- Email: [email protected]
Production of PHA (poly hydroxyalkanoate) by genetically engineered marine cyanobacterium
T. Inui, M. Anpo, K. Izui, S. Yanagida, T. Yamaguchi (Editors) Advances in Chemical Conversions for Mitigating Carbon Dioxide Studies in Surface Science and Catalysis, Vol. 114 9 1998 Elsevier Science B.V. All rights reserved.
237
Production of PHA (poly hydroxyalkanoate) by genetically engineered marine cyanobacterium H. Miyasaka ", H. Nakano ~, H. Akiyama ~, S. Kanai ~and M. Hirano b "Kansai Electric Power Co., Inc., Technical Research Center, 11-20 Nakoji 3Chome, Amagasaki, Hyogo 661, Japan ~Bioiogical Sciences Department, Toray Research Center, Inc., 1111 Tebiro, Kamakura, Kanagawa 248, Japan
To develop a basic system for the biological conversion of 002 into useful industrial materials, the vector-promoter system for the expression of foreign genes in the marine cyanobacterium was established. Using this system, the production of a biodegradable plastic, PHA (poly hydroxyalkanoate), by the genetically engineered cyanobacterial cells was examined. The transformant cyanobacterial cells carrying the poly hydroxybutyrate (PHB)-synthesizing genes of hydrogen bacterium (Alcaligenes eutrophus) produced up to 17 % of the cell dry weight of PHA.
1. INTRODUCTION Although the fixing of 002 by photosynthetic microorganisms can be an efficient system for the removal of CO2 in flue gases from thermal power plants and other industrial sources, one of the major problems of this system is the effective utilization of the fixed biomass. The biomass produced by photosynthetic microorganisms must be utilized as a resource, or it will be easily degraded by microorganisms into CO2 again. There have been, however, only a few reports on the possible utilization methods of fixed biomass, such as the utilization for animal feeds [1] and fuels [2]. Thus the introduction of foreign genes into photosynthetic microorganisms for the production of useful materials is an important technological approach. Cyanobacteria are procaryotic photosynthetic microorganisms and can provide a simple genetic transformation system. In this study, we established an efficient vector-promoter system for the introduction and expression of foreign
238
genes in the marine cyanobacterium Synechococcus sp. PCC7002, and examined the production of biodegradable plastic, PHA, by genetically engineered cyanobacteria. PHA has already been commercially produced by bacterial cultures using organic compounds as substrates. The production of biodegradable plastics by photoautotrophic organisms has several advantages on the protection of the global environment as follows: (i) CO2 in flue gases from industrial sources can be converted into useful resources; (ii) the use of plastics made from CO2 can reduce the consumption of fossil fuel resources by substituting the chemical plastics made from petrochemicals; and (iii) the use of biodegradable plastics can reduce the environmental pollution caused by the chemical plastics. 2. EXPERIMENTAL
The unicellular marine cyanobacterium Synechococcus sp. PCC7002 was grown under continuous illumination at 32 ~ C in A2 medium [3]. The nucleotide sequences were determined using an ABI 373S DNA sequencer (Perkin-Elmer). The CAT (chloramphenicol acetyltransferase) activities in bacterial and cyanobacterial cells were determined by the spectrophotometric assay method [4]. The PHB gene [5] was cloned from the originally constructed genomic library of Alcaligenes eutrophus, using the PCR amplified DNA fragment as the probe. For the extraction of PHA from cyanobacterial cells, the cells were disrupted by a sonication and extracted with chloroform. The PHA was then precipitated by adding methanol to the chloroform solution, dried, and weighed. For GC-MS analyses, the PHA was alkaline hydrolyzed and silylated by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (MTBSTFA). The tert-butyldimethylsilylated derivatives of I~-hydroxybutyric acid and lactic acid were identified by comparing the retention time of GC and the mass fragmentation patterns of MS with commercial standard samples. The molecular weight (M.W.) of PHA was determined by gel permeation chromatography (GPC). 3. RESULTS
