5 , which is equal to or slightly lower than the frequency of 0.3 to 1.3 × 10−5 reported by Nugent et al. (2006) but is however much higher than the frequency of 0.05 × 10−5 as reported by Radchuk et al. (2002). Furthermore, fully developed transformed BoMinD cauliflower plants exhibited no morphological/physiological differences to WT cauliflower plants (Fig. 1C). Analysis via PCR with hptII and BoMinD specific primers indicated that all 6 BoMinD transgenic cauliflower lines (CM1–CM6) were positive for the presence of the two transgenes (data not shown). Further analysis of stable BoMinD transgenic cauliflower plants by Southern blotting and RTPCR was performed using BoMinDRT For and E9-ter Rev primers
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
411
Fig. 1. Generation and molecular analysis of stable BoMinD transgenic cauliflower plants. (A) Cauliflower nuclear transformation plasmid. (B) Hygromycin resistant embryos at 45 days (Bar = 1 cm) resulted by the PEG mediated transformation of the BoMinD. (C) Fully developed plantlets of WT (MS0) and BoMinD transgenic cauliflower line, CM5 (MS0 + hygromycin). (D) Southern blot of XbaI digested genomic DNA extracts of the BoMinD transgenic lines to determine copy number probed with BoMinDRT2 For and E9 ter Rev primers. (E) RT-PCR analysis of BoMinD transgenic plants with actin (Brassica), BoMinD and BoMinDRT For and E9 ter Rev primers. (F) Western blot analysis of BoMinD transgenic cauliflower plants with AtMinD antibodies. M = 1 kb ladder, + = positive control, WT = non-transgenic plant, CM1, CM2, CM3, CM4, CM5 & CM6 are the BoMinD transgenic cauliflower lines. For Western blot analysis, 50 g of total soluble protein from WT A. thaliana, tobacco and cauliflower TSP was used and 20 g of TSP from transgenic cauliflower lines was used.
that detects only transgene BoMinD but not endogenous BoMinD (Fig. 1D and E). Southern blotting of transgenic lines showed that, CM1 and CM6 lines contained five and three copies of the BoMinD transgene respectively, while CM4 and CM5 lines contained two transgene inserts (Fig. 1D). Gene expression analysis, by RT-PCR (Fig. 1E) and also measurement of BoMinD by western blot (Fig. 1F)
indicated that the transgene number did not relate to the BoMinD transgene expression, particularly in transgenic events CM4, CM5 and CM6 lines as the transgene expression is dependent on many factors such as; promoter strength, transgene integration site and also on the number of transgene integrations (Stam et al., 1997; Matzke and Matzke, 1998). Though there were good levels of total
412
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413
BoMinD transcript in transgenic cauliflower (CM1–CM6) lines using RT-PCR with BoMinD primers, there was only weak BoMinD transgene expression detected in CM4, CM5 and CM6 lines with BoMinD For and E9-ter Rev primers (Fig. 1E). Examination of BoMinD levels by western blotting with anti-MinD antibody also showed very low BoMinD levels in stable BoMinD transgenic cauliflower lines (Fig. 1F). Abnormal (honeycomb shaped) chloroplasts and irregular membrane shaped chloroplasts were not observed in the transgenic tobacco plants with BoMinD (Chikkala et al., 2012). However, macrochloroplast phenotypes were obtained by using the same BoMinD expression cassette when used to transform tobacco (Chikkala et al., 2012). This may be due to use of the tobacco NtrbcS promoter for the BoMinD transgene expression in the heterologous species, in this case cauliflower. It has been shown that rbcS promoters from different sources express recombinant genes at different levels in