Progesterone effects on oligodendrocyte differentiation in injured spinal cord

Brain Research 1708 (2019) 36–46

Contents lists available at ScienceDirect

Brain Research journal homepage: www.elsevier.com/locate/brainres

Research report

Progesterone effects on oligodendrocyte differentiation in injured spinal cord Ignacio Jurea, Alejandro F. De Nicolaa,b, Florencia Labombardaa,b, a b

T

⁎

Laboratory of Neuroendocrine Biochemistry, Instituto de Biologia y Medicina Experimental, Vuelta de Obligado 2490, 1428 Buenos Aires, Argentina Dept. of Human Biochemistry, Faculty of Medicine, University of Buenos Aires, Paraguay 2155 C1121, Buenos Aires, Argentina

H I GH L IG H T S

differentiation program fails after spinal cord injury. • Oligodendrocyte upregulates the oligodendrocyte differentiation program. • Pg increases the number of TGFβ1 + astrocytes and microglial cells. • Pg • TGFβ1 emerges as a possible mediator of Pg differentiating effects.

A R T I C LE I N FO

A B S T R A C T

Keywords: Progesterone Oligodendrocytes precursor cells TGFβ1 Microglial cells Remyelination Spinal cord injury

Spinal cord lesions result in chronic demyelination as a consequence of secondary injury. Although oligodendrocyte precursor cells proliferate the differentiation program fails. Successful differentiation implies progressive decrease of transcriptional inhibitors followed by upregulation of activators. Progesterone emerges as an antiinflammatory and pro-myelinating agent which improves locomotor outcome after spinal cord injury. In this study, we have demonstrated that spinal cord injury enhanced oligodendrocyte precursor cell number and decreased mRNA expression of transcriptional inhibitors (Id2, Id4, hes5). However, mRNA expression of transcriptional activators (Olig2, Nkx2.2, Sox10 and Mash1) was down-regulated 3 days post injury. Interestingly, a differentiation factor such as progesterone increased transcriptional activator mRNA levels and the density of Olig2- expressing oligodendrocyte precursor cells. The differentiation program is regulated by extracellular signals which modify transcriptional factors and epigenetic players. As TGFβ1 is a known oligodendrocyte differentiation factor which is regulated by progesterone in reproductive tissues, we assessed whether TGFβ1 could mediate progesterone remyelinating actions after the lesion. Notwithstanding that astrocyte, oligodendrocyte precursor and microglial cell density increased after spinal cord injury, the number of these cells which expressed TGFβ1 remained unchanged regarding sham operated rats. However, progesterone treatment increased TGFβ1 mRNA expression and the number of astrocytes and microglial TGFβ1 expressing cells which would indirectly enhance oligodendrocyte differentiation. Therefore, TGFβ1 arises as a potential mediator of progesterone differentiating effects on oligodendrocyte linage.

1. Introduction Primary mechanical insult after spinal cord injury (SCI) leads to a cascade of biological events described as secondary injury resulting in further neurological damage. Among these events, the loss of axons and oligodendrocytes (OL) in the ascending and descending pathways contribute principally to the progressive failure of function after SCI (Rabchevsky et al., 2007). Indeed, therapies which cause a small increase in spare white matter result in a substantial recovery of

⁎

locomotor function (Kloos et al., 2005; Schucht et al., 2002). OL loss after SCI, just like in other demyelinating diseases, is mostly due to the inflammatory response orchestrated by microglial cells and infiltrated immune cells alongside with astrocytes (Kempuraj et al., 2016; Mekhail et al., 2012; Miron and Franklin, 2014). Previous experiments using animal models of traumatic SCI have shown that oligodendrocyte precursor cells (OPC) proliferate in response to injury but do not reach a differentiation and maturation stage, preventing remyelination (Horky et al., 2006; Ishii et al., 2001;

Corresponding author at: Instituto de Biología y Medicina Experimental, Vuelta de Obligado 2490, C1428ADN, Buenos Aires, Argentina. E-mail address: fl[email protected] (F. Labombarda).

https://doi.org/10.1016/j.brainres.2018.12.005 Received 25 September 2018; Received in revised form 27 November 2018; Accepted 4 December 2018 Available online 05 December 2018 0006-8993/ © 2018 Elsevier B.V. All rights reserved.

Brain Research 1708 (2019) 36–46

I. Jure et al.

(COX-2 and iNOS) inhibiting NFkB via a PR-dependent mechanism (Labombarda et al., 2011, 2015) Finally, using magnetic resonance imaging (MRI) and the sophisticated CatWalk locomotor analysis, we have previously demonstrated that progesterone reduces secondary damage, preserves white matter and improves locomotor outcome after spinal cord injury (Garcia-Ovejero et al., 2014). The precise mechanism of progesterone remyelinating effects is actually open to debate. Despite the fact that several reports have shown PR involvement (El-Etr et al., 2015; Hussain et al., 2011; Labombarda et al., 2015), it is currently unknown whether progesterone stimulates OPC differentiation directly and/or indirectly by the regulation of astrocytes and microglial cells. On this subject, PR has been detected not only in the oligodendrocyte linage but also in neurons and astrocytes (Brinton et al., 2008; Schumacher et al., 2014). In particular, PR expression is observed in motoneurons and glial cells of spinal cord (Labombarda et al., 2000). Adult OPC differentiation is strongly modulated by astroglial and microglial cells in several pathological situations (Hiremath et al., 1998; Kotter et al., 2001). Indeed, our laboratory has recently shown that progesterone down-regulates pro-inflammatory cytokine expression and decreases astroglial and microglial activation by a PR-dependent mechanism (Labombarda et al., 2015). Interestingly, PR is not expressed in rodent microglial cells (Sierra et al., 2008) thus progesterone effects on microglial cells might be due to astrocyte and neuron modulation. Progesterone actions could be also mediated by extracellular factors that promote the differentiation program, such as TGFβ1. In the CNS TGFβ induces OPC cell cycle exit and accelerates CNS myelination (Palazuelos et al., 2014). In reproductive tissues, TGFβ1 is secreted by endometrial epithelial cells in response to progesterone during embryo implantation (Kim et al., 2005). Furthermore, the presence of the progesterone response element in the TGFβ1 promoter (AliBaba 2.1 analysis, Sequence accession number: NM011577) points to this factor as a good candidate to mediate progesterone effects on remyelination. In the present study, we aimed to (1) identify which step fails in the differentiation program after SCI and how this process is modified by a differentiation factor such as progesterone. (2) determine whether TGFβ1 could mediate progesterone remyelinating actions after SCI. Understanding the role of progesterone in oligodendrogenesis and CNS myelination is an important step to design strategies for myelin repair in SCI and demyelinating diseases.

