Progesterone-induced agrin expression in astrocytes modulates glia–neuron interactions leading to synapse formation

Neuroscience 141 (2006) 1327–1338

PROGESTERONE-INDUCED AGRIN EXPRESSION IN ASTROCYTES MODULATES GLIA–NEURON INTERACTIONS LEADING TO SYNAPSE FORMATION C. E. TOURNELL, R. A. BERGSTROM AND A. FERREIRA*

mental milestone (Haydon, 2001; Slezak and Pfrieger, 2003). This evidence has been obtained using both in vivo and in culture model systems. In vivo studies established the temporal correlation between the generation of glial cells and the formation of synaptic contacts in many regions of the CNS (Pfrieger and Barres, 1996; Sauvageot and Stiles, 2002). More recently, studies using cultured neurons provided data suggesting that astrocytes induced not only synapse formation but also enhanced synaptic activity in retinal ganglion cells (Mauch et al., 2001). These effects seem to be mediated, at least in part, by cholesterol complexed with apolipoprotein E-containing lipoproteins, and thrombospondin (Mauch et al., 2001; Christopherson et al., 2005). Collectively, these data provided some insights into the molecular mechanisms underlying the glial effects on synapse formation and/or synaptic activity. On the other hand, neither the full complement of glia-derived factors capable of influencing synapse formation nor the regulation of these factors has been elucidated. It is tempting to speculate that, if expressed in glial cells, proteins implicated in synaptogenesis both at the neuromuscular junction and in interneuronal synapses could modulate the glia–neuron interactions during the formation of synaptic contacts. One such protein is agrin, a single chain extracellular matrix glycoprotein first localized at the neuromuscular junction. Agrin is encoded by a single gene that is alternatively spliced to give rise to several isoforms that are differentially expressed throughout the organism (Deyst et al., 1998; Glass and Yancopoulos, 1997; Glass et al., 1996; Godfrey, 1991; Godfrey et al., 1988; Hoch et al., 1994; McMahan, 1990; Ruegg and Bixby, 1998; Ruegg et al., 1992; Rupp et al., 1991, 1992; Sanes, 1997; Stone and Nikolics, 1995). Initial studies suggested that the agrin isoform capable of inducing synapse formation was synthesized only by motoneurons and transported to their terminals where it was released (Magill-Solc and McMahan, 1988). Recently, it has been shown that this neuron-specific agrin isoform is also expressed in central neurons (Bowe and Fallon, 1995; Hilgenberg et al., 1999; Hoch et al., 1993; Ji et al., 1998; Kroger et al., 1996; Mann and Kroger 1996; Mantych and Ferreira, 2001; O’Toole et al., 1996; Rupp et al., 1991, 1992; Stone and Nikolics, 1995). Furthermore, this agrin isoform induced synapse formation when added to cultured hippocampal neurons and sympathetic neurons (Gingras et al., 2002; Mantych and Ferreira, 2001). On the other hand, little is known about other potential sources of agrin in the CNS or whether agrin synthesized by other cell

Department of Cell and Molecular Biology, The Feinberg School of Medicine, Northwestern University, and Institute for Neuroscience, Northwestern University, Searle Building Room 5-474, 320 East Superior Street, Chicago, IL 60611, USA

Abstract—Experimental evidence recently obtained suggests that synaptogenesis is a tripartite event in which not only pre- and post-synaptic neurons but also glial cells play a key role. However, the molecular mechanisms by which glia modulate the formation of synapses in the CNS remain poorly understood. In the present study, we analyzed the role of astrocytes in synapse formation in cultured hippocampal rat neurons. For these experiments, hippocampal neurons were cultured in the presence or absence of a monolayer of astrocytes. Our results indicated that hippocampal neurons cultured in the presence of astrocytes formed more synapses than the ones cultured in their absence only when kept in N2 serum-free medium. To get insights into the potential molecular mechanisms underlying this effect, we analyzed the expression of proteins known to induce synapse formation in hippocampal neurons. A significant increase in agrin expression was detected in astrocytes cultured in N2 serum-free medium when compared with the ones cultured in serum containing medium. Experiments performed using different components of the N2 mixture indicated that progesterone induced the expression of agrin in astrocytes. Taken collectively, these results provide evidence supporting a role for astrocytes in synapse formation in central neurons. Furthermore, they identified agrin as a potential mediator of this effect, and astrocytes as a bridge between the endocrine and nervous systems during synaptogenesis. © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: synaptogenesis, hippocampal neurons, antisense oligonucleotides, astrocytes, hormones.