heterologous species, depending upon the promoter length and the presence or absence of regulatory sequences like matrix-attachment regions (MAR), cis-acting elements, I-box and G-box, all of which are important for tissue specific gene expression (Song et al., 2000). Heterologous expression of gus by the tomato rbcS promoter in cauliflower was 10 times lower than the CaMV35S promoter (Baranski and Puddephat, 2004). The NtrbcS promoter used in this study for BoMinD transgene expression in cauliflower may lack some regulatory factors required for the correct regulation of expression in cauliflower. However, BoMinD transgenic cauliflower chloroplasts look slightly larger than WT chloroplasts but the number of chloroplasts per cell was similar to WT plants. It has been reported that in order to generate chloroplast abnormality, transgene expression must produce 3 times the level of native plastid division protein levels (Stokes et al., 2000). Out of the six BoMinD transgenic cauliflower lines, three lines (CM1, CM2 and CM3) showed no difference to WT chloroplast phenotype but the other three lines (CM4, CM5 and CM6) showed abnormal chloroplasts with a doughnut-like shape or with an irregular chloroplast membrane (Fig. 2A and B). The abnormal chloroplasts in transgenic cauliflower plants were typically dispersed throughout the cells, whereas the WT chloroplasts were mainly on the cell periphery (Fig. 2A and B). Chloroplasts with irregularly shaped membranes were observed in A. thaliana arc11 mutants complemented with AtMinD1 and expression of the AtMinD1 was at level slightly higher than those in the WT plants (Fujiwara et al., 2004). In addition, AtMinD1 (A296G) transgenic plants showed vacuolated chloroplasts (Fujiwara et al., 2004). Though BoMinD does not have a sequence difference at the 296 position (A296G) when compared to AtMinD1, the honey-comb shaped chloroplasts and irregular surface membrane chloroplasts may have arisen due to the slight increase of BoMinD expression levels. This tends to indicate that BoMinD functions similarly to AtMinD1 and regulates chloroplast division and chloroplast envelope membrane morphology, either directly or indirectly, depending upon expression levels (Chikkala et al., 2012; Fujiwara et al., 2004). In conclusion, stable transgenic cauliflower plants carrying BoMinD were obtained that exhibited honey-comb shaped chloroplasts and irregular membrane shaped chloroplasts that appear to be due to an insufficient total increase of BoMinD. Macrochloroplasts in cauliflower might be generated a number of ways; by expressing plastid division genes at higher levels, perhaps by using a stronger constitutive promoter such as the CaMV35S or using a BoMinD promoter (Dinkins et al., 2001; Stokes et al., 2000), by the antisense expression of plastid division genes (Osteryoung et al., 1998; Colletti et al., 2000) or by RNAi technology (Khraiwesh et al., 2008; Raynaud et al., 2005). Transgenic cauliflower plants bearing abnormal chloroplast phenotypes may prove useful in various fundamental studies of cell biology and plant biotechnology
Fig. 2. Fluorescence microscopy images of leaf samples of mesophyll chloroplasts and isolated protoplasts of WT and BoMinD transgenic cauliflower. (A) Leaf samples of WT mesophyll chloroplasts and BoMinD transgenic cauliflower honeycomb shaped chloroplasts. (B) Bright and fluorescence images of WT mesophyll chloroplasts and BoMinD transgenic cauliflower (CM5) mesophyll chloroplasts with serrated edges. Arrow shows the serrate edged chloroplasts. Magnification = 100× (leaf samples) and 1000× (protoplasts), Bar = 10 M.