McTigue and Tripathi, 2008; Rabchevsky et al., 2007; Siegenthaler et al., 2007). However, a recent report using genetic fate mapping has demonstrated that spontaneous myelin repair after SCI by endogenous OPC could be more robust than previously recognized (Assinck et al., 2017). Several lines of evidence, both experimental and clinical in other demyelinating diseases such as multiple sclerosis, suggest that the lack of differentiation represents a major cause of remyelination failure (Chang et al., 2002; Kuhlmann et al., 2008). Therefore, enhancement of endogenous remyelination becomes the target of future therapies. The differentiation program of OPC is a very complex process which involves the finely-tuned interplay of transcription factors and epigenetic modifiers (Huang et al., 2013; Mitew et al., 2014). Briefly, OPC differentiation is characterized by the progressive decrease of transcriptional inhibitors (Id2, Id4, Hes5, sox6, sox5), followed by the upregulation of activators (Olig1, Olig2, Nkx2.2, Sox10, Mash1, MRF) and finally myelin gene expression (Liu and Casaccia, 2010). Both events should be perfectly synchronized since transcriptional inhibitor downregulation offers a window of opportunity for transcriptional activators to increase and exert successful remyelination (Fancy et al., 2010). In this context, our goal was to understand which step fails in the differentiation program after SCI. For that purpose the key transcriptional activators and inhibitors of oligodendrocyte differentiation (Liu and Casaccia, 2010) were measured. Regarding activators, Olig2 is a key transcription factor involved in OL linage specification, greatly up-regulated during the differentiation program (Kitada and Rowitch, 2006; Mitew et al., 2014). The commitment into myelin-producing cells requires the up-regulation of Olig2 and Nkx2.2 (Cai et al., 2010; Watanabe et al., 2002) while terminal differentiation is regulated by Sox10 which induces the expression of MBP and MRF (Emery et al., 2009; Hornig et al., 2013). Concerning inhibitors, Hes-5 arrests OPC differentiation by repressing Sox10 and Mash1 expression (Liu et al., 2006). In fact, blocking Hes5signaling increases the maturation and differentiation of OPC into adult OL (Jurynczyk et al., 2008). Both Id2 and Id4 are key players in the inhibition of OL differentiation (Cheng et al., 2007; Samanta and Kessler, 2004) tethering Olig 2 and Olig1 by protein-protein interactions (Samanta and Kessler, 2004). It is worth mentioning that the differentiation program is regulated by extracellular factors that promote or inhibit oligodendrogenesis modifying the main transcription factors that mediate their effects (Huang et al., 2013; Mitew et al., 2014; Fancy et al., 2010). Nowadays there is no efficient therapy to enhance the capacity for endogenous remyelination either for SCI or for other demyelinating diseases such as multiple sclerosis (MS). In this respect, progesterone represents a good candidate for this challenge because the steroid has pro-myelinating and anti-inflammatory effects both in the PNS and CNS (Ciriza et al., 2004; De Nicola et al., 2018). Indeed, progesterone stimulates the recruitment and maturation of OPC in cerebellar organotypic cultures after lysolecithin-induced demyelination (Hussain et al., 2011). Several groups have reported that progesterone stimulates the synthesis of myelin proteins and decreases the inflammatory reaction in the experimental autoimmune encephalomyelitis (EAE) model of MS and in toxin-induced demyelination models (Aryanpour et al., 2017; ElEtr et al., 2015; Garay et al., 2011). In line with this evidence, our previous studies have demonstrated that progesterone promotes remyelination in spinal cord injured rats (Labombarda et al., 2009, 2015). In particular the steroid differentiates OPC, which proliferate 3 days post lesion, into mature OL producing myelin proteins as MBP and PLP (Labombarda et al., 2009). Progesterone also increases OPC survival preventing apoptosis by a progesterone receptor (PR)-dependent mechanism 48 h after SCI (Labombarda et al., 2015). Regarding neuroinflammation, progesterone decreases the activation and proliferation of astrocytes and microglial cells in both the acute and chronic phases after lesion (Labombarda et al., 2011, 2015). Concerning the acute phase, progesterone down-regulates the mayor proinflammatory cytokines (IL1β1, IL6 and TNFα) and enzymes

2. Results 2.1. The differentiation program of OL after SCI We first analyzed the time course expression of transcriptional inhibitors of OPC differentiation (Hes-5, Id2, Id4) to disclose early and late changes following SCI. As shown in Fig. 1 the mRNA expression of the three inhibitors decreased 1 and 3 dpl (ANOVA: F(3,28) = 18.66, p = 0.002 for Hes-5; F(3,28) = 16.64, p < 0.001 for Id2 and F(3,28) = 6.56, p = 0.0061 for Id4). However, Hes-5 and Id2 mRNAs were up-regulated at 21 dpl, reaching the mRNA levels of sham rats in the case of Hes-5 (p > 0.05 ns SCI 21 dpl vs sham rats, Newman Keuls post-test, Fig. 1A) and overcoming this value in the case of Id2 (p < 0.001 SCI 21 dpl vs sham values, Newman Keuls post-test, Fig. 1B). Id4 mRNA remained repressed throughout the studied time (p < 0.05 or p < 0.001 SCI vs sham rats, Fig. 1C). Employing an identical time scale, we found that the expression of transcriptional activators (Olig1, Olig2, Nkx2.2, Mash 1 and Sox10) was significantly reduced at all time periods following SCI (ANOVA: F(3,28) = 48.57, p < 0.0001 for Olig 2 Fig. 1D; F(3,28) = 10.76, p = 0.0002 for Olig 1 Fig. 1E; F(3,28) = 13.22, p = 0.0002 for Nkx2.2 Fig. 1F; F(3,28) = 10.04, p = 0.0023 for Mash1 Fig. 1G and F(3,28) = 8.166, p = 0.0026 for Sox10 Fig. 1H). The only exception of this down-regulation was Mash 1 mRNA expression which reached sham values 21 dpl (p > 0.05 ns SCI 21 dpl vs sham rats, Newman Keuls post-test Fig. 1G). 37

Brain Research 1708 (2019) 36–46

I. Jure et al.

Fig. 1. Time course gene expression of oligodendrocyte differentiation inhibitors, Hes-5 (A), Id2 (B) Id4 (C) and activators, Olig2 (D), Olig1 (E), Nkx2.2 (F), Mash1 (G) and Sox10 (H) after spinal cord injury (SCI). White bars represent sham operated rats and black bars spinal cord injured rats at 1, 3 and 21 days post lesion (dpl). Regarding inhibitors, SCI decreased the mRNA levels from 1 to 3 dpl (A–C). Hes-5 and Id2 mRNA increased 21 dpl (A, B) while Id4 mRNA remained down-regulated (C). On the other hand, SCI also decreased the mRNA expression of all transcriptional activators throughout the studied time (D–H). The only exception of this downregulation was Mash 1 mRNA expression which reached sham values 21 dpl (G). After SCI not only transcriptional inhibitors but also activators were down-regulated explaining the differentiation failure of oligodendrocytes precursor cells. Data represent the mean ± SEM for n = 8 animals per group. ANOVA followed by Newman Keuls post-test *p < 0.05 vs sham, **p < 0.01 vs sham, ***p < 0.001 vs sham.

These findings suggested that SCI had dual effects on OPC differentiation, by decreasing both inhibitory and activating factors responsible for OPC differentiation. We next studied if the response to injury could be modified by a differentiation factor such as progesterone. A previous study has shown that progesterone enhances the number of OPC which differentiate into mature OL after 21 dpl (Labombarda et al., 2009). Because OPC differentiation requires at least 3 weeks (Horky et al., 2006), we assumed that progesterone differentiating effects occur in the acute phase post SCI. Therefore, we determined the mRNA expression of transcriptional inhibitors and activators at 3 dpl in spinal cord injured rats with and without progesterone treatment. We found that gene expression of transcriptional inhibitors was not modified by progesterone (Table2). Inhibitor mRNA levels were lower than the values obtained in sham-operated rats and remained similar to those obtained by the lesioned group receiving vehicle (ANOVA: F(2,21) = 5.57, p = 0.021, Newman Keuls post-hoc analysis p > 0.05 ns SCI + Pg vs SCI for Hes-5; F(2,21) = 21.34, p < 0.0001, Newman Keuls post-hoc analysis p > 0.05 ns SCI + Pg vs SCI for Id2 and F(2,21) = 6.77, p = 0.016, Newman Keuls post-hoc analysis p > 0.05 ns

SCI + Pg vs SCI for Id4, Table 2). Instead, progesterone enhanced transcriptional levels of Olig2, Nkx2.2, Mash 1 and Sox10 mRNAs 3 dpl (ANOVA: F(2,21) = 54.69, p < 0.0001 for Olig2 Fig. 2A; F(2,21) = 20, p < 0.0013 for Nkx2.2 Fig. 2B; F(2,21) = 27.11, p = 0.0021 for Mash 1 Fig. 2C and F(2,21) = 32.84, p = 0.0001 for Sox 10 Fig. 2D). In particular, progesterone treatment increased Nkx2.2 and Sox10 mRNA levels above the values obtained in sham rats (p < 0.05 SCI + Pg vs sham rats, Newman Keuls post-test, for Nkx2.2 Fig. 2B and p < 0.001 SCI + Pg vs sham rats, Newman Keuls post-test, for Sox 10 Fig. 2D). In agreement with gene expression data, progesterone increased the number of OPC which expressed Olig2 protein (PDGFRα+/Olig2+ cells) (ANOVA: F(2,21) = 227, p = 0.0004, Fig. 3A). The number of Olig2-expressing OPC was higher in progesterone treated injured rats than in both injured and sham-operated rats (p < 0.01 SCI + Pg vs SCI and sham, Newman Keuls post-test Fig. 3A). Olig2 is a key transcription factor involved in OL linage specification, greatly upregulated during differentiation and persisting in mature OL (Mitew et al., 2014; Kitada and Rowitch, 2006). We have also found, in agreement with previous reports (Levine et al., 2001), that SCI increased OPC density compared to sham-operated rats (ANOVA: 38

Brain Research 1708 (2019) 36–46

I. Jure et al.

Table 1 Primer sequences, working concentration and validation of Real Time RT-PCR. Gene