AND
DISCUSSION
3.1. Construction of shuttle-vectors For the construction of a shuttle-vector between E. coil and the marine cyanobacterium Synechococcus sp. PCC7002, we isolated and characterized the smallest endogenous plasmid pAQ1 (DDBJ Accession No. D13972) of this cyanobacterium. The DNA sequence analysis revealed that plasmid pAQ1 was 4809 bp long and had four ORFs, ORF943, ORF64, ORF71, and ORF93 (numbers show the putative amino acid numbers). The construction of the shuttle-vector was
239 done by digesting pAQ1 plasmid and pUC19 plasmid of E. coli with restriction enzymes, which cleave each plasmid at a unique site, and by ligating the linearized plasmids. The plasmid pUC19 and the plasmid pAQ1 were linearized by Sma I and Stu I digestions, respectively, and were ligated to generate the shuttle-vector pAQJ6 (Fig. 1; both Sma land Stul are blunt-end forming restriction enzymes). EcoRI Sacl
Stul
a,
Stu,
~ ' ORF64i4~O:;:P43)~'--Sac'
SaClHind~l EcoRI Sacl
Amp
pAQJ6
EcoRI Sacl (partial digestion)
Ligation
Sacl
~
ac'
v
Hindlll
\
Hindlll / ~ ~ : , a c i Sacl~
sa
Sail
Figure 1. Construction of shuttle-vector betweenE, coli and Synechococcus sp. PCC7002. The effect of four ORFs on the transformation efficiency of the shuttle-vector was examined by introducing various deletions into these ORFs. Figure 2 shows the effects of the deletions in ORF943 on the transformation efficiency of the shuttlevector. When the deletions were introduced into ORF943 from 5' side, the transformation efficiency decreased stepwise, indicating that this ORF plays an important role in the maintenance of shuttle-vectors in cyanobacterial cells. The other ORFs, ORF64, ORF71, and ORF93 showed no significant effect on the transformation efficiency of this shuttle-vector (data not shown). From these results the simplified shuttle-vector pAQJ4 with full ORF943 was constructed from the pAQJ6 vector (Fig. 1). The transformation efficiency of the shuttle-vector pAQJ4 was about 3.6 x 105 (cfu / l~g DNA), when we transformed 4 x 107 of cyanobacterial cells with 0.3 l~g (0.1 pmol) of pAQJ4 vector in 1 ml solution. This transformation efficiency was 10 -~ 100 times higher than the shuttle-vectors for this cyanobacterium previously reported [6,7].
240
pUC19
Vector
Sac~/Sac/ S~cl
Hind/l/
I
I
Sicl/Ec~
Hind/I/
Transformation efficiency (cfu / l~g DNA) 3.6 x 10 5
(1-3201) pAQJ4-D 1 (1142-3201 )
~ ORF943 .... ................................................. ! ~
pAQJ4-D2 (1978-3201)
Amp
5.2 x 10 4
.................................. ~
pAQJ4-D3 (2264-3201)
3.6 X 10 4
3.7 X 10 3
. . . . . . . . . . . . . . . . . . . . . . . . . . .
~
Figure 2. Effects of the deletion in ORF943 on the transformation efficiency of shuttle-vectors
3.2. Development of effective promoter Next, we developed the effective promoter for the expression of foreign genes on the shuttle-vector, pAQJ4. The promoter of the RuBisco (rbc) gene of this cyanobacterium was chosen for the source of strong promoter, and the rbc gene was isolated by screening the genomic library of this cyanobacterium. Our genomic clone of the rbc gene (DDBJ Accession No. D13971) was 4234 bp long and had 962 bp in the 5' upstream region of the rbc large subunit (Fig. 3a). We introduced various deletions into this 5' upstream region and determined the precise promoter region by both bacterial and cyanobacterial CAT assays [8]. The promoter activity existed in the region close to the coding region of the rbc large subunit (Fig. 3b, c). Sau3AI/BamHI
EcoRI
300bp
vtl (a) Structure of rbc gene
rbcL
rbcS
i
i
/ Sau3AI/BamHI
(b) 5' Upstream region (962 bp)
(c) Promoter region (possible -35 and -10 sequences are underlined)
...... , .......
BamHI
,,,,,,,J
I
........................
