Production of human protein disulfide isomerase by Bacillus brevis

journal of biotechnology ELSEVIER

Journal of Biotechnology33 (1994) 55-62

Production of human protein disulfide isomerase by Bacillus brevis Hideaki Tojo

a,,

Tsuneo Asano a,1 Koichi Kato a,1 Shigezo Udaka Ryuya Horiuchi c, Atsushi Kakinuma a,2

b,2

a Bioteehnology Research Laboratories, Takeda Chemical Industries, Ltd., Osaka, Japan, b Department of Food Science and Technology, Nagoya University, Nagoya, Japan, c Institute of Endocrinology, Gunma University, Maebashi, Japan

(Received 18 February 1993;revision accepted 3 July 1993)

Abstract Human protein disulfide isomerase (PDI; EC 5.3.4.1) was expressed and secreted into the culture medium using Bacillus brevis as host and pNU200 which codes the promoter and signal sequence of major cell wall protein of B. brevis as vector. The accumulation of recombinant human PDI (rhPDI) reached about 5 mg 1-1 in the late

exponential phase of the bacterial growth. The purified rhPDI was found to be exactly processed at the carboxyl terminus of the signal sequence. It was as active as natural PDI derived from human placenta as determined by its ability to reactivate scrambled ribonuclease that was a fully oxidized mixture containing randomly formed disulfide bonds. The activity was significantly accelerated in the presence of dithiothreitol or a mixture of reduced and oxidized glutathione. These indicate that the characteristics of rhPDI are similar to those reported for mammalian PDI and that it can be used for refolding inactive proteins having incorrect disulfide bonds. Key wor&': Protein disulfide isomerase; Bacillus brevis; Secretion; Disulfide bond; Protein refolding

I. Introduction Disulfide bonds in a protein play important roles in maintaining three-dimensional structure

* Corresponding author (present address): Discovery Research Division, Takeda Chemical Industries, Ltd., Yodogawa-ku, Osaka 532, Japan. Present address: 1 Discovery Research Division and 2 Department of Applied Biological Sciences, Nagoya University, Nagoya, Japan.

and biological activities. In eukaryotes, disulfide bond formation and protein folding are catalyzed by protein disulfide isomerase (PDI; E C 5.3.4.1) which is a soluble protein abundantly present in the lumen of endoplasmic reticulum (Roth and Pierce, 1987; Koivu and Myllyla, 1987; Hillson et al., 1984). PDI has been isolated from bovine liver (Lambert and Freedman, 1983), rat liver (Edman et al., 1987) and human placenta (Kaetzel et al., 1987). It has been indicated that P D I is identical to thyroid hormone (T3) binding protein (Cheng et al., 1987; Yamauchi et al., 1987) a n d / 3 subunit of prolyl-4-hydroxylase (Koivu et al.,

0168-1656/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0168-1656(93)E0081-8

56

H. Tojoet al. / Journal of Biotechnology 33 (1994) 55-62

1987), both of which are encoded in the same gene (Pihlajaniemi et al., 1987). Furthermore, PDI has been reported to be highly homologous to chicken glycosylation site binding protein (Geetha-Habib et al., 1988) and one component of human iodothyronine-5'-monodeiodinase (Boado et al., 1988). It is conceivable that PDI plays multiple roles in post-translational modification of nascent protein in eukaryotic cells (Freedman, 1989). Progress in genetic engineering has enabled us to produce recombinant mammalian proteins. However, some mammalian proteins produced in bacterial cells are often inactive due to the formation of incorrect disulfide bonds (Marston, 1986). The present study was aimed at obtaining a sufficient amount of human PDI for reactivation of inactive recombinant proteins. Human PDI was chosen because it has an advantage that its antigenicity to human is expected to be low and it can be applied for pharmaceutical products safely. Escherichia coli-expression system has been widely used for the production of mammalian proteins, but the products often have an additional methionine residue at the amino terminus. The additional methionine may also cause antigenicity. To obtain recombinant human PDI (rhPDI) with the mature sequence beginning with the N-terminal alanine, a Bacillus brevis host vector system was employed in the present study. Secretion of rhPDI into the medium is considered to be preferable to accumulation inside the cell body because the product can be easily recovered from the medium. The protein secretion system by using Saccharomyces cerevisiae or Bacillus subtilis has been studied for production of human proteins with the native sequence and the native molecular form. However, human proteins, especially with a high molecular weight, secreted by these hosts are rapidly degraded by extracellular proteinases. On the other hand, B. brevis has an ability to produce proteins in the medium and shows no detectable extracellular proteinase activity (Takagi et al., 1989a). Here we report expression of rhPDI by using protein hyper-producing bacteria B. brevis as host. Some characteristics of the rhPDI thus obtained are also described.