Sequence

Efficiency

r2

WC

Gene Data

Id 2

F: CATTTCACCAGGAGAACAAGTTGAA R: TGATCACTCTTAGTTTTCCTTCCGT F: TGCCTGCAGTGCGATATGA R: TTGTTGGGCGGGATGGT F: TCCAGAGCTCCAGGCATGG R: CCGCAGTCGATTTTTCTCCTT F: TGGAGGTTGCTGAACGAGAGT R: CGCCGAGGTTGGTACTTGTAG F: GATCCTGTGTCTTCAGTGTTTCTTG R: GGTGTCTGGTTTGTTTGTTTCTTTT F: GCCCAGGCCACGAGTACAAA R: TCCACTCCGAAACCCAACGA F: GAAATGGAATAATCCCGAACTACT R: CCCCTCCCAAATAACTCAAAC F: CGGGCTGAGAAAGGTATGGA R: TGTGCTGTCGGGTACTGGG F: GTGGCAAGATCGAAGTGGAGA R: TAAAAATCAGGCCTGTGGAAT F: AGATTCAAGTCAAGTCAACTGTGGAG R: AAGCCCTGTATTCCGTCTC

1.92

0.994

400 nM

2.09

0.997

600 nM

2.07

0.993

200 nM

1.96

0.995

600 nM

1.96

0.997

400 nM

1.95

0.993

600 nM

1.92

0.992

400 nM

2.03

0.999

600 nM

2.05

0.996

400 nM

2.10

0.997

400 nM

NM_013060.3 GI: 148539949 NM_175582.1 GI: 28212235 NM_024383.1 GI: 13242286 AJ001029.1 GI: 2695880 NM_022384.1 GI: 11693147 NM_021770.3 GI: 237757335 NM_001100557.1 GI: 281371418 NM_001077632.1 GI: 117647244 M19533.1 GI: 203701 NM_021578.2 GI: 59086

Id 4 Hes 5 Sox 10 Mash 1 Olig 1 Olig 2 Nkx 2.2 Cyc B TGF β1

F: forward, R: reverse, r2: correlation coefficient, WC: working concentration. Efficiency is defined by Ex = 10−1/slope.

Labombarda et al., 2011, 2015) which are involved in OPC differentiation under pathological conditions (Hiremath et al., 1998; Kotter et al., 2011). Therefore, we determined progesterone effects on TGFβ1 protein expression in microglial and astrocytes at 3dpl. As expected, SCI induced a significant OX-42+ microgliosis (ANOVA: F(2,21) = 37.37, p < 0.0001, p < 0.001 SCI vs sham, Newman Keuls post-analysis, Fig. 4C), which subsided after progesterone treatment (p < 0.001 SCI + Pg vs SCI, Newman Keuls postanalysis, Fig. 4C). As we published before (Labombarda et al., 2011, 2015), the density of Ox-42+ cells in progesterone receiving rats was higher than the number obtained in sham-operated rats (p < 0.001 SCI + Pg vs Sham, Newman Keuls post-analysis, Fig. 4C). Interestingly, the number of TGFβ1+/OX-42+ double-labeled cells increased in spinal cord injured rats receiving progesterone, compared to sham-operated and spinal cord injured rats (ANOVA: F(2,21) = 4.68, p = 0.012, p < 0.05 SCI + Pg vs SCI and sham, Newman Keuls post-analysis, Fig. 4B). Instead, the number of double-labeled cells in the spinal cord injured group remained unchanged vs. the sham- operated group (p > 0.05 SCI vs Sham, Newman Keuls post-analysis, Fig. 4B). Concerning astrocytes, SCI increased the number of GFAP+ cells and progesterone treatment decreased astrocyte density with regard to the injured group (ANOVA: F(2,21) = 12.02, p = 0.0003, p < 0.001 SCI vs sham and SCI + Pg, p < 0.05 SCI + Pg vs SCI, Newman Keuls postanalysis, Fig. 4E), in agreement with previous results (Labombarda et al., 2011, 2015). Consistent with progesterone effects on microglial cells, the steroid maintained astrocyte number above the value reached in sham-operated rats (p < 0.05 SCI + Pg vs Sham Newman Keuls post-analysis, Fig. 4E). Noticeably, TGFβ1− expressing astrocytes (TGFβ1+/GFAP+ cells) were up-regulated with progesterone treatment, reaching higher values than those obtained in sham-operated and injured rats (ANOVA: F(2,21) = 7.16 p = 0.0042, p < 0.05 SCI + Pg vs sham and SCI, Newman Keuls post-analysis, Fig. 4D). Similarly to microglial cells, the number of double-labeled cells in the spinal cord injured group remained unchanged vs. the sham-operated group (p > 0.05 SCI vs Sham, Newman Keuls post-analysis, Fig. 4E). Confocal microscopy from white matter tracts supporting these findings are shown in Figs. 5 and 6. Fig. 5 shows progesterone effects on microglial cells which expressed TGFβ1. After SCI an increased number of Ox-42+ cells was found (Fig. 5B vs A). Notably, most microglial cells in injured rats lacked TGFβ1 expression (Fig. 5B, E, H, arrows: Ox-42+, TGFβ1− cells). On the other hand, progesterone treatment downregulated Ox-42 total density (Fig. 5C vs B) but increased the number of

Table 2 Progesterone (Pg) effects on mRNA expression of transcriptional inhibitors. Results are expressed as fold change of mRNA levels respect to sham operated rats. Gene Hes-5 Id2 Id4

Sham 1.01 ± 0.16 0.99 ± 0.040 1.02 ± 0.049

SCI

SCI + Pg *

0.33 ± 0.083 0.49 ± 0.082*** 0.41 ± 0.11*

0.34 ± 0.13* 0.54 ± 0.10*** 0.50 ± 0.15*

Group labelling: Sham (sham-operated rats), SCI (spinal cord injured animals) and SCI + Pg (spinal cord injured rats treated with Pg). ANOVA followed by Newman Keuls post-test: *p < 0.05 vs Sham, ***p < 0.001 vs Sham.

F(2,21) = 106, p = 0.0016, p < 0.01 SCI vs sham Newman Keuls postanalysis, Fig. 3B). In addition, progesterone treatment of spinal cord injured rats further increased the number of PDGFRα+ cells (p < 0.01 SCI + Pg vs SCI and sham, Newman Keuls post-analysis, Fig. 3B). The photomicrographs of Fig. 3 show the results of the immunohistochemistry for PDGFRα and Olig2. Three days after injury more OPC (PDGFRα+ cells) could be seen than those observed in sham-operated rats, however these OPC were Olig2 negative (D, arrowheads). An increase in the number of Olig2-producing OPC (PDGFRα+/Olig2+) was found in progesterone treated spinal cord injured rats (E, arrows).

2.2. TGFβ1 as a possible mediator of progesterone differentiating effects in SCI TGFβ1 was studied in two different experiments. First, we have explored changes of mRNA expression in spinal cord injured rats treated and untreated with progesterone. Second, we have investigated the cell type(s) involved in TGFβ1 protein expression. As shown in Fig. 4A, there was a significant up-regulation of TGFβ1 mRNA in spinal cord injured rats receiving progesterone compared to both sham operated and vehicle-treated injured rats at 3 dpl (ANOVA: F(2,21) = 48.13, p < 0.0001, p < 0.001 SCI + Pg vs SCI and sham Newman Keuls post-analysis, Fig. 4A). However, SCI did not modify the values shown in sham operated rats (p > 0.05 SCI vs Sham, Newman Keuls postanalysis Fig. 4A). Regarding the cell type responsible for these effects, microglia and astrocytes were studied because progesterone reduces neuroinflammation and the reactivity of both types of cells (Garay et al., 2012; 39

Brain Research 1708 (2019) 36–46

I. Jure et al.

Fig. 2. Progesterone (Pg) effects on mRNA expression of transcriptional activators of oligondendrocyte differentiation after spinal cord injury. Pg-treated spinal cord injured rats (SCI + Pg) increased mRNA expression of Olig 2 (A), Nkx2.2 (B), Mash1 (C) and Sox 10 (D) 3 days post lesion with regard to spinal cord injured rats (SCI). Nkx2.2 (B) and Sox 10 (D) mRNA levels of SCI + Pg rats overcame the values reached by sham-operated rats (sham). Data represent the mean ± SEM for n = 8 animals per group. ANOVA followed by Newman Keuls post-test *p < 0.05 vs sham, **p < 0.01 vs sham, ***p < 0.001 vs sham, +p < 0.05 vs SCI ++ p < 0.01 vs SCI, +++p < 0.001 vs SCI, &p < 0.05 vs sham, &&p < 0.001 vs sham.