__GCTAATCAGCCCAAAAAACAAAAGCAATCTTTTTTTGTTGCTAAAAGATAAAA
-i0 ATAAGTCGAGGCTGTGGTAACATATCCCACAGATTAAAGAAA
Figure 3. Structure of rbc gene of
Synechococcussp. PCC7002.
241
We also examined the effects of the 5' upstream region of the rbc gene on the promoter activity, by dividing the 962 bp of upstream region into three fragments, as shown in Fig. 3b, and connecting these fragments in various combinations to pAQJ4-CAT vector [8] (Fig. 4). We found that the AT-rich region of -303 to -654 upstream of the rbc gene had some repressive effects on the promoter activity (by the comparison of pAQ-EX6 and pAQ-EX8), and that the -655 to -962 region had some enhancing effects on the promoter activity (by the comparison of pAQ-EX1 and pAQ-EX6). When the -655 to -962 region was connected to the upstream of the bacterial tac promoter, the activity of the tac promoter was also enhanced both in E. coli and cyanobacterium (pAQ-rbc+trc of Fig. 4), indicating that the enhancing effect of this region might work universally in procaryotic cells. From these results, we designed the new strong promoter by removing the -303 to -654 region from the 5' upstream region of the rbc gene (pAQEX6 promoter of Fig. 4). The pAQJ4 vector with the pAQEX6 promoter, however, was found to be unstable in the cyanobacterial cells, and the modifications to increase its stability are in progress. Thus, for the production of PHA, we used the pAQJ4 vector with the pAQEXl promoter. Sau 3AI/Bam HI -962
Promoter
Bam HI
Eco R I
-655
-304
k\~-~t,~,~,~,~~~,~,~,~:~,!
pAQ-EXl
i
-1
- I E.coli
=- I
P0C7002~
pAQ-EX3
pAQ-EX6
iii~i~i!i~~i~iii~i~l
L~"-.I
I
=1
~ I
pAQ-EX8 No promoter (pAQJ4/cat) tac promoter V ~ A
pAQ-trc
pAQ-rbc+trc
~
tac promoter ~'/~/,,! 0
0
1
i
20
I
30
40
CAT activity (~mol/mg/min) Figure 4. Effects of 5' upstream region of rbc gene on the promoter activity.
242
3.3.
Production of PHA in the genetically engineered cyanobacterial cells For the production of PHA in the cyanobacterial cells, the PHB genes from A/ca/igenes eutrophus were introduced into the pAQJ4 vector under the control of the pAQEXl promoter. The growth rate of the cyanobacterial cells with PHB genes, and with only the pAQJ4 vector (control), did not show any difference. The production of PHA by the transformant cells was examined after more than 5 passages of the culture. The transformant cells showed different PHA contents depending on the culture conditions, and the maximum productivity was about 17 % of the cell dry weight. This productivity was several times higher than that of the fresh water cyanobacterial transformant cells, carrying the PHB genes, previously reported [9]. The PHA produced by the transformed cyanobacterial cells was identified by GC-MS analysis. The constituents of PHA of the cyanobacterial cells were 15hydroxybutyric acid, lactic acid, and other unknown hydroxyalkanoic acids, and the major constituent was 13-hydroxybutyric acid. The average molecular weight (M.W.) of PHA produced by the cyanobacterial cells was about 1,000,000, similar to the average M.W. of PHA from A/ca/igenes eutrophus. REFERENCES 1. Y. Watanabe and D.O. Hall, Energy Convers. Mgmt., 36 (1995) 721. 2. J.R. Benemann, Energy Convers. Mgmt., 34 (1993) 999. 3. E.R. Tabita, S.E. Stevens and R. Quijano, Biochem. Biophys. Res. Commun., 61 (1974) 45. 4. W.V. Shaw, Methods Enzymol, 156 (1975) 737. 5. O.P. Peoples and A.J. Sinskey, J. Biol. Chem., 264 (1989) 15293. 6. J.S. Buzby, R.D. Porter and S.E. Stevens, J. Bacteriol., 154 (1983) 1446. 7. R.L. Lorimier, G. Guglielmi, D.A. Bryant and S.E. Stevens, J. Bacteriol., 169 (1987) 1830. 8. H. Akiyama, S. Kanai, M. Hirano and H. Miyasaka, submitted for publication in Gene . 9. T. Suzuki, M. Miyake, Y. Tokiwa, H. Saegusa, T. Saito and Y. Asada, Biotech. Lett., 18 (1996) 1047.