2. Materials and methods

2.1. Bacterial strain, plasmids and media B. brevis HPD31 isolated by Takagi et al. (1989a) was used throughout this work. Plasmid pNU200 containing the replication origin of pUBll0, major cell wall protein (MWP) pro. moter, MWP signal sequence and erythromycin resistance gene was constructed as described (Yamagata et al., 1989; Udaka et al., 1989). Plasmid pT3BP-3 having an inserted human PDI gene in pUC19 was cloned by Horiuchi et al. (to be published elsewhere). T2 medium and T3 medium were described previously (Udaka, 1976; Yamagata et al., 1989). Erythromycin was added at 10 /xg m1-1 to the media for selection of the transformants. 2.2. Transformation orB. brevis B. brevis HPD31 was cultured in T2 medium. Cells harvested at the middle exponential growth phase were mixed with 1 /zg of DNA and were electroporated using a Bio-Rad gene pulser (2.4 kV, 25 tzF) (Takagi et al., 1989b). 2.3. Mutagenesis with N T G Cells grown to the middle exponential phase in 5 ml of T2 medium were harvested by centrifugation and washed with 1 ml of 0.05 M sodium phosphate buffer (pH 7.5). The washed cells were suspended in 0.2 ml of 0.05 M sodium phosphate buffer (pH 7.5). Freshly prepared N-methyl-N'nitro-N-nitrosoguanidine (NTG) solution was added to this suspension and the suspension was incubated at 30°C for 30 min to obtain 0.01-1% survival. After NTG was removed by washing the cells twice with the same buffer, the cells were collected by centrifugation and suspended in 5 ml of T2 medium containing 20 mM magnesium chloride. The mixture was incubated at 30°C for 60 min with gentle shaking. Erythromycin was added to a final concentration of 0.1/zg m1-1 and the whole mixture was incubated at 30°C for an additional 4 h. Cells were plated on a selective medium (T2 containing 10 /xg m1-1 of ery-

57

H. Tojo et al. / Journal of Biotechnology 33 (1994) 55-62

Hindlll

DEAE-Toyopearl column chromatography

BamHI

hPDI Em pNU200-PDI 6.1 kb ', Ncol

MWP

T h e eluate from the phenyl-Sepharose column was directly applied to a column (2.5 × 16.5 cm) of D E A E - T o y o p e a r l 650S (Tosoh Co., Ltd.) previously equilibrated with 20 m M sodium phosphate buffer ( p H 6.8) containing 1 m M E D T A and 0.1 m M A P M S F . Proteins were eluted with a linear gradient of NaC1 concentration (0-0.4 M) in the same buffer. Fractions containing r h P D I as d e t e r m i n e d by W e s t e r n blot analysis with an antiP D I rabbit serum (Horiuchi et al., 1989) were pooled.

~ Idtll

Fig. 1. Construction of expression-secretion plasmid for human PDI. The human PDI cDNA fragment deleting the signal sequence was ligated to pNU200 (Udaka et al., 1989). A plasmid designated pNU200-PDI directed the synthesis of a fusion protein composed of MWP signal peptide and human PDI. The closed, open and dotted arrows represent the MWP promoter, the mature human PDI (hPDI) structural gene and erythromycin resistance gene, respectively. The closed bar indicates the MWP signal sequence.

1

2

i~~~ii¸¸¸ii! !~!~i , ~ ~ ~~ ii~i~i i~!~!~i~i I~ ~i ~ I ~

~i

thromycin) and cultivated at 30°C for 2 or 3 days. T h e surviving clones were tested for the productivity of r h P D I by in situ colony immunoassay ( H e l f m a n et al., 1983). 2.4. Procedure f o r purification o f r h P D I Phenyl-Sepharose c o l u m n c h r o m a t o g r a p h y