10 and Mash 1 3 dpl. We have previously demonstrated that progesterone increases Olig2 and Nkx2.2 mRNA after SCI (Labombarda et al., 2009). The present work expanded this effect and showed that progesterone enhanced not only Olig2 and Nkx2.2 expression but also mRNA expression of the other key transcriptional activators Sox10 and Mash1. These activators exert specific functions during differentiation. It is known that Olig2 is a key transcription factor involved in OL linage specification and differentiation which is up-regulated during the differentiation program (Mitew et al., 2014; Kitada and Rowitch, 2006; Wang et al., 2006). Furthermore, OPC differentiation and commitment into myelin-producing cells require up-regulation and co-expression of Olig2 and Nkx2.2 (Cai et al., 2010; Fancy et al., 2004; Watanabe et al., 2002). In turn, Mash 1 induces Nkx2.2 expression and collaborates with Olig2 to promote spinal cord OPC differentiation (Sugimori et al., 2008). Finally, Sox10 stimulates the transformation of premyelinizating OL into myelinizating cells by inducing the expression of MBP and MRF, the latter being involved in internodes and myelin formation (Emery et al., 2009; Hornig et al., 2013). According to several reports, we have described that SCI stimulated OPC density (Levine et al., 2001) whereas progesterone treatment further increased the number of these precursors (Garay et al., 2011; Labombarda et al., 2009, 2006a). More recently, we have found that progesterone stimulation of OPC survival and prevention of apoptosis requires a PR-dependent mechanism (Labombarda et al., 2015). Since OPC cell number increased in both groups of lesioned rats (progesterone-treated and not treated) but activator mRNA levels only increased with steroid treatment, changes in mRNA levels were probably

TGFβ1-expressing cells (Fig. 5C, F, I, arrowheads: Ox-42+, TGFβ1+ cells). Fig. 6 shows progesterone effects on TGFβ1-producing astrocytes. In agreement with the results on microglial cells, SCI increased the number of GFAP+ cells (Fig. 6B vs A). Interestingly, most astrocytes in injured rats lacked TGFβ1 expression (Fig. 6B, E, H, arrows: GFAP+, TGFβ1− cells). Similarly to microglial cells, progesterone treatment down-regulated the total density of GFAP positive cells (Fig. 6C vs B) but increased the number of TGFβ1-expressing astrocytes (Fig. 6 C, F, I, arrowheads: GFAP+, TGFβ1+ cells). 3. Discussion The extent of endogenous remyelination in the demyelinated CNS is limited and OCP differentiation into mature myelinating OL is a crucial step of the process. As mentioned, the differentiation program requires not only the progressive decrease of transcriptional inhibitors but also the subsequent surge of transcriptional activators (Huang et al., 2013; Fancy et al., 2010; Mitew et al., 2014). In the present study we have demonstrated that transcriptional inhibitors which block the differentiation program were down regulated during a discrete temporal window after SCI (i.e., 24 h to 21 dpl). Unfortunately, transcriptional activators were down-regulated during this period. Therefore, OPC missed the opportunity window to differentiate. This result suggests that factors promoting a successful differentiation should increase transcriptional activators and synchronize this up-regulation with a decrease of the inhibitors. Progesterone acting as a differentiated factor enhanced the expression of Olig2, Nkx2.2, Sox 40

Brain Research 1708 (2019) 36–46

I. Jure et al.

Fig. 3. Progesterone (Pg) effects on oligodendrocyte precursor cells (OPC) 3 days after spinal cord injury. OPC were identified as PDGFRα+ cells. Group labelling: Sham (sham-operated rats), SCI (spinal cord injured animals) and SCI + Pg (spinal cord injured rats treated with Pg). Number of double positive cells (PDGFRα+/ Olig2+) (A) Total number of PDGFRα positive cells (B). Pg enhanced the number of Olig-2 expressing OPC (double positive cells). Results represent the number of immunopositive cells per 50000 µm2 (mean ± S.E.M, n = 8 per group). ANOVA followed by Newman Keuls post-test **p < 0.01 vs Sham, ++p < 0.01 vs SCI, && p < 0.01 vs Sham. Immunohistochemistry with Olig2 and PDGFRα antibodies (C–E). Images from white matter of sham (C), SCI (D) and SCI + Pg (E) animals. SCI + Pg rats showed more Olig2-expressing cells (double stained cells, Arrows) while in SCI animals more OPC without Olig2 labelling were detected (PDGFRα+/ Olig2− cells, arrowheads). Scale bar: 20 µm.

the receptive endometrium (Maurya et al., 2013). Although further experiments should be performed to demonstrate TGFβ1 extracellular activation after progesterone treatment, the mentioned reports support the fact that in the CNS, progesterone-induced TGFβ1 could mediate OL differentiation after SCI. There is experimental evidence showing that progesterone remyelinating and anti-inflammatory effects are mediated by PR. In this regard, we have already demonstrated that progesterone-down-regulation of cytokines and the decrease of astrocytes and microglial activation are lost in PR knock out mice after SCI (Labombarda et al., 2015). Along this line, it has been shown that progesterone effects on protein myelin expression and OPC differentiation are also missing in PR knock out mice after toxin-induced demyelination (El-Etr et al., 2015; Hussain et al., 2011). It is worth mentioning that PR levels play an important role in neuroprotection as PR expression increases after brain isquemia (Allen et al., 2016). Despite the fact that PR requirement is clear, currently it is unknown whether progesterone stimulates OPC differentiation directly acting on these cells or indirectly creating an anti-inflammatory and pro-differentiating environment by microglial and astrocyte regulation. Concerning the indirect mechanism, progesterone increased the number of TGFβ1− expressing astrocytes and microglial cells in spinal cord injured rats with regard to injured untreated rats. Published work has already shown that progesterone decreases the total number of astrocytes, microglial cells and pro-inflammatory mediators in the injured spinal cord (Labombarda et al., 2015) and in spinal cord demyelinating models as well (El-Etr et al., 2015; Garay et al., 2012) It is known that astrocyte-derived TGFβ1 mediates the neuroprotective effects of estradiol (Dhandapani et al., 2005). In the same way PR-positive astrocytes (Brinton et al., 2008; Schumacher et al., 2014) could mediate progesterone effects on OL linage by releasing TGFβ1 and creating a pro-differentiating environment. Progesterone also

due to transcriptional effects and not related to changes in OPC cell number. In this study, progesterone not only enhanced the OPC number but also increased the number of OPC which expressed Olig2. In this way, the steroid may increase the number of cells committed to OL after SCI. In search for extracellular factors that promote or inhibit the differentiation program, we hypothesize that TGFβ1 could be a likely candidate. TGFβ1 signaling is activated during the transition from OPC to myelinating OL and recent evidence has shown that TGFβ1 induces OPC cell cycle exit and accelerates brain myelination (Palazuelos et al., 2014). During spinal cord development TGFβ ligands and activin B together support oligodendrocyte development and myelin formation (Dutta et al., 2014). Studies in vitro have shown that O-2A progenitor cells express TGFβ1 and that TGFβ signaling activation exerts an antimitogenic effect countering PDGFRα signaling, which promotes cell cycle arrest and O-2A differentiation (McKinnon et al., 1993). TGFβ signaling during OL differentiation in vivo not only up-regulates the anti-mitotic genes p15, p21 and p27 (Misumi et al., 2008), but also the pro-oligodendrogenic genes Olig1 and Olig2 (Palazuelos et al., 2014). Furthermore, TGFβ1 exerts essential functions in the control of OPC cell cycle exit and OL differentiation by modulating c-myc and p21 expression through the cooperation of SMAD3/4 with FoxO1 and Sp1 (Palazuelos et al., 2014). Several lines of evidence support TGFβ1 as a possible mediator of progesterone actions: (a) TGFβ1 mRNA levels were up-regulated by progesterone; (b) the TGFβ1 promoter presents a progesterone receptor response element; and (c) progesterone remyelinating effects involve a PR-dependent mechanism (El-Etr et al., 2015; Hussain et al., 2011; Labombarda et al., 2015). It is well established that TGFβ1 acquires biological activity after release from its latent or inactive complex (Annes et al., 2003). In reproductive tissues the sex steroids progesterone and estradiol release the active form from its latent complex in 41

