- Email: [email protected]
Production of a plasmid-encoded OXA-72 β-lactamase associated with resistance to carbapenems in a clinical isolate Acinetobacter junii
Letters to the Editor / International Journal of Antimicrobial Agents 39 (2012) 90–94 [5] Gomes AA, Asad LMBO, Felzenszwalb I, Leitão AC, Silva AB, Guillobel HCR, et al. Does UVB radiation induce SoxS gene expression in Escherichia coli cells? Radiat Environ Biophys 2004;43:219–22.
María M. Tavío ∗ Virginia D. Aquili Unidad de Microbiología del Departamento de Ciencias Clínicas, Universidad de Las Palmas de G.C., Las Palmas de G.C., Spain Anna Fàbrega Jordi Vila Departamento de Microbiología, IDIBAPS, Facultad de Medicina, Universidad de Barcelona, Barcelona, Spain José B. Poveda Unidad de Epidemiología y Medicina Preventiva, Universidad de Las Palmas de G.C., Las Palmas de G.C., Spain ∗ Corresponding author. Present address: Microbiología, Departamento de Ciencias Clínicas, Facultad de Ciencias de la Salud, Universidad de Las Palmas de G.C., Dr Pasteur, 35 080 Las Palmas de Gran Canaria, Spain. Tel.: +34 928 453 405; fax: +34 928 451 416. E-mail address: [email protected] (M.M. Tavío)
24 June 2011 doi:10.1016/j.ijantimicag.2011.08.008
Production of a plasmid-encoded OXA-72 -lactamase associated with resistance to carbapenems in a clinical isolate Acinetobacter junii Sir, Resistance to carbapenems in Acinetobacter spp. is a serious problem that is increasing worldwide. In Acinetobacter baumannii, which is the most important genospecies associated with human infections, resistance to carbapenems is related fundamentally to the production of acquired carbapenem-hydrolysing class D -lactamases (oxacillinases) (CHDLs) of phylogenetic subgroups OXA-58, OXA-23, OXA-24/40 and OXA 143 and, less frequently, to the acquisition of carbapenem-hydrolysing metallo--lactamases (CHMBLs) such as those of type IMP or VIM. For genospecies of Acinetobacter other than A. baumannii, resistance to carbapenems is still rare and has been associated with the production of CHDLs and/or CHMBLs. In Acinetobacter junii, resistance to carbapenems has been associated with the production of OXA-58 and IMP-4 [1]. In the present study, the role of CHDLs and CHMBLs in the resistance to carbapenems observed in a clinical isolate of A. junii selected from a tracheal aspirate sample of a 72-year-old patient admitted at the Intensive Care Unit of the University Hospital Virgen Macarena (Seville, Spain) in November 2010 was investigated. The isolate was identified as Acinetobacter lwoffii using a Wider I system (Francisco Soria Melguizo S.A., Madrid, Spain) and showed resistance to amoxicillin (alone or associated with clavulanic acid), cefalothin, cefoxitin, imipenem, meropenem and fosfomycin and susceptibility to ceftazidime, cefepime, ampicillin/sulbactam, piperacillin/tazobactam, ciprofloxacin, amikacin, tobramycin and colistin. The isolate was not able to grow at 44 ◦ C and was identified as A. junii using the API 20NE system (bioMérieux Marcy, l’Étoile, France) and by 16S rDNA sequencing (Macrogen Inc., Seoul, South Korea). Minimum inhibitory concentrations (MICs) of imipenem, meropenem, ceftazidime, cefepime and aztreonam
93
determined by microdilution according to Clinical and Laboratory Standards Institute (CLSI) recommendations were 32, 64, 8, 0.5 and 32 mg/L, respectively, corroborating that the isolate was truly resistant to carbapenems and susceptible to ceftazidime and cefepime. Screening for genes encoding CHDLs (subgroups OXA-51, OXA58, OXA-23 and OXA24/40) and CHMBLs (IMP- and VIM-type) was performed using two independent multiplex polymerase chain reaction (PCR) assays [2,3]. No amplification product was observed for CHMBLs. In contrast, a unique band of DNA of ca. 246 bp compatible with blaOXA-24/40-like was visualised with the multiplex PCR used to detect genes encoding