Solid a m m o n i u m sulfate was slowly a d d e d to 10 liter of the culture supernatant to give 55% saturation. T h e soluble fraction was applied to a column (4.5 x 21 cm) of phenyl-Sepharose CL-4B (Pharmacia L K B Biotechnology, Inc.) previously equilibrated with 20 m M sodium p h o s p h a t e buffer ( p H 6.8) containing 1 m M E D T A , 0.1 m M ( p amidinophenyl)methanesulfonyl fluoride hydrochloride ( A P M S F ) and a m m o n i u m sulfate (55% saturation). T h e column was washed with 20 m M sodium p h o s p h a t e buffer ( p H 6.8) containing 1 m M E D T A and 0.1 m M A P M S F . Proteins were eluted with the same buffer containing 50% ( v / v ) ethylene glycol. Fractions containing proteins as d e t e r m i n e d by the absorbance at 280 n m were pooled.

Fig. 2. Western blot analysis of culture supernatant. Electrophoresis was performed on 10% polyacrylamide gel containing 0.1% SDS under reducing conditions. PDI was detected with anti-PDI rabbit serum (Horiuchi et al., 1989). Lane 1, 0.1 ~g of human PDI; lane 2, 30 /zl of culture supernatant. Culture conditions are described in the text.

H. Tojo et al. /Journal of Biotechnology 33 (1994) 55-62

58

Gel permeation chromatography The eluate from DEAE-Toyopearl column was applied to a column (0.75 x 60 cm) of TSK-gel G3000SW (Tosoh Co., Ltd.). Proteins were eluted with 50 mM sodium phosphate buffer (pH 7.0) containing 100 mM sodium sulfate. Fractions giving a single band on SDS-polyacrylamide gel electrophoresis (PAGE) were collected.

reduced RNase with atmospheric 0 2 w a s a fully oxidized mixture containing randomly formed disulfide bonds. The scrambled RNase (50 /~g m1-1) was incubated with PDI in 100 mM sodium phosphate buffer (pH 7.5) containing 10 mM EDTA and 3 tzM dithiothreitol (DTT) at 20°C for 15 min. The RNase activity was determined by measuring the absorbance at 260 nm with yeast RNA as substrate. One unit of the PDI activity was defined as the activity that generates one unit of RNase per minute under the standard assay conditions.

2.5. Amino acid sequence analysis The amino-terminal amino acid sequence was determined by Edman method using a gas-phase protein sequencer model 470A (Applied Biosystems).

3. Results

2.6. Assay of PDI activity

3.1. Expression and secretion of rhPDI in B. brevis

The PDI activity was determined by the rate of reactivation of denatured and scrambled RNase as described previously (Horiuchi et al., 1989). The scrambled RNase prepared by reoxidizing

A plasmid containing the replication origin derived from pUB110, erythromycin resistance gene (erm C), MWP promoter region and DNA sequence encoding mature human PDI directly

A 1 2 0.016

97,400

E

c" O

66,200

0.008

42,699

..a <

3t,ooo

!:~!i:iii~!;;i;ii !!!:i'i:ii!: ii~~i~i:i

ii!!i:iiii~ii ii~il 21,5oo ~ii:~!i~;:i ~

< I

I

10 20 Elution volume (ml)

I

30

Fig. 3. Purity of rhPDI produced by B. brevis. (A) SDS-PAGE of purified rhPDI. Electrophore~is was performed on 10% polyacrylamide gel containing 0.1% SDS under reducing conditions. Proteins were stained with silver staining reagent. Lane 1, molecular weight standards; lane 2, purified rhPDI. (B) Elution pattern of purified rhPDI on GPC (TSK-gel G3000SW). Elution was performed as described in Materials and methods.

H. Tojo et al. /Journal of Biotechnology33 (1994) 55-62 -

-

MWp

signal seq . . . . .

\ [

hPDI m a t u r e

following the M W P signal s e q u e n c e was constructed as described in Fig. 1. T h e resulting plasmid p N U 2 0 0 - P D I was used to transform B. brevis H P D 3 1 to erythromycin resistance by electroporation. T h e c l o n e s p r o d u c i n g e n o u g h a m o u n t o f rhPDI as e v i d e n c e d by c o l o n y imm u n o a s s a y ( H e l f m a n et al., 1983) were isolated. T h e expression o f rhPDI by these clones, however, was easily abolished during cultivation even after a single passage into a liquid m e d i u m . Therefore, it was difficult to obtain a sufficient

seq . . . . . .