Brain Research 1708 (2019) 36–46

I. Jure et al.

Fig. 4. Progesterone (Pg) effects on TGFβ1 expression. TGFβ1 mRNA levels 3 day post-injury (A). Pg up-regulated TGFβ1 transcription in treated spinal cord injured rats (SCI + Pg) compare to both injured (SCI) and sham-operated rats (Sham). Number of TGFβ1+/Ox-42+ cells (B). Total number of GFAP positive cells (C). Number of TGFβ1+/GFAP+ cells) (D). Total number of GFAP positive cells (D). SCI increased the total number of astrocytes and microglial cells. Although Pg decreased the total number of microglial cells and astrocytes, the steroid increased the number of TGFβ1-expressing astrocytes and microglia (double positive cells). Results represent the number of immunopositive cells per 50,000 µm2 (mean ± S.E.M, n = 8 per group). ANOVA followed by Newman Keuls post-test: +p < 0.05 vs SCI, &p < 0.05 vs Sham, ***p < 0.001 vs Sham, +++p < 0.001 vs SCI and &&&p < 0.001 vs Sham.

change of microglia phenotype caused by progesterone could create a pro-differentiating environment for OPC. In this regard, Palazuelos et al., have demonstrated that TGFβ receptor II (TGFβ-RII) is expressed in OPC and it is necessary for OPC to differentiate during myelination (Palazuelos et al., 2014). It is known that TGFβ1 controls OPC cell cycle exit, differentiation and myelination by modulating c-myc and p21 expression (Palazuelos et al., 2014). However the possibility that TGFβ1 signaling exerts a positive control of the transcriptional activators deserves further research.

modulates the phenotype of microglia, increasing the M2 anti-inflammatory and decreasing the M1 pro-inflammatory phenotype (Aryanpour et al., 2017). As already mentioned PR is absent in microglial cells (Sierra et al., 2008) therefore progesterone actions could be mediated by astrocytes and neurons. In fact progesterone attenuates microglial toxicity by stimulating the protective fractalkine-CX3CR1 signaling in neurons (Roche et al., 2016). Based on the fact that M2 microglial cells drive OPC differentiation (Miron and Franklin, 2014) and release TGFβ1 (David and Kroner, 2011; Hu et al., 2015) the 42

Brain Research 1708 (2019) 36–46

I. Jure et al.

Fig. 5. Representative confocal images taken from white matter showing progesterone (Pg) effects on TGFβ1-expressing microglial cells 3 days after spinal cord injury. Microglial cells were identified as OX-42+ cells. Group labelling: Sham (sham-operated rats A, D, G), SCI (spinal cord injured animals B, E, H) and SCI + Pg (spinal cord injured rats treated with Pg C, F, I). Pg treatment of lesioned rats decreased the number of total microglial cell but increased the number of microglial cells which expressed TGFβ1. Arrows indicate Ox-42+, TGFβ1− cells and arrowheads Ox-42+, TGFβ1+ cells. Scale bar: 10 µm.

Fig. 6. Representative confocal images taken from white matter showing progesterone (Pg) effects on TGFβ1-expressing astrocytes 3 days after spinal cord injury. Astrocytes were identified as GFAP positive cells. Group labelling: Sham (sham-operated rats A, D, G), SCI (spinal cord injured animals B, E, H) and SCI + Pg (spinal cord injured rats treated with Pg C, F, I). Pg treatment of lesioned rats decreased astrocyte total number but increased the number of TGFβ1-positive astrocytes. Arrows indicate GFAP+, TGFβ1− cells and arrowheads GFAP+, TGFβ1+ cells. Scale bar: 20 µm.

43

Brain Research 1708 (2019) 36–46

I. Jure et al.

their spinal cords transected at the thoracic level (T9) as described by Labombarda et al. (2009). After SCI, animals were housed singly. Urinary bladders were manually expressed twice a day, and infections were prevented by administration of cefalexine (20 mg/kg daily) starting immediately before surgery. In sham-operated animals (sham), laminectomy was performed but the spinal cord was not cut. Animals were sacrificed 1, 3 or 21 days post lesion (dpl). Progesterone effect was studied only in the animals that were scarified after 3 dpl because differentiating progesterone actions started at this time point (Labombarda et al., 2009). Thus, these rats received daily sc injections of vegetable oil as vehicle (SCI) or 16 mg/kg progesterone (SCI + Pg) (Proluton, Schering, Argentina) and were killed 3 dpl. The first progesterone injection was given immediately after injury. Sham rats treated with progesterone were not included because morphological, neurochemical and molecular evidence have confirmed the absence of progesterone effects in the intact spinal cord (Labombarda et al., 2002, 2006a). The dose of progesterone chosen prevents oedema, neuronal loss, and improves cognitive responses following brain contusion (Stein, 2008). In the damaged spinal cord, this progesterone dose reduces secondary damage, preserves white matter, improves locomotor outcome, promotes remyelination, and modulates glial cells involved in the inflammatory response (Garcia-Ovejero et al., 2014; Labombarda et al., 2009, 2011) The Animal procedures described for rats followed the NIH Guide for the Care and Use of Laboratory Animals (Assurance Certificate N A5072-01 to Instituto de Biología y Medicina Experimental) and received approval of the Institute's Animal Care Committee (number n° 36/2017–2020). Efforts were made to keep the number of lesioned animals to a minimum.

At this point, it is worth mentioning that progesterone per se also might up-regulate the transcriptional activators. Progesterone direct actions were also supported by some reports that describe PR expression in OL cultures (Jung-Testas et al., 1994) and the release of progesterone and its derivates during OPC development in vitro (Gago et al., 2001). The rapid metabolism of progesterone into 3α, 5α-tetrahydroprogesterone (Labombarda et al., 2006b), a metabolite showing promyelinating activity in the PNS and CNS (Ciriza et al., 2004; Djebaili et al., 2005; Ghoumari et al., 2003) opens up the multiplicity of actions of progesterone treatment. The present study has further explored progesterone differentiating mechanisms in OPC and proposed TGFβ1 as a possible mediator of progesterone actions during SCI. The present and previous published results support the fact that progesterone therapy acts on oligodendrocyte linage and regulates astrocytes and microglial cells suppressing neuroinflamation and creating a pro-differentiating environment which results in neurological recovery after SCI (Garcia-Ovejero et al., 2014; Labombarda et al., 2009, 2011, 2015). Indeed, using MRI and the CatWalk gait analysis we have demonstrated that progesterone treatment reduces secondary damage, increases oligodendrocyte number and improves locomotor outcome after SCI (Garcia-Ovejero et al., 2014). Besides the beneficial effects on remyelination, progesterone has neuroprotective effects on motoneurons. Progesterone treatment increases both BDNF and Chat expression and reduces neuronal chromatolysis, a main type of cell injury caused by oxidative stress and neuroinflammation (Gonzalez et al., 2004). Despite abundant experimental data support favorable progesterone effects in spinal cord injured rats, clinical translation lags behind information provided by rodent models. However, clinical trials in patients with traumatic brain injury indicate that progesterone treatment was not associated with an increase in breast cancer, thrombotic risk or feminization of patients (Skolnick et al., 2014; Wright et al., 2007; Xiao et al., 2008). Therefore, progesterone rises as a safe molecule that could be used for SCI treatment. On the other hand, the progesterone potent agonist Nestorone also exerts myelinating and anti-inflammatory actions in EAE and toxininduced demyelinating models (El-Etr et al., 2015; Hussain et al., 2011; Garay et al., 2014). Therefore, not only progesterone but also progestogens emerge as multi-functional drugs that recover the endogenous capacity of remyelination acting on the OL linage and regulating microglial cells.

5.2. Real Time PCR for semi-quantitative determination of mRNA expression of transcriptional inhibitors and activators after SCI One, 3 and 21 days after SCI, injured rats as well as sham animals (n = 8 animal per group), were deeply anaesthetized with chloral hydrate (800 mg/kg ip) and killed by decapitation. Spinal cord tissue localized immediately rostral to the lesion site, and equivalent regions form sham animals were removed and homogenized with a Polytron homogenizer. RNA was extracted and subjected to reverse transcription as previously described (Labombarda et al., 2009). Relative gene expression was determined using the Sep One plus Real Time PCR Applied BioSystem. Sequence of primers were designed using the web site ttp:// www.ncbi.nlm.nih.gov/tools/primer-blast. Primer sequences are listed in Table 1. Cyclofiline B (Cyc B) was chosen as the housekeeping gene based on the similarity of mRNA expression across all samples templates. Linearity and efficiency of PCR amplification were validated before quantification. Relative gene expression was calculated using the method described by Pfaffl (Pfaffl, 2001) and it was determined for each target gene as fold induction with respect to its respective control. For each amplification 2 ng cDNA/μl of reaction was used and PCR was performed in triplicate under optimised conditions: 95 °C at 10 min followed by 40 cycles at 95 °C for 0.15 s and 60 °C for 1 min.