237
Production of PHA (poly hydroxyalkanoate) by genetically engineered marine cyanobacterium H. Miyasaka ", H. Nakano ~, H. Akiyama ~, S. Kanai ~and M. Hirano b "Kansai Electric Power Co., Inc., Technical Research Center, 11-20 Nakoji 3Chome, Amagasaki, Hyogo 661, Japan ~Bioiogical Sciences Department, Toray Research Center, Inc., 1111 Tebiro, Kamakura, Kanagawa 248, Japan
To develop a basic system for the biological conversion of 002 into useful industrial materials, the vector-promoter system for the expression of foreign genes in the marine cyanobacterium was established. Using this system, the production of a biodegradable plastic, PHA (poly hydroxyalkanoate), by the genetically engineered cyanobacterial cells was examined. The transformant cyanobacterial cells carrying the poly hydroxybutyrate (PHB)-synthesizing genes of hydrogen bacterium (Alcaligenes eutrophus) produced up to 17 % of the cell dry weight of PHA.
1. INTRODUCTION Although the fixing of 002 by photosynthetic microorganisms can be an efficient system for the removal of CO2 in flue gases from thermal power plants and other industrial sources, one of the major problems of this system is the effective utilization of the fixed biomass. The biomass produced by photosynthetic microorganisms must be utilized as a resource, or it will be easily degraded by microorganisms into CO2 again. There have been, however, only a few reports on the possible utilization methods of fixed biomass, such as the utilization for animal feeds [1] and fuels [2]. Thus the introduction of foreign genes into photosynthetic microorganisms for the production of useful materials is an important technological approach. Cyanobacteria are procaryotic photosynthetic microorganisms and can provide a simple genetic transformation system. In this study, we established an efficient vector-promoter system for the introduction and expression of foreign
238
genes in the marine cyanobacterium Synechococcus sp. PCC7002, and examined the production of biodegradable plastic, PHA, by genetically engineered cyanobacteria. PHA has already been commercially produced by bacterial cultures using organic compounds as substrates. The production of biodegradable plastics by photoautotrophic organisms has several advantages on the protection of the global environment as follows: (i) CO2 in flue gases from industrial sources can be converted into useful resources; (ii) the use of plastics made from CO2 can reduce the consumption of fossil fuel resources by substituting the chemical plastics made from petrochemicals; and (iii) the use of biodegradable plastics can reduce the environmental pollution caused by the chemical plastics. 2. EXPERIMENTAL
The unicellular marine cyanobacterium Synechococcus sp. PCC7002 was grown under continuous illumination at 32 ~ C in A2 medium [3]. The nucleotide sequences were determined using an ABI 373S DNA sequencer (Perkin-Elmer). The CAT (chloramphenicol acetyltransferase) activities in bacterial and cyanobacterial cells were determined by the spectrophotometric assay method [4]. The PHB gene [5] was cloned from the originally constructed genomic library of Alcaligenes eutrophus, using the PCR amplified DNA fragment as the probe. For the extraction of PHA from cyanobacterial cells, the cells were disrupted by a sonication and extracted with chloroform. The PHA was then precipitated by adding methanol to the chloroform solution, dried, and weighed. For GC-MS analyses, the PHA was alkaline hydrolyzed and silylated by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (MTBSTFA). The tert-butyldimethylsilylated derivatives of I~-hydroxybutyric acid and lactic acid were identified by comparing the retention time of GC and the mass fragmentation patterns of MS with commercial standard samples. The molecular weight (M.W.) of PHA was determined by gel permeation chromatography (GPC). 3. RESULTS