Neol \ / Aval - - - GCACTTACTGTTGCT~AT~CTTTCG CAGC ~AGGAGGACCACGTCCTGGTG - - -AlaLeuThrValAlaProHetAlaPheAlaAlaProCluGluGluAspHisValLeuVal -I0 -5 -i i 5

I0

Q Cleavage s i t e

Fig. 4. Nucleotide sequence and amino acid sequence of MWP-PDI fusion gene. The complete nucleotide sequence of MWP was described by Tsuboi et al. (1986) and that of human PDI (hPDI) will be published elsewhere (Horiuchi et al.). The amino terminal amino acid sequence of rhPDI determined by the Edman method is underlined. The cleavage site of signal peptide is shown by an arrow.

A

>, >

B

1,2

1.2

1.0

1.0.

0.8"

0.8,

0.6 -

o.6,

0.4-

0.4-

0.2-

0.2-

3.0 : 0

59

0.3

1

3

10

30

100

0.0 " 0/0

300

0,06/0.006

' 0.2/0.02

0TT ( pM )

0.6~0.06

' 2.0/0.2

6.0~0.6

GSH(mM)IGSSG(mM)

C 1.2'

1•0'

0.8 •

0.6 •

0.4;

0.2"

O.0

•

,

10

•

,

20

•

,

30

Tempereture

•

,

40

-

i

50

•

60

(oC)

Fig. 5. PDI activities under various conditions. The enzyme activity was determined using 10 p.g of rhPDI as described in Materials and methods, except that DTT concentration (A), glutathione concentration (B) or temperature (C) was varied as indicated.

60

H. Tojo et aL/Journal of Biotechnology 33 (1994)55-62

amount of rhPDI by cultivating these clones. We applied mutagenesis for B. brevis H P D 3 1 / pNU200-PDI with N-methyl-N'-nitro-N-nitrosoguanidine to stabilize the expression and screened clones constantly expressing rhPDI by colony immunoassay and Western blot analysis. As there was a possibility that the isolated clones were mutated within the PDI coding region, plasmids in these clones were eliminated by repeated inoculation into an erythromycin-free T2 medium. The resulting host strain, B. brevis HPD31-T1, was transformed again by pNU200-PDI to obtain a clone constantly expressing rhPDI. Fig. 2 shows a Western blot analysis of the culture supernatant after the cultivation of B. brevis HPD31-T1 carrying pNU200-PDI in T3 medium at 28°C for 24 h. 3.2. Purification of rhPDI secreted by B. brevis B. brevis HPD31-T1 carrying pNU200-PDI was grown for 16 h at 28°C in T3 medium, rhPDI produced in the culture supernatant was purified as described in Materials and methods. The magnitude of purification for the final preparation was approx. 50-fold starting from the culture supernatant and the recovery of activity was 56.8%. The purified rhPDI gave a single peak on gel-permeation chromatography (GPC) and a single band on reduced SDS-PAGE (Fig. 3). The molecular mass was determined to be 57 kDa by reduced and non-reduced SDS-PAGE and approx. 120 kDa by GPC. These results suggest that the rhPDI secreted by B. brevis exists as a homodimer linked by non-covalent bonds. 3.3. Structural analysis of rhPDI secreted by B. brevis The sequence of nineteen amino terminal amino acid residues of the purified rhPDI corresponded exactly to those predicted from the cDNA sequence of human PDI (Fig. 4). This indicates that the MWP-PDI fusion protein was correctly processed in the protein secreting system of B. brevis. 3.4. Characteristics of rhPDI The activity of rhPDI was compared with that of a natural PDI preparation derived from hu-

man placenta (Horiuchi et al., to be published) by determining the rate of reactivation of scrambled RNase. The specific activities of rhPDI and natural human PDI were 125 units mg -~ and 121 units mg-t, respectively. These results indicated that the rhPDI produced by B. brevis was fully active. DTT or glutathione greatly influenced the PDI activity. The optimum concentration of DT-F was 3 /zM (Fig. 5A) and those of reduced and oxidized glutathione (GSH and GSSG) were 0.6 mM and 0.06 mM, respectively (Fig. 5B). The optimum temperature for reactivation and the optimum pH were 20°C (Fig. 5C) and 7.5, respectively.