4. Conclusion The present investigation suggests that the differentiation program of OPC into mature OL failed because transcriptional activators remained down-regulated after SCI. Interestingly, in the presence of a differentiating factor such as progesterone transcriptional activator levels, increased taking advantage of the opportunity window given by a simultaneous down-regulation of transcriptional inhibitors. The mechanism proposed for progesterone differentiating effects might involve TGFβ1, which could indirectly mediate these actions by the release of microglial and astrocytic TGFβ1. In the future, further experiments will be necessary to prove the participation of TGFβ1 in mediating progesterone effects. This report proposes progesterone as a multi-functional drug which could be used for the treatment of demyelinating diseases.

5.2.1. Tissue preparation and immunohistochemistry Sham, SCI and SCI + Pg (n = 8 rat per group) were sacrificed 3 days following surgery or sham-operation. Rats were deeply anesthetized as specified above and intracardially perfused with 0.9% NaCl, followed by ice-cold 4% paraformaldehyde (PFA). Tissue blocks of 3 mm immediately rostral to the lesion site and equivalent regions from Sham rats were embedded in optimum cutting temperature compound (Tissue Tek, Miles Lab, Elkhart, IL, USA), post-fixed in the same fixative, rinsed in 20% sucrose, frozen on dry ice, cut into 30-µm thick serial coronal sections on a cryostat, and sequentially collected on slides. Immunostaining of OPC, astrocytes and microglial cell was performed according to previously published protocols (Labombarda et al., 2009, 2011, 2006a). Commercial antibodies were used so the specificity

5. Experimental procedure 5.1. Progesterone treatment and spinal cord transection Male Sprague-Dawley rats (250–300 g) were anesthetized with a mixture of ketamine (80 mg/kg, i.p.) and xylazine (10 mg/kg, i.p.) and 44

Brain Research 1708 (2019) 36–46

I. Jure et al.

Technology (PICT 2012-0009), the National Research Council of Argentina (PIP 112 20120100016), the University of Buenos Aires (Ubacyt 20020100100089). These funding sources did not have a role either in the collection, analysis, and interpretation of data or in the writing of the report and in the decision to submit the paper for publication.

is guaranteed by the manufacturer and previous reports where they were utilized. We have employed the following primary antibodies: against Ox-42 for microglia (1:100 mouse-monolconal antibody, Chemicon catalogue number: CBL1512), GFAP for astrocytes (1:1000 mouse-monoclonal antibody, Santa Cruz catalogue number: Sc33673) and PDGFRα (1:250 goat-policlonal antibody, Neuromix catalogue number: GT15150) for OPC. For double labelling TGFβ1 (1:100, rabbitpoliclonal, Santa Cruz catalogue number: Sc146) and Olig2 (1:1000 rabbit-policlonal, Neuromix catalogue number: RA25081) antibodies were used. Incubations with the primary antibodies were rinsed three times in TBS 0.1% Triton X-100 for 15 min before application of the secondary antibodies: goat anti-rabbit IgG conjugated to Alexa 488 (1:1000, Molecular probes catalogue number: A11008), donkey antigoat IgG conjugated to Alexa 555 (1:1000, Molecular probes catalogue number: A21432) and goat anti-mouse IgG conjugated to Alexa 555 (1:1000, Molecular probes catalogue number: A21422). Incubation with secondary antibodies was followed by three rinses in TBS. Sections were mounted with Fluoromont G and kept in the dark at 4 °C until analysis by confocal microscopy. Control experiments were performed in parallel and involved the incubation of tissue without primary antibodies in order to rule out non-specific staining. Samples from the different experimental groups were run at the same time to prevent interexperimental bias.

References Allen, R.S., Sayeed, I., Oumarbaeva, Y., Morrison, K.C., Choi, P.H., Pardue, M.T., Stein, D.G., 2016. Progesterone treatment shows greater protection in brain vs. retina in a rat model of middle cerebral artery occlusion: progesterone receptor levels may play an important role. Restor. Neurol. Neurosci. 34, 947–963. Annes, J.P., Munger, J.S., Rifkin, D.B., 2003. Making sense of latent TGFbeta activation. J. Cell Sci. 116, 217–224. Aryanpour, R., Pasbakhsh, P., Zibara, K., Namjoo, Z., Beigi Boroujeni, F., Shahbeigi, S., Kashani, I.R., Beyer, C., Zendehdel, A., 2017. Progesterone therapy induces an M1 to M2 switch in microglia phenotype and suppresses NLRP3 inflammasome in a cuprizone-induced demyelination mouse model. Int. Immunopharmacol. 51, 131–139. Assinck, P., Duncan, G.J., Plemel, J.R., Lee, M.J., Stratton, J.A., Manesh, S.B., Liu, J., Ramer, L.M., Kang, S.H., Bergles, D.E., Biernaskie, J., Tetzlaff, W., 2017. Myelinogenic plasticity of oligodendrocyte precursor cells following spinal cord contusion injury. J. Neurosci. 37, 8635–8654. Brinton, R.D., Thompson, R.F., Foy, M.R., Baudry, M., Wang, J., Finch, C.E., Morgan, T.E., Pike, C.J., Mack, W.J., Stanczyk, F.Z., Nilsen, J., 2008. Progesterone receptors: form and function in brain. Front. Neuroendocrinol. 29, 313–339. Cai, J., Zhu, Q., Zheng, K., Li, H., Qi, Y., Cao, Q., Qiu, M., 2010. Co-localization of Nkx6.2 and Nkx2.2 homeodomain proteins in differentiated myelinating oligodendrocytes. Glia 58, 458–468. Ciriza, I., Azcoitia, I., Garcia-Segura, L.M., 2004. Reduced progesterone metabolites protect rat hippocampal neurones from kainic acid excitotoxicity in vivo. J. Neuroendocrinol. 16, 58–63. Chang, A., Tourtellotte, W.W., Rudick, R., Trapp, B.D., 2002. Premyelinating oligodendrocytes in chronic lesions of multiple sclerosis. N. Engl. J. Med. 346, 165–173. Cheng, X., Wang, Y., He, Q., Qiu, M., Whittemore, S.R., Cao, Q., 2007. Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells. Stem Cells 25, 3204–3214. David, S., Kroner, A., 2011. Repertoire of microglial and macrophage responses after spinal cord injury. Nat. Rev. Neurosci. 12, 388–399. De Nicola, A.F., Garay, L.I., Meyer, M., Guennoun, R., Sitruk-Ware, R., Schumacher, M., Gonzalez Deniselle, M.C., 2018. Neurosteroidogenesis and progesterone anti-inflammatory/neuroprotective effects. J. Neuroendocrinol. 30. Dhandapani, K.M., Wade, F.M., Mahesh, V.B., Brann, D.W., 2005. Astrocyte-derived transforming growth factor-{beta} mediates the neuroprotective effects of 17{beta}estradiol: involvement of nonclassical genomic signaling pathways. Endocrinology 146, 2749–2759. Djebaili, M., Guo, Q., Pettus, E.H., Hoffman, S.W., Stein, D.G., 2005. The neurosteroids progesterone and allopregnanolone reduce cell death, gliosis, and functional deficits after traumatic brain injury in rats. J. Neurotrauma 22, 106–118. Dutta, D.J., Zameer, A., Mariani, J.N., Zhang, J., Asp, L., Huynh, J., Mahase, S., Laitman, B.M., Argaw, A.T., Mitiku, N., Urbanski, M., Melendez-Vasquez, C.V., Casaccia, P., Hayot, F., Bottinger, E.P., Brown, C.W., John, G.R., 2014. Combinatorial actions of Tgfbeta and Activin ligands promote oligodendrocyte development and CNS myelination. Development 141, 2414–2428. El-Etr, M., Rame, M., Boucher, C., Ghoumari, A.M., Kumar, N., Liere, P., Pianos, A., Schumacher, M., Sitruk-Ware, R., 2015. Progesterone and nestorone promote myelin regeneration in chronic demyelinating lesions of corpus callosum and cerebral cortex. Glia 63, 104–117. Emery, B., Agalliu, D., Cahoy, J.D., Watkins, T.A., Dugas, J.C., Mulinyawe, S.B., Ibrahim, A., Ligon, K.L., Rowitch, D.H., Barres, B.A., 2009. Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination. Cell 138, 172–185. Fancy, S.P., Zhao, C., Franklin, R.J., 2004. Increased expression of Nkx2.2 and Olig2 identifies reactive oligodendrocyte progenitor cells responding to demyelination in the adult CNS. Mol. Cell. Neurosci. 27, 247–254. Fancy, S.P., Kotter, M.R., Harrington, E.P., Huang, J.K., Zhao, C., Rowitch, D.H., Franklin, R.J., 2010. Overcoming remyelination failure in multiple sclerosis and other myelin disorders. Exp. Neurol. 225, 18–23. Gago, N., Akwa, Y., Sananes, N., Guennoun, R., Baulieu, E.E., El-Etr, M., Schumacher, M., 2001. Progesterone and the oligodendroglial lineage: stage-dependent biosynthesis and metabolism. Glia 36, 295–308. Garay, L., Tungler, V., Deniselle, M.C., Lima, A., Roig, P., De Nicola, A.F., 2011. Progesterone attenuates demyelination and microglial reaction in the lysolecithininjured spinal cord. Neuroscience 192, 588–597. Garay, L., Gonzalez Deniselle, M.C., Sitruk-Ware, R., Guennoun, R., Schumacher, M., De Nicola, A.F., 2014. Efficacy of the selective progesterone receptor agonist nestorone for chronic experimental autoimmune encephalomyelitis. J. Neuroimmunol. 276, 89–97. Garay, L.I., Gonzalez Deniselle, M.C., Brocca, M.E., Lima, A., Roig, P., De Nicola, A.F., 2012. Progesterone down-regulates spinal cord inflammatory mediators and increases myelination in experimental autoimmune encephalomyelitis. Neuroscience 226, 40–50. Garcia-Ovejero, D., Gonzalez, S., Paniagua-Torija, B., Lima, A., Molina-Holgado, E., De Nicola, A.F., Labombarda, F., 2014. Progesterone reduces secondary damage,