CHDLs. Primers P1 (5 -GTACTAATCAAAGTTGTGAA) and P2 (5 TTCCCCTAACATGAATTTGT) were used to amplify a fragment of 995 bp encompassing the entire blaOXA-24/40-like gene. The amplification product was cloned into Escherichia coli Dh10B using a Zero Blunt® TOPO® PCR Cloning Kit (Invitrogen, Cergy-Pontoise, France) followed by selection on agar plates containing 30 g/mL kanamycin (Sigma, Madrid, Spain). The cloned blaOXA-24/40-like gene was identified as blaOXA-72 by bidirectional DNA sequencing (Macrogen Inc.) using primers P1 and P2. The insertion sequences ISAba1, ISAba2, ISAba3, ISAba4 and IS18 were not detected by PCR using primers specific of every insertion sequence, indicating that these mobile sequences of DNA probably do not contribute to the overexpression of blaOXA-72 . The genetic localisation of blaOXA-72 (plasmidic and/or chromosomal) was determined by (i) Southern blotting using as probe an internal fragment of blaOXA-72 labelled with digoxigenin (DIG DNA Labelling and Detection Kit; Roche Diagnostics, S.L., Barcelona, Spain) and (ii) electroporation (MicroPulserTM Electroporator; Bio-Rad Laboratories Inc., Hercules, CA) of E. coli Dh10B and the rifampicin-resistant strain A. baumannii CIP70.10 (AbRifR ) using plasmid extracts of A. junii obtained by the Keiser method. Four bands of plasmid DNA of 40, 20, 4 and <2 kb, respectively, were observed in A. junii and the transformants of Ab-RifR . The probe of blaOXA-72 hybridised with the plasmid band of 20 kb (A. junii and transformants) and gave no signal with the chromosomal DNA, indicating that blaOXA-72 is plasmid-encoded. Transformants of Ab-RifR showed the same pattern of resistance to imipenem and meropenem as did the A. junii, indicating that blaOXA-72 is responsible for the relatively high level of resistance to carbapenems observed in the A. junii isolate. blaOXA-72 was not mobilised from A. junii to Ab-RifR by plasmid conjugation under the experimental conditions used; however, it is not possible to reject that blaOXA-72 could have been acquired by plasmid transference. Homologous recombination mediated by the Xer system may be a possible explanation for the mobilisation of blaOXA-72 in A. junii, as Merino et al. have shown with the blaOXA-24 of a clinical isolate of Acinetobacter calcoaceticus acquired from an isolate of A. baumannii [4]. blaOXA-72 has been mostly described in A. baumannii and, to our knowledge, this is the first description of blaOXA-72 encoded in a small-size plasmid harboured in a clinical isolate of A. junii resistant to carbapenems and susceptible to expanded-spectrum cephalosporins. The role of other mechanisms of resistance to carbapenems, such as loss or reduced expression of porins and/or overexpression of efflux pumps, should not be underestimated in this genospecies. This isolate of A. junii could represent a potential source of transferable resistance to carbapenems by horizontal dissemination amongst different genomic species of Acinetobacter, as has been described for other genospecies such as Acinetobacter radioresistens [5,6]. More detailed studies are necessary to verify the role of other mechanisms of resistance and to understand the transmission and the role of A. junii as a reservoir of carbapenem resistance gene determinants.
94
Letters to the Editor / International Journal of Antimicrobial Agents 39 (2012) 90–94
Acknowledgments Part of this study has been presented at the XV Congreso ˜ Nacional de la Sociedad Espanola de Enfermedades Infecciosas y Microbiología Clínica (SEIMC), 1–4 June 2011, Málaga, Spain. Funding: This work was supported in part by the Spanish Network for Research in Infectious Diseases (REIPI RD06/0008) and Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III, Fondo de Investigación Sanitaria, Madrid, Spain (PI080209). Competing interests: None declared. Ethical approval: Not required.