AND
DISCUSSION
3.1. Construction of shuttle-vectors For the construction of a shuttle-vector between E. coil and the marine cyanobacterium Synechococcus sp. PCC7002, we isolated and characterized the smallest endogenous plasmid pAQ1 (DDBJ Accession No. D13972) of this cyanobacterium. The DNA sequence analysis revealed that plasmid pAQ1 was 4809 bp long and had four ORFs, ORF943, ORF64, ORF71, and ORF93 (numbers show the putative amino acid numbers). The construction of the shuttle-vector was
239 done by digesting pAQ1 plasmid and pUC19 plasmid of E. coli with restriction enzymes, which cleave each plasmid at a unique site, and by ligating the linearized plasmids. The plasmid pUC19 and the plasmid pAQ1 were linearized by Sma I and Stu I digestions, respectively, and were ligated to generate the shuttle-vector pAQJ6 (Fig. 1; both Sma land Stul are blunt-end forming restriction enzymes). EcoRI Sacl
Stul
a,
Stu,
~ ' ORF64i4~O:;:P43)~'--Sac'
SaClHind~l EcoRI Sacl
Amp
pAQJ6
EcoRI Sacl (partial digestion)
Ligation
Sacl
~
ac'
v
Hindlll
\
Hindlll / ~ ~ : , a c i Sacl~
sa
Sail
Figure 1. Construction of shuttle-vector betweenE, coli and Synechococcus sp. PCC7002. The effect of four ORFs on the transformation efficiency of the shuttle-vector was examined by introducing various deletions into these ORFs. Figure 2 shows the effects of the deletions in ORF943 on the transformation efficiency of the shuttlevector. When the deletions were introduced into ORF943 from 5' side, the transformation efficiency decreased stepwise, indicating that this ORF plays an important role in the maintenance of shuttle-vectors in cyanobacterial cells. The other ORFs, ORF64, ORF71, and ORF93 showed no significant effect on the transformation efficiency of this shuttle-vector (data not shown). From these results the simplified shuttle-vector pAQJ4 with full ORF943 was constructed from the pAQJ6 vector (Fig. 1). The transformation efficiency of the shuttle-vector pAQJ4 was about 3.6 x 105 (cfu / l~g DNA), when we transformed 4 x 107 of cyanobacterial cells with 0.3 l~g (0.1 pmol) of pAQJ4 vector in 1 ml solution. This transformation efficiency was 10 -~ 100 times higher than the shuttle-vectors for this cyanobacterium previously reported [6,7].
240
pUC19
Vector
Sac~/Sac/ S~cl
Hind/l/
I
I
Sicl/Ec~
Hind/I/
Transformation efficiency (cfu / l~g DNA) 3.6 x 10 5
(1-3201) pAQJ4-D 1 (1142-3201 )
~ ORF943 .... ................................................. ! ~
pAQJ4-D2 (1978-3201)
Amp
5.2 x 10 4
.................................. ~
pAQJ4-D3 (2264-3201)
3.6 X 10 4
3.7 X 10 3
. . . . . . . . . . . . . . . . . . . . . . . . . . .
~
Figure 2. Effects of the deletion in ORF943 on the transformation efficiency of shuttle-vectors
3.2. Development of effective promoter Next, we developed the effective promoter for the expression of foreign genes on the shuttle-vector, pAQJ4. The promoter of the RuBisco (rbc) gene of this cyanobacterium was chosen for the source of strong promoter, and the rbc gene was isolated by screening the genomic library of this cyanobacterium. Our genomic clone of the rbc gene (DDBJ Accession No. D13971) was 4234 bp long and had 962 bp in the 5' upstream region of the rbc large subunit (Fig. 3a). We introduced various deletions into this 5' upstream region and determined the precise promoter region by both bacterial and cyanobacterial CAT assays [8]. The promoter activity existed in the region close to the coding region of the rbc large subunit (Fig. 3b, c). Sau3AI/BamHI
EcoRI
300bp
vtl (a) Structure of rbc gene
rbcL
rbcS
i
i
/ Sau3AI/BamHI
(b) 5' Upstream region (962 bp)
(c) Promoter region (possible -35 and -10 sequences are underlined)
...... , .......
BamHI
,,,,,,,J
I
........................
__GCTAATCAGCCCAAAAAACAAAAGCAATCTTTTTTTGTTGCTAAAAGATAAAA
-i0 ATAAGTCGAGGCTGTGGTAACATATCCCACAGATTAAAGAAA
Figure 3. Structure of rbc gene of
Synechococcussp. PCC7002.