5.2.2. Quantitative morphometric analysis Serial sections were taken with a cryostat every 0.3 mm from a 3 mm-long block rostral to the injury. Among these serial sections, 10 representative sections at least 300 μm apart from each other were subject to immunostaining with different antibodies. After immunostaining double-labeled cells in the white matter (dorsal, lateral and ventral funiculus) were examined under a Nikon Eclipse E 800 confocal scanning laser microscope. The images of each immunohistochemistry were acquired with the same laser excitation intensity and on the same day. The quantification procedure was already reported (Labombarda et al., 2009). Briefly, a template was overlaid onto the coronal sections, dividing the spinal cord into defined sectors of 50,000 µm2 in such a way that the white matter images were always acquired in the same defined area (Labombarda et al., 2009). Each image covered the whole sector (50.000 µm2) and ten images per rat were counted (one per spinal cord section). The average of images per rat was calculated and cell quantification was expressed as the number of cells (double or single-labeled) per 50.000 µm2. Total spinal cord section area, white matter area and volume were not modified by progesterone treatment (data not shown). The number of cells counted in dorsal, lateral and ventral funiculus were averaged for each glial cell marker because no region effects were found after two-way ANOVA analysis. 5.2.3. Statistical analysis One-way ANOVA followed by the Newman-Keuls test was used for all statistical analysis. Statistical analyses were performed with Prism 5 GraphPad software (San Diego, CA, USA). Significance was set at p < 0.05. The n used for statistical analysis was the number of rats per group. The number of rats in each group was 8–10. However, ten rats were operated in both the lesioned progesterone-treated and untreated group to keep the N number large enough for statistical accuracy.” 5.3. Contributors IJ performed the research; IJ and FL analyzed the data; AFD and FL designed the research and FL wrote the paper. All authors reviewed and approved the final manuscript and they report no conflict of interests. Acknowledgements This work was supported by grants from the Ministry of Science and 45

Brain Research 1708 (2019) 36–46

I. Jure et al.

De Nicola, A.F., 2015. A functional progesterone receptor is required for immunomodulation, reduction of reactive gliosis and survival of oligodendrocyte precursors in the injured spinal cord. J. Steroid Biochem. Mol. Biol. 154, 274–284. Levine, J.M., Reynolds, R., Fawcett, J.W., 2001. The oligodendrocyte precursor cell in health and disease. Trends Neurosci. 24, 39–47. Liu, A., Li, J., Marin-Husstege, M., Kageyama, R., Fan, Y., Gelinas, C., Casaccia-Bonnefil, P., 2006. A molecular insight of Hes5-dependent inhibition of myelin gene expression: old partners and new players. EMBO J. 25, 4833–4842. Liu, J., Casaccia, P., 2010. Epigenetic regulation of oligodendrocyte identity. Trends Neurosci. 33, 193–201. Maurya, V.K., Jha, R.K., Kumar, V., Joshi, A., Chadchan, S., Mohan, J.J., Laloraya, M., 2013. Transforming growth factor-beta 1 (TGF-B1) liberation from its latent complex during embryo implantation and its regulation by estradiol in mouse. Biol. Reprod. 89, 84. McKinnon, R.D., Piras, G., Ida Jr., J.A., Dubois-Dalcq, M., 1993. A role for TGF-beta in oligodendrocyte differentiation. J. Cell Biol. 121, 1397–1407. McTigue, D.M., Tripathi, R.B., 2008. The life, death, and replacement of oligodendrocytes in the adult CNS. J. Neurochem. 107, 1–19. Mekhail, M., Almazan, G., Tabrizian, M., 2012. Oligodendrocyte-protection and remyelination post-spinal cord injuries: a review. Prog. Neurobiol. 96, 322–339. Miron, V.E., Franklin, R.J., 2014. Macrophages and CNS remyelination. J. Neurochem. 130, 165–171. Misumi, S., Kim, T.S., Jung, C.G., Masuda, T., Urakawa, S., Isobe, Y., Furuyama, F., Nishino, H., Hida, H., 2008. Enhanced neurogenesis from neural progenitor cells with G1/S-phase cell cycle arrest is mediated by transforming growth factor beta1. Eur. J. Neurosci. 28, 1049–1059. Mitew, S., Hay, C.M., Peckham, H., Xiao, J., Koenning, M., Emery, B., 2014. Mechanisms regulating the development of oligodendrocytes and central nervous system myelin. Neuroscience 276, 29–47. Palazuelos, J., Klingener, M., Aguirre, A., 2014. TGFbeta signaling regulates the timing of CNS myelination by modulating oligodendrocyte progenitor cell cycle exit through SMAD3/4/FoxO1/Sp1. J. Neurosci. 34, 7917–7930. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucl. Acids Res. 29, e45. Rabchevsky, A.G., Sullivan, P.G., Scheff, S.W., 2007. Temporal-spatial dynamics in oligodendrocyte and glial progenitor cell numbers throughout ventrolateral white matter following contusion spinal cord injury. Glia 55, 831–843. Roche, S.L., Wyse-Jackson, A.C., Gomez-Vicente, V., Lax, P., Ruiz-Lopez, A.M., Byrne, A.M., Cuenca, N., Cotter, T.G., 2016. Progesterone attenuates microglial-driven retinal degeneration and stimulates protective fractalkine-CX3CR1 signaling. PLoS One 11, e0165197. Samanta, J., Kessler, J.A., 2004. Interactions between ID and OLIG proteins mediate the inhibitory effects of BMP4 on oligodendroglial differentiation. Development 131, 4131–4142. Schucht, P., Raineteau, O., Schwab, M.E., Fouad, K., 2002. Anatomical correlates of locomotor recovery following dorsal and ventral lesions of the rat spinal cord. Exp. Neurol. 176, 143–153. Schumacher, M., Mattern, C., Ghoumari, A., Oudinet, J.P., Liere, P., Labombarda, F., Sitruk-Ware, R., De Nicola, A.F., Guennoun, R., 2014. Revisiting the roles of progesterone and allopregnanolone in the nervous system: resurgence of the progesterone receptors. Prog. Neurobiol. 113, 6–39. Siegenthaler, M.M., Tu, M.K., Keirstead, H.S., 2007. The extent of myelin pathology differs following contusion and transection spinal cord injury. J. Neurotrauma 24, 1631–1646. Sierra, A., Gottfried-Blackmore, A., Milner, T.A., McEwen, B.S., Bulloch, K., 2008. Steroid hormone receptor expression and function in microglia. Glia 56, 659–674. Skolnick, B.E., Maas, A.I., Narayan, R.K., van der Hoop, R.G., MacAllister, T., Ward, J.D., Nelson, N.R., Stocchetti, N., Investigators, S.T., 2014. A clinical trial of progesterone for severe traumatic brain injury. N. Engl. J. Med. 371, 2467–2476. Stein, D.G., 2008. Progesterone exerts neuroprotective effects after brain injury. Brain Res. Rev. 57, 386–397. Sugimori, M., Nagao, M., Parras, C.M., Nakatani, H., Lebel, M., Guillemot, F., Nakafuku, M., 2008. Ascl1 is required for oligodendrocyte development in the spinal cord. Development 135, 1271–1281. Wang, S.Z., Dulin, J., Wu, H., Hurlock, E., Lee, S.E., Jansson, K., Lu, Q.R., 2006. An oligodendrocyte-specific zinc-finger transcription regulator cooperates with Olig2 to promote oligodendrocyte differentiation. Development 133, 3389–3398. Watanabe, M., Toyama, Y., Nishiyama, A., 2002. Differentiation of proliferated NG2positive glial progenitor cells in a remyelinating lesion. J. Neurosci. Res. 69, 826–836. Wright, D.W., Kellermann, A.L., Hertzberg, V.S., Clark, P.L., Frankel, M., Goldstein, F.C., Salomone, J.P., Dent, L.L., Harris, O.A., Ander, D.S., Lowery, D.W., Patel, M.M., Denson, D.D., Gordon, A.B., Wald, M.M., Gupta, S., Hoffman, S.W., Stein, D.G., 2007. ProTECT: a randomized clinical trial of progesterone for acute traumatic brain injury. Ann. Emerg. Med. 49 391–402, 402 e1-2. Xiao, G., Wei, J., Yan, W., Wang, W., Lu, Z., 2008. Improved outcomes from the administration of progesterone for patients with acute severe traumatic brain injury: a randomized controlled trial. Crit. Care 12, R61.