such as imaging ion fluxes, targeting proteins to various internal chloroplast compartments, CO2 uptake studies, observing the effect of different abiotic stresses on these plants and expressing foreign proteins in macrochloroplast plants by plastid transformation.Acknowledgement Antibodies for AtMinD were generously provided by Dr. Shin-ya Miyagishima (RIKEN, Japan). References Baranski, R., Puddephat, I., 2004. Tissue specific expression of -glucuronidase gene driven by heterologous promoters in transgenic cauliflower plants. Acta Physiol. Plant 26, 307–315. Bhalla, P.L., Nicole, S., 1998. Agrobacterium tumefaciens-mediated transformation of cauliflower, Brassica oleracea var. botrytis. Mol. Breed. 4, 531–541. Bogorad, L., 2000. Engineering chloroplasts: an alternative site for foreign genes, proteins, reactions and products. Trends Biotechnol. 18, 257–263. Cardoza, V., Stewart, C., 2004. Brassica biotechnology: progress in cellular and molecular biology. In Vitro Cell Dev. Biol. Plant 40, 542–551. Chakrabarty, R., Viswakarma, N., Bhat, S., Kirti, P., Singh, B., Chopra, V., 2002. Agrobacterium-mediated transformation of cauliflower: Optimization of protocol and development of Bt-transgenic cauliflower. J. Biosci. 27, 495–502. Chikkala, V.R.N., Nugent, G., Stalker, D., Mouradov, A., Stevenson, T., 2012. Expression of Brassica oleracea FtsZ1-1 and MinD alters chloroplast division in Nicotiana tabacum generating macro- and mini-chloroplasts. Plant Cell Rep. 31, 917–928.
V.R.N. Chikkala et al. / Scientia Horticulturae 164 (2013) 409–413 Chikkala, V.R.N., Nugent, G., Dix, P., Stevenson, T., 2009. Regeneration from leaf explants and protoplasts of Brassica oleracea var. botrytis (cauliflower). Sci. Horti. 119, 330–334. Colletti, K.S., Tattersall, E.A., Pyke, K.A., Froelich, J.E., Stokes, K.D., Osteryoung, K.W., 2000. A homologue of the bacterial cell division site-determining factor MinD mediates placement of the chloroplast division apparatus. Curr. Biol. 10, 507–516. David, C., Tempé, J., 1988. Genetic transformation of cauliflower (Brassica oleracea L. var. Botrytis) by Agrobacterium rhizogenes. Plant Cell Rep. 7, 88–91. Dinkins, R., Reddy, S., Leng, M., Collins, G., 2001. Overexpression of the Arabidopsis thaliana MinD1 gene alters chloroplast size and number in transgenic tobacco plants. Planta 214, 180–188. Dunwell, J.M., 2000. Transgenic approaches to crop improvement. J. Exp. Bot. 51, 487–496. Eimert, K., Siegemund, F., 1992. Transformation of cauliflower (Brassica oleracea L. var. botrytis) – an experimental survey. Plant Mol. Biol. 19, 485–490. Frey, J.E., 1999. Genetic flexibility of plant chloroplasts. Nature 398, 115–116. Fujiwara, M.T., Nakamura, A., Itoh, R., Shimada, Y., Yoshida, S., Møller, S.G., 2004. Chloroplast division site placement requires dimerization of the ARC11/AtMinD1 protein in Arabidopsis. J. Cell Sci. 117, 2399–2410. Herbers, K., Sonnewald, U., 1999. Production of new/modified proteins in transgenic plants. Curr. Opin. Biotechnol. 10, 163–168. Hou, B.K., Zhou, Y.H., Wan, L.H., Zhang, Z.L., Shen, G.F., Chen, Z.H., Hu, Z.M., 2003. Chloroplast transformation in oilseed rape. Trans. Res. 12, 111–114. Jin, Y., Ma, D., Dong, J., Li, D., Deng, C., Jin, J., Wang, T., 2007. The HC-Pro protein of potato virus Y interacts with NtMinD of tobacco. Mol. Plant Microbe Interact. 20, 1505–1511. Kanamaru, K., Fujiwara, M., Kim, M., Nagashima, A., Nakazato, E., Tanaka, K., Takahashi, H., 2000. Chloroplast targeting, distribution and transcriptional fluctuation of AtMinD1, a eubacteria-type factor critical for chloroplast division. Plant Cell Physiol. 41, 1119–1128. Khraiwesh, B., Ossowski, S., Weigel, D., Reski, R., Frank, W., 2008. Specific gene silencing by artificial microRNAs in Physcomitrella patens: an alternative to targeted gene knockouts. Plant Physiol. 148, 684–693. Liu, C.W., Lin, C.C., Chen, J., Tseng, M.J., 2007. Stable chloroplast transformation in cabbage (Brassica oleracea L. var. capitata L.) by particle bombardment. Plant Cell Rep. 26, 1733–1744. Matzke, A.J.M., Matzke, M.A., 1998. Position effects and epigenetic silencing of plant transgenes. Curr. Opin. Plant Biol. 1, 142–148. Mazur, B., Krebbers, E., Tingey, S., 1999. Gene discovery and product development for grain quality traits. Science 285, 372–375.