[6] Marti S, Sánchez-Céspedes J, Blasco MD, Ruiz M, Espinal P, Alba V, et al. Characterization of the carbapenem-hydrolyzing oxacillinase OXA-58 in an Acinetobacter genospecies 3 clinical isolate. Antimicrob Agents Chemother 2008;52: 2955–8.
Felipe Fernández-Cuenca ∗ José Manuel Rodríguez-Martínez Ma Carmen Gómez-Sánchez Paula Díaz de Alba Department of Microbiology, University Hospital Virgen Macarena, and University of Seville, Seville, Spain Vanesa Infante-Martínez
References [1] Peleg AY, Franklin C, Walters LJ, Bell JM, Spelman DW. OXA-58 and IMP-4 carbapenem-hydrolyzing -lactamases in an Acinetobacter junii blood culture isolate from Australia. Antimicrob Agents Chemother 2006;50:399–400. [2] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006;27:351–3. [3] Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo--lactamases. J Antimicrob Chemother 2007;59:321–2. [4] Merino M, Acosta J, Poza M, Sanz F, Beceiro A, Chaves F, et al. OXA-24 carbapenemase gene flanked by XerC/XerD-like recombination sites in different plasmids from different Acinetobacter species isolated during a nosocomial outbreak. Antimicrob Agents Chemother 2010;54:2724–7. [5] Poirel L, Figueiredo S, Cattoir V, Carattoli A, Nordmann P. Acinetobacter radioresistens as a silent source of carbapenem resistance for Acinetobacter spp. Antimicrob Agents Chemother 2008;52:1252–6.
Department of Biology, University of Guanajuato, Colonia Noria Alta, Guanajuato, GTO, Mexico Álvaro Pascual Department of Microbiology, University Hospital Virgen Macarena, and University of Seville, Seville, Spain ∗ Corresponding
author. Tel.: +34 955 00 82 88; fax: +34 954 37 74 13. E-mail address: [email protected] (F. Fernández-Cuenca) 16 June 2011 doi:10.1016/j.ijantimicag.2011.07.017
María M. Tavío ∗ Virginia D. Aquili Unidad de Microbiología del Departamento de Ciencias Clínicas, Universidad de Las Palmas de G.C., Las Palmas de G.C., Spain Anna Fàbrega Jordi Vila Departamento de Microbiología, IDIBAPS, Facultad de Medicina, Universidad de Barcelona, Barcelona, Spain José B. Poveda Unidad de Epidemiología y Medicina Preventiva, Universidad de Las Palmas de G.C., Las Palmas de G.C., Spain ∗ Corresponding author. Present address: Microbiología, Departamento de Ciencias Clínicas, Facultad de Ciencias de la Salud, Universidad de Las Palmas de G.C., Dr Pasteur, 35 080 Las Palmas de Gran Canaria, Spain. Tel.: +34 928 453 405; fax: +34 928 451 416. E-mail address: [email protected] (M.M. Tavío)
24 June 2011 doi:10.1016/j.ijantimicag.2011.08.008
Production of a plasmid-encoded OXA-72 -lactamase associated with resistance to carbapenems in a clinical isolate Acinetobacter junii Sir, Resistance to carbapenems in Acinetobacter spp. is a serious problem that is increasing worldwide. In Acinetobacter baumannii, which is the most important genospecies associated with human infections, resistance to carbapenems is related fundamentally to the production of acquired carbapenem-hydrolysing class D -lactamases (oxacillinases) (CHDLs) of phylogenetic subgroups OXA-58, OXA-23, OXA-24/40 and OXA 143 and, less frequently, to the acquisition of carbapenem-hydrolysing metallo--lactamases (CHMBLs) such as those of type IMP or VIM. For genospecies of Acinetobacter other than A. baumannii, resistance to carbapenems is still rare and has been associated with the production of CHDLs and/or CHMBLs. In Acinetobacter junii, resistance to carbapenems has been associated with the production of OXA-58 and IMP-4 [1]. In the present study, the role of CHDLs and CHMBLs in the resistance to carbapenems observed in a clinical isolate of