preserves white matter, and improves locomotor outcome after spinal cord contusion. J. Neurotrauma 31, 857–871. Ghoumari, A.M., Ibanez, C., El-Etr, M., Leclerc, P., Eychenne, B., O'Malley, B.W., Baulieu, E.E., Schumacher, M., 2003. Progesterone and its metabolites increase myelin basic protein expression in organotypic slice cultures of rat cerebellum. J. Neurochem. 86, 848–859. Gonzalez, S.L., Labombarda, F., Gonzalez Deniselle, M.C., Guennoun, R., Schumacher, M., De Nicola, A.F., 2004. Progesterone up-regulates neuronal brain-derived neurotrophic factor expression in the injured spinal cord. Neuroscience 125, 605–614. Hiremath, M.M., Saito, Y., Knapp, G.W., Ting, J.P., Suzuki, K., Matsushima, G.K., 1998. Microglial/macrophage accumulation during cuprizone-induced demyelination in C57BL/6 mice. J. Neuroimmunol. 92, 38–49. Horky, L.L., Galimi, F., Gage, F.H., Horner, P.J., 2006. Fate of endogenous stem/progenitor cells following spinal cord injury. J. Comp. Neurol. 498, 525–538. Hornig, J., Frob, F., Vogl, M.R., Hermans-Borgmeyer, I., Tamm, E.R., Wegner, M., 2013. The transcription factors Sox10 and Myrf define an essential regulatory network module in differentiating oligodendrocytes. PLoS Genet. 9, e1003907. Hu, X., Leak, R.K., Shi, Y., Suenaga, J., Gao, Y., Zheng, P., Chen, J., 2015. Microglial and macrophage polarization-new prospects for brain repair. Nat. Rev. Neurol. 11, 56–64. Huang, H., Zhao, X.F., Zheng, K., Qiu, M., 2013. Regulation of the timing of oligodendrocyte differentiation: mechanisms and perspectives. Neurosci. Bull. 29, 155–164. Hussain, R., El-Etr, M., Gaci, O., Rakotomamonjy, J., Macklin, W.B., Kumar, N., SitrukWare, R., Schumacher, M., Ghoumari, A.M., 2011. Progesterone and nestorone facilitate axon remyelination: a role for progesterone receptors. Endocrinology 152, 3820–3831. Ishii, K., Toda, M., Nakai, Y., Asou, H., Watanabe, M., Nakamura, M., Yato, Y., Fujimura, Y., Kawakami, Y., Toyama, Y., Uyemura, K., 2001. Increase of oligodendrocyte progenitor cells after spinal cord injury. J. Neurosci. Res. 65, 500–507. Jung-Testas, I., Schumacher, M., Robel, P., Baulieu, E.E., 1994. Actions of steroid hormones- and growth factors on glial cells of the central and peripheral nervous system. J. Steroid Biochem. Mol. Biol. 48, 145–154. Jurynczyk, M., Jurewicz, A., Bielecki, B., Raine, C.S., Selmaj, K., 2008. Overcoming failure to repair demyelination in EAE: gamma-secretase inhibition of Notch signaling. J. Neurol. Sci. 265, 5–11. Kempuraj, D., Thangavel, R., Natteru, P.A., Selvakumar, G.P., Saeed, D., Zahoor, H., Zaheer, S., Iyer, S.S., Zaheer, A., 2016. Neuroinflammation induces neurodegeneration. J. Neurol. Neurosurg. Spine 1. Kim, M.R., Park, D.W., Lee, J.H., Choi, D.S., Hwang, K.J., Ryu, H.S., Min, C.K., 2005. Progesterone-dependent release of transforming growth factor-beta1 from epithelial cells enhances the endometrial decidualization by turning on the Smad signalling in stromal cells. Mol. Hum. Reprod. 11, 801–808. Kitada, M., Rowitch, D.H., 2006. Transcription factor co-expression patterns indicate heterogeneity of oligodendroglial subpopulations in adult spinal cord. Glia 54, 35–46. Kloos, A.D., Fisher, L.C., Detloff, M.R., Hassenzahl, D.L., Basso, D.M., 2005. Stepwise motor and all-or-none sensory recovery is associated with nonlinear sparing after incremental spinal cord injury in rats. Exp. Neurol. 191, 251–265. Kotter, M.R., Setzu, A., Sim, F.J., Van Rooijen, N., Franklin, R.J., 2001. Macrophage depletion impairs oligodendrocyte remyelination following lysolecithin-induced demyelination. Glia 35, 204–212. Kotter, M.R., Stadelmann, C., Hartung, H.P., 2011. Enhancing remyelination in disease–can we wrap it up? Brain 134, 1882–1900. Kuhlmann, T., Miron, V., Cui, Q., Wegner, C., Antel, J., Bruck, W., 2008. Differentiation block of oligodendroglial progenitor cells as a cause for remyelination failure in chronic multiple sclerosis. Brain 131, 1749–1758. Labombarda, F., Guennoun, R., Gonzalez, S., Roig, P., Lima, A., Schumacher, M., De Nicola, A.F., 2000. Immunocytochemical evidence for a progesterone receptor in neurons and glial cells of the rat spinal cord. Neurosci. Lett. 288, 29–32. Labombarda, F., Gonzalez, S.L., Gonzalez, D.M., Guennoun, R., Schumacher, M., de Nicola, A.F., 2002. Cellular basis for progesterone neuroprotection in the injured spinal cord. J. Neurotrauma 19, 343–355. Labombarda, F., Gonzalez, S., Gonzalez Deniselle, M.C., Garay, L., Guennoun, R., Schumacher, M., De Nicola, A.F., 2006a. Progesterone increases the expression of myelin basic protein and the number of cells showing NG2 immunostaining in the lesioned spinal cord. J. Neurotrauma 23, 181–192. Labombarda, F., Pianos, A., Liere, P., Eychenne, B., Gonzalez, S., Cambourg, A., De Nicola, A.F., Schumacher, M., Guennoun, R., 2006b. Injury elicited increase in spinal cord neurosteroid content analyzed by gas chromatography mass spectrometry. Endocrinology 147, 1847–1859. Labombarda, F., Gonzalez, S.L., Lima, A., Roig, P., Guennoun, R., Schumacher, M., de Nicola, A.F., 2009. Effects of progesterone on oligodendrocyte progenitors, oligodendrocyte transcription factors, and myelin proteins following spinal cord injury. Glia 57, 884–897. Labombarda, F., Gonzalez, S., Lima, A., Roig, P., Guennoun, R., Schumacher, M., De Nicola, A.F., 2011. Progesterone attenuates astro- and microgliosis and enhances oligodendrocyte differentiation following spinal cord injury. Exp. Neurol. 231, 135–146. Labombarda, F., Jure, I., Gonzalez, S., Lima, A., Roig, P., Guennoun, R., Schumacher, M.,

46