413
Menczel, L., Nagy, F., Kiss, Z.R., Maliga, P., 1981. Streptomycin resistant and sensitive somatic hybrids of Nicotiana tabacum + Nicotiana knightiana: correlation of resistance to N. tabacum plastids. Theor. Appl. Genet. 59, 191–195. Moehs, C.P., Tian, L., Osteryoung, K.W., Dellapenna, D., 2001. Analysis of carotenoid biosynthetic gene expression during marigold petal development. Plant Mol. Biol. 45, 281–293. Mukhopadhyay, A., Töpfer, R., Pradhan, A., Sodhi, Y., Steinbiß, H.-H., Schell, J., Pental, D., 1991. Efficient regeneration of Brassica oleracea hypocotyl protoplasts and high frequency genetic transformation by direct DNA uptake. Plant Cell Rep. 10, 375–379. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15, 473–497. Nakanishi, H., Suzuki, K., Kabeya, Y., Miyagishima, S., 2009. Plant-specific protein MCD1 determines the site of chloroplast division in concert with cacteriaderived MinD. Curr. Biol. 19, 151–156. Nugent, G.D., Coyne, S., Nguyen, T.T., Kavanagh, T.A., Dix, P.J., 2006. Nuclear and plastid transformation of Brassica oleracea var. botrytis (cauliflower) using PEGmediated uptake of DNA into protoplasts. Plant Sci. 170, 135–142. Osteryoung, K.W., Stokes, K.D., Rutherford, S.M., Percival, A.L., Lee, W.Y., 1998. Chloroplast division in higher plants requires members of two functionally divergent gene families with homology to bacterial ftsZ. Plant Cell 10, 1991–2004. Puddephat, I.J., Thompson, N., Robinson, H.T., Sandhu, P., Henderson, J., 1999. Biolistic transformation of broccoli (Brassica oleracea var. italica) for transient expression of the -glucuronidase gene. J. Horti. Sci. Biotech. 74, 714–720. Radchuk, V.V., Ryschka, U., Schumann, G., Klocke, E., 2002. Genetic transformation of cauliflower (Brassica oleracea var. botrytis) by direct DNA uptake into mesophyll protoplasts. Physiol. Plant 114, 429–438. Raynaud, C., Perennes, C., Reuzeau, C., Catrice, O., Brown, S., Bergounioux, C., 2005. Cell and plastid division are coordinated through the prereplication factor AtCDT1. Proc. Natl. Acad. Sci. USA 102, 8216–8221. Song, P., Heinen, L.J., Burns, T.H., Allen, R.D., 2000. Expression of two tissue-specific promoters in transgenic cotton plants. J. Cotton Sci. 4, 217–223. Stam, M., Mol, J.N.M., Kooter, J.M., 1997. The silence of genes in transgenic plants. Ann. Bot. 79, 3–12. Stokes, K.D., McAndrew, R.S., Figueroa, R., Vitha, S., Osteryoung, K.W., 2000. Chloroplast division and morphology are differentially affected by overexpression of FtsZ1 and FtsZ2 genes in Arabidopsis. Plant Physiol. 124, 1668–1677. Xue, H.W., Wei, Z.M., Xu, Z.H., 1997. Regeneration of transgenic plants of Brassica oleracea via PEG-mediated gene transformation. Acta Bot. Sin. 39, 28–33 (in Chinese).