241
We also examined the effects of the 5' upstream region of the rbc gene on the promoter activity, by dividing the 962 bp of upstream region into three fragments, as shown in Fig. 3b, and connecting these fragments in various combinations to pAQJ4-CAT vector [8] (Fig. 4). We found that the AT-rich region of -303 to -654 upstream of the rbc gene had some repressive effects on the promoter activity (by the comparison of pAQ-EX6 and pAQ-EX8), and that the -655 to -962 region had some enhancing effects on the promoter activity (by the comparison of pAQ-EX1 and pAQ-EX6). When the -655 to -962 region was connected to the upstream of the bacterial tac promoter, the activity of the tac promoter was also enhanced both in E. coli and cyanobacterium (pAQ-rbc+trc of Fig. 4), indicating that the enhancing effect of this region might work universally in procaryotic cells. From these results, we designed the new strong promoter by removing the -303 to -654 region from the 5' upstream region of the rbc gene (pAQEX6 promoter of Fig. 4). The pAQJ4 vector with the pAQEX6 promoter, however, was found to be unstable in the cyanobacterial cells, and the modifications to increase its stability are in progress. Thus, for the production of PHA, we used the pAQJ4 vector with the pAQEXl promoter. Sau 3AI/Bam HI -962
Promoter
Bam HI
Eco R I
-655
-304
k\~-~t,~,~,~,~~~,~,~,~:~,!
pAQ-EXl
i
-1
- I E.coli
=- I
P0C7002~
pAQ-EX3
pAQ-EX6
iii~i~i!i~~i~iii~i~l
L~"-.I
I
=1
~ I
pAQ-EX8 No promoter (pAQJ4/cat) tac promoter V ~ A
pAQ-trc
pAQ-rbc+trc
~
tac promoter ~'/~/,,! 0
0
1
i
20
I
30
40
CAT activity (~mol/mg/min) Figure 4. Effects of 5' upstream region of rbc gene on the promoter activity.
242
3.3.
Production of PHA in the genetically engineered cyanobacterial cells For the production of PHA in the cyanobacterial cells, the PHB genes from A/ca/igenes eutrophus were introduced into the pAQJ4 vector under the control of the pAQEXl promoter. The growth rate of the cyanobacterial cells with PHB genes, and with only the pAQJ4 vector (control), did not show any difference. The production of PHA by the transformant cells was examined after more than 5 passages of the culture. The transformant cells showed different PHA contents depending on the culture conditions, and the maximum productivity was about 17 % of the cell dry weight. This productivity was several times higher than that of the fresh water cyanobacterial transformant cells, carrying the PHB genes, previously reported [9]. The PHA produced by the transformed cyanobacterial cells was identified by GC-MS analysis. The constituents of PHA of the cyanobacterial cells were 15hydroxybutyric acid, lactic acid, and other unknown hydroxyalkanoic acids, and the major constituent was 13-hydroxybutyric acid. The average molecular weight (M.W.) of PHA produced by the cyanobacterial cells was about 1,000,000, similar to the average M.W. of PHA from A/ca/igenes eutrophus. REFERENCES 1. Y. Watanabe and D.O. Hall, Energy Convers. Mgmt., 36 (1995) 721. 2. J.R. Benemann, Energy Convers. Mgmt., 34 (1993) 999. 3. E.R. Tabita, S.E. Stevens and R. Quijano, Biochem. Biophys. Res. Commun., 61 (1974) 45. 4. W.V. Shaw, Methods Enzymol, 156 (1975) 737. 5. O.P. Peoples and A.J. Sinskey, J. Biol. Chem., 264 (1989) 15293. 6. J.S. Buzby, R.D. Porter and S.E. Stevens, J. Bacteriol., 154 (1983) 1446. 7. R.L. Lorimier, G. Guglielmi, D.A. Bryant and S.E. Stevens, J. Bacteriol., 169 (1987) 1830. 8. H. Akiyama, S. Kanai, M. Hirano and H. Miyasaka, submitted for publication in Gene . 9. T. Suzuki, M. Miyake, Y. Tokiwa, H. Saegusa, T. Saito and Y. Asada, Biotech. Lett., 18 (1996) 1047.