A. junii selected from a tracheal aspirate sample of a 72-year-old patient admitted at the Intensive Care Unit of the University Hospital Virgen Macarena (Seville, Spain) in November 2010 was investigated. The isolate was identified as Acinetobacter lwoffii using a Wider I system (Francisco Soria Melguizo S.A., Madrid, Spain) and showed resistance to amoxicillin (alone or associated with clavulanic acid), cefalothin, cefoxitin, imipenem, meropenem and fosfomycin and susceptibility to ceftazidime, cefepime, ampicillin/sulbactam, piperacillin/tazobactam, ciprofloxacin, amikacin, tobramycin and colistin. The isolate was not able to grow at 44 ◦ C and was identified as A. junii using the API 20NE system (bioMérieux Marcy, l’Étoile, France) and by 16S rDNA sequencing (Macrogen Inc., Seoul, South Korea). Minimum inhibitory concentrations (MICs) of imipenem, meropenem, ceftazidime, cefepime and aztreonam
93
determined by microdilution according to Clinical and Laboratory Standards Institute (CLSI) recommendations were 32, 64, 8, 0.5 and 32 mg/L, respectively, corroborating that the isolate was truly resistant to carbapenems and susceptible to ceftazidime and cefepime. Screening for genes encoding CHDLs (subgroups OXA-51, OXA58, OXA-23 and OXA24/40) and CHMBLs (IMP- and VIM-type) was performed using two independent multiplex polymerase chain reaction (PCR) assays [2,3]. No amplification product was observed for CHMBLs. In contrast, a unique band of DNA of ca. 246 bp compatible with blaOXA-24/40-like was visualised with the multiplex PCR used to detect genes encoding CHDLs. Primers P1 (5 -GTACTAATCAAAGTTGTGAA) and P2 (5 TTCCCCTAACATGAATTTGT) were used to amplify a fragment of 995 bp encompassing the entire blaOXA-24/40-like gene. The amplification product was cloned into Escherichia coli Dh10B using a Zero Blunt® TOPO® PCR Cloning Kit (Invitrogen, Cergy-Pontoise, France) followed by selection on agar plates containing 30 g/mL kanamycin (Sigma, Madrid, Spain). The cloned blaOXA-24/40-like gene was identified as blaOXA-72 by bidirectional DNA sequencing (Macrogen Inc.) using primers P1 and P2. The insertion sequences ISAba1, ISAba2, ISAba3, ISAba4 and IS18 were not detected by PCR using primers specific of every insertion sequence, indicating that these mobile sequences of DNA probably do not contribute to the overexpression of blaOXA-72 . The genetic localisation of blaOXA-72 (plasmidic and/or chromosomal) was determined by (i) Southern blotting using as probe an internal fragment of blaOXA-72 labelled with digoxigenin (DIG DNA Labelling and Detection Kit; Roche Diagnostics, S.L., Barcelona, Spain) and (ii) electroporation (MicroPulserTM Electroporator; Bio-Rad Laboratories Inc., Hercules, CA) of E. coli Dh10B and the rifampicin-resistant strain A. baumannii CIP70.10 (AbRifR ) using plasmid extracts of A. junii obtained by the Keiser method. Four bands of plasmid DNA of 40, 20, 4 and <2 kb, respectively, were observed in A. junii and the transformants of Ab-RifR . The probe of blaOXA-72 hybridised with the plasmid band of 20 kb (A. junii and transformants) and gave no signal with the chromosomal DNA, indicating that blaOXA-72 is plasmid-encoded. Transformants of Ab-RifR showed the same pattern of resistance to imipenem and meropenem as did the A. junii, indicating that blaOXA-72 is responsible for the relatively high level of resistance to carbapenems observed in the A. junii isolate. blaOXA-72 was not mobilised from A. junii to Ab-RifR by plasmid conjugation under the experimental conditions used; however, it is not possible to reject that blaOXA-72 could have