4. Discussion

We have constructed an efficient expressionsecretion system to produce a fully active rhPDI using a B. brevis host-vector system and succeeded in obtaining a sufficient amount of rhPDI. rhPDI was secreted into the culture medium at the late exponential growth phase as an exactly processed molecular form. The amount of secreted rhPDI as measured by Western blot analysis was 5 mg 1-1 Previous reports have described the production of salivary a-amylase (Konishi et al., 1990), growth hormone (to be published) and, epidermal growth factor (Yamagata et al., 1989; Ebisu et al., 1992) with this B. brevis system as high as 0.06, 0.2 and 1.1 g/liter, respectively. The amount of rhPDI secreted was small compared to that of those proteins. The molecular mass of the heterologous proteins may influence the secretion efficiency for B. brevis (PDI and a-amylase, 57-58 kDa; growth hormone, 22 kDa; epidermal growth factor, 6 kDa). In addition, the expression of the rhPDI may cause a specific stress that damages the cytoplasmic membrane of the host cell besides the general stress caused by expressing a large amount of heterologous proteins. Characteristics of rhPDI were similar to those of bovine liver PDI (Lambert and Freedman, 1983). The activity of rhPDI using scrambled RNase as substrate was affected by both DTT concentration and glutathione concentration (Fig.

H. Tojo et al. /Journal of Biotechnology 33 (1994) 55-62

5A and B). This indicates that PDI requires disulfide reagents for its enzymic activity and the initial moderate reduction of scrambled RNase made by the disulfide reagents is essential. In addition, because there are optimum concentrations for both GSH and GSSG, scrambled RNase is suggested to have an optimum redox state to have its rearrangement reaction accelerated. It is expected that different substrates of PDI have their own optimum redox conditions for refolding. The activity of rhPDI was only moderately affected by temperature and the relative activity at 4°C ~as approx, one half of that at the optimum temperature (Fig. 5C). These suggest that PDI could be conveniently used to refold scrambled proteins which are sensitive to heat. Some proteins are hardly obtained in biologically active forms by using conventional techniques. Okumura et al. (1988) reported that human pro-urokinase expressed in Escherichia coli was efficiently refolded with bovine liver PDI. We also succeeded in refolding E. coli-derived human interleukin 2 with the rhPDI obtained in this paper (to be published). Further study is under way on the application of rhPDI to those proteins which are difficult to refold.

5. Acknowledgments We thank Drs. H. Yamagata and K. Nakahama foi helpful discussions throughout this work. We are grateful to Mr. K. Kawahara for amino acid sequence analysis.

6. References Boado, R.J., Campbell, D.A. and Chopra, I.J. (1988) Nucleotide sequence of rat liver iodothyronine 5'-monodeiodenase (5'-MD): Its identity with the protein disulfide isomerase. Biochem. Biophys. Res. Commun. 155, 12971304. Cheng, S.Y., Gong, Q.H., Parkinson, C., Robinson, E.A., Apella, E., Merlino, G.T. and Pastan, I. (1987) The nucleotide sequence of a human cellular thyroid hormone binding protein present in endoplasmic reticulum. J. Biol. Chem. 262, 11221-11227. Ebisu, S., Takagi, H., Kadowaki, K., Yamagata, H. and Udaka,

61

S. (1992) Production of human epidermal growth factor by Bacillus brevis increased with use of a stable plasmid from B. brevis 481. Biosci. Biotech. Biochem. 56, 812-813. Edman, J.C., Ellis, L., Blacher, R.W., Roth, R.A. and Rutter, W.J. (1987) Sequence of protein disulfide isomerase and implications of its relationship to thioredoxin. Nature 317, 267-270. Freedman, R.B. (1989) Protein disulfide isomerase: Multiple roles in the modification of nascent secretory proteins. Cell 57, 1069-1072. Geetha-Habib, M., Noiva, R., Kaplan, H.A. and Lennarz, W.J. (1988) Glycosylation site binding protein, a component of oligosaccharyl transferase, is highly similar to three other 57 kd luminal proteins of the ER. Cell 54, 1053-1060. Helfman, D.M., Feramisco, J.R., Fiddes, J.C., Thomas, G.P. and Hughs, S.H. (1983) Identification of clones that encode chicken tropomyosin by direct immunological screening of a cDNA expression library. Proc. Natl. Acad. Sci. USA 80, 31-35. Hillson, D.A., Lambert, N. and Freedman, R.B. (1984) Formation and isomerization of disulfide bonds in proteins: Protein disulfide isomerase. Methods Enzymol. 107, 281294. Horiuchi, R., Yamauchi, K., Hayashi, H., Koya, S., Takeuchi, Y., Kato, K., Kobayashi, M. and Takikawa, H. (1989) Purification and characterization of 55-kDa protein with 3,5,3'-triiodo-L-thyronine-binding activity and protein disulfide-isomerase activity from beef liver membrane. Eur. J. Biochem. 183, 529-538. Kaetzel, C.S., Rao, C.K. and Lamm, M.E.(1987) Protein disulfide-isomerase from human placenta and rat liver. Biochem. J. 241, 39-47. Koivu, J. and Myllyla, R. (1987) Interchain disulfide bond formation in types I and II procollagen. J. Biol. Chem. 262, 6159-6164. Koivu, J., Myllyla, R., Helaakoski, T., Pihlajaniemi, T., Tasanen, K. and Kivirikko, K.I. (1987) A single polypeptide acts both as the/3 subunit of prolyl 4-hydroxylase and as a protein disulfide-isomerase. J. Biol. Chem. 262, 6447-6449. Konishi, H., Sato, T., Yamagata, H. and Udaka, S. (1990) Efficient production of human a-amylase by a Bacillus brevis mutant. Appl. Microbiol. Biotechnol. 34, 297-302. Lambert, N. and Freedman, R.B. (1983) Structural properties of homogeneous protein disulfide isomerase from bovine liver purified by a rapid high-yielding procedure. Biochem. J. 213, 225-234. Marston, F.A.O. (1986) The purification of eukaryotic polypeptides synthesized in Escherichia coll. Biochem. J. 240, 1-12. Okumura, K., Miyake, Y., Wakayama, H., Miyake, T., Murayama, K., Seto, K., Taguchi, H. and Shimabayashi, Y. (1988) Effects of protein disulfide-isomerase on the refolding of human pro-urokinase cloned and expressed in Escherichia coli. Agric. Biol. Chem. 52, 1735-1739. Pihlajaniemi, T., Helaakoski, T., Tasanen, K., Myllyla, R., Huhtala, M.L., Koivu, J. and Kivirikko, K.I. (1987) Molecular cloning of the /3-subunit of human prolyl 4-hydroxyl-

62

H. Tojo et al. /Journal of Biotechnology 33 (1994) 55-62

ase. This subunit and protein disulfide isomerase are products of the same gene. EMBO J. 6, 643-649. Roth, R.A. and Pierce, S.B. (1987) In vivo cross-linking of protein disulfide isomerase to immunoglobulins. Biochemistry 26, 4179-4182. Takagi, H., Kadowaki, K. and Udaka, S. (1989a) Screening and characterization of protein-hyperproducing bacteria without detectable exoprotease activity. Agric. Biol. Chem. 53, 691-699. Takagi, H., Kagiyama, S., Kadowaki, K., Tsukagoshi, N. and Udaka, S. (1989b) Genetic transformation of Bacillus brev/s with plasmid DNA by electroporation. Agric. Biol. Chem. 53, 3099-3100. Tsuboi, A., Uchihi, R., Tabata, R., Takahashi, Y., Hashida, H., Sasaki, T., Yamagata, H., Tsukagoshi, N. and Udaka, S. (1986) Characterization of the genes coding for two major cell wall proteins from protein-producing Bacillus

brevis 47: Complete nucleotide sequence of the outer wall protein gene. J. Bacteriol. 168, 365-373. Udaka, S. (1976) Screening for protein-producing bacteria. Agric. Biol. Chem. 40, 523-528. Udaka, S., Tsukagosi, N. and Yamagata, H. (1989) Bacillus brevis, a host bacterium for efficient extracellular production of useful proteins. Biotech. Genet. Eng. Rev., 7, 113-146. Yamagata, H., Nakahama, K., Suzuki, Y., Kakinuma, A., Tsukagoshi, N. and Udaka, S. (1989) Use of Bacillus brevis for efficient synthesis and secretion of human epidermal growth factor. Proc. Natl. Acad. Sci. USA 86, 3589-3593. Yamauchi, K.,Yamamoto, T., Hayashi, H., Koya, S., Takikawa, H., Toyoshima, K. and Horiuchi, R. (1987) Sequence of membrane-associated thyroid hormone binding protein from bovine liver: Its identity with protein disulfide isomerase. Biochem. Biophys. Res. Commun. 146, 1485-1492.