been acquired by plasmid transference. Homologous recombination mediated by the Xer system may be a possible explanation for the mobilisation of blaOXA-72 in A. junii, as Merino et al. have shown with the blaOXA-24 of a clinical isolate of Acinetobacter calcoaceticus acquired from an isolate of A. baumannii [4]. blaOXA-72 has been mostly described in A. baumannii and, to our knowledge, this is the first description of blaOXA-72 encoded in a small-size plasmid harboured in a clinical isolate of A. junii resistant to carbapenems and susceptible to expanded-spectrum cephalosporins. The role of other mechanisms of resistance to carbapenems, such as loss or reduced expression of porins and/or overexpression of efflux pumps, should not be underestimated in this genospecies. This isolate of A. junii could represent a potential source of transferable resistance to carbapenems by horizontal dissemination amongst different genomic species of Acinetobacter, as has been described for other genospecies such as Acinetobacter radioresistens [5,6]. More detailed studies are necessary to verify the role of other mechanisms of resistance and to understand the transmission and the role of A. junii as a reservoir of carbapenem resistance gene determinants.
94
Letters to the Editor / International Journal of Antimicrobial Agents 39 (2012) 90–94
Acknowledgments Part of this study has been presented at the XV Congreso ˜ Nacional de la Sociedad Espanola de Enfermedades Infecciosas y Microbiología Clínica (SEIMC), 1–4 June 2011, Málaga, Spain. Funding: This work was supported in part by the Spanish Network for Research in Infectious Diseases (REIPI RD06/0008) and Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III, Fondo de Investigación Sanitaria, Madrid, Spain (PI080209). Competing interests: None declared. Ethical approval: Not required.
[6] Marti S, Sánchez-Céspedes J, Blasco MD, Ruiz M, Espinal P, Alba V, et al. Characterization of the carbapenem-hydrolyzing oxacillinase OXA-58 in an Acinetobacter genospecies 3 clinical isolate. Antimicrob Agents Chemother 2008;52: 2955–8.
Felipe Fernández-Cuenca ∗ José Manuel Rodríguez-Martínez Ma Carmen Gómez-Sánchez Paula Díaz de Alba Department of Microbiology, University Hospital Virgen Macarena, and University of Seville, Seville, Spain Vanesa Infante-Martínez
References [1] Peleg AY, Franklin C, Walters LJ, Bell JM, Spelman DW. OXA-58 and IMP-4 carbapenem-hydrolyzing -lactamases in an Acinetobacter junii blood culture isolate from Australia. Antimicrob Agents Chemother 2006;50:399–400. [2] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006;27:351–3. [3] Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo--lactamases. J Antimicrob Chemother 2007;59:321–2. [4] Merino M, Acosta J, Poza M, Sanz F, Beceiro A, Chaves F, et al. OXA-24 carbapenemase gene flanked by XerC/XerD-like recombination sites in different plasmids from different Acinetobacter species isolated during a nosocomial outbreak. Antimicrob Agents Chemother 2010;54:2724–7. [5] Poirel L, Figueiredo S, Cattoir V, Carattoli A, Nordmann P. Acinetobacter radioresistens as a silent source of carbapenem resistance for Acinetobacter spp. Antimicrob Agents Chemother 2008;52:1252–6.
Department of Biology, University of Guanajuato, Colonia Noria Alta, Guanajuato, GTO, Mexico Álvaro Pascual Department of Microbiology, University Hospital Virgen Macarena, and University of Seville, Seville, Spain ∗ Corresponding
author. Tel.: +34 955 00 82 88; fax: +34 954 37 74 13. E-mail address: [email protected] (F. Fernández-Cuenca) 16 June 2011 doi:10.1016/j.ijantimicag.2011.07.017