The formation of synaptic contacts could be considered a key cellular event leading to the establishment of a functional neuronal network. As such, it has been extensively studied. The majority of these studies have considered synaptogenesis in the CNS as a pure neuronal cellular event. However, a growing body of evidence suggests that glial cells might be important modulators of this develop*Corresponding author. Tel: ⫹1-312-503-0597; fax: ⫹1-312-503-7345. E-mail address: [email protected] (A. Ferreira). Abbreviations: BSA, bovine serum albumin; E18, embryonic day 18; GFAP, glial fibrillary acid protein; MAP2, microtubule-associated protein 2; MEM, minimum essential medium; PBS, phosphate-buffered saline; PSD-95, postsynaptic density protein 95; RT-PCR, reverse transcription–polymerase chain reaction; SDS, sodium dodecyl sulfate; SN, short N-terminal.

0306-4522/06$30.00⫹0.00 © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2006.05.004

1327

1328

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

types (i.e. glia cells) could also promote synapse formation. The present study provides evidence indicating that agrin is indeed expressed in astrocytes. In addition, our results show that glia-derived agrin enhances synapse formation in hippocampal neurons. Finally, the data presented herein suggest that progesterone could regulate synapse formation in hippocampal neurons by modulating agrin-mediated glia–neuron interactions.

EXPERIMENTAL PROCEDURES Preparation of hippocampal cultures Neuronal cultures were prepared from the hippocampi of embryonic day 18 (E18) rat embryos as previously described (Goslin and Banker, 1991). In brief, embryos were removed and their hippocampi dissected and freed of meninges. The cells were dissociated by trypsinization (0.25% for 15 min at 37 °C) followed by trituration with a fire-polished Pasteur pipette and plated onto poly-L-lysine-coated coverslips or 60 mm tissue culture dishes in minimum essential medium (MEM) with 10% horse serum at a density of 150,000 cell/60 mm dish. Coverslips were then transferred to dishes containing an astroglial monolayer and maintained in MEM supplemented with either horse serum (10%) or N2 mixture (Bottenstein and Sato, 1979) plus ovalbumin (0.1%) and sodium pyruvate (0.1 mM). Sister cultures were cultured in the same media but in the absence of astrocytes.

Preparation of astrocyte cultures Astrocyte cultures were prepared from the cerebral cortex of E18 rat embryos as previously described (Ferreira and Loomis, 1998). Briefly, embryos were removed and their cerebral cortex dissected and freed of meninges. The cells were dissociated by trypsinization (0.25% for 35 min at 37 °C) and then centrifuged in MEM plus 10% horse serum at 1000 r.p.m. for 10 min. The cells were resuspended in fresh MEM plus 10% horse serum, triturated with a fire-polished pipette, and plated at high density (800,000 cells/ 60-mm dish) on non-coated culture dishes. All the experiments included in this study were performed using astrocytes kept in culture for 14 days.

Reverse transcription–polymerase chain reaction (RT-PCR) To obtain total mRNA, astrocytes were lysed in TRIzol® Reagent (Life Technologies, Gaithersburg, MD, USA). RNA was extracted by phenol/chloroform according to the TRIzol® Reagent manufacturer’s protocol. Reverse transcription was performed in 20 ␮l reactions containing 1 ␮g sample RNA, 2.5 U MuLV reverse transcriptase, 2.5 ␮M random hexamers, 1 U RNase inhibitor, 8 ␮l DNase- and RNase-free (DI) water, 1 mM dNTP, 5 mM MgCl2 solution, 2 ␮l l0X Buffer II (GeneAmp RNA PCR Core Kit, N8080143; Perkin Elmer, Branchburg, NJ, USA). Tubes were incubated at 42 °C for 15 min and then at 99 °C for 5 min to terminate the reaction. To control for DNA contamination, reverse transcription was also performed in parallel tubes where MuLV reverse transcriptase was omitted. The reaction products were then subject to PCR amplification. No DNA contamination was detected in our samples (data not shown). PCR was performed in 80 ␮l reactions containing 1 ␮l of RT product, 1 ␮M primer forward (F), 1 ␮M primer reverse (R), 61 ␮l DI water, 0.25 mM dNTP, 1.25 mM MgCl2 solution, 8 ␮l l0⫻ Buffer II, 2 U DyNAzymeTM EXT DNA Polymerase (Finnzymes Oy, MJ Research, Waltham, MA, USA). The following primer sets were used: AgrinS (sense, 5= GCC GTA TAG GTG CAA CCC G 3=), AgrinAS (antisense, 5=TAC GGA GTT

AAA CTG GCA GGT CT3=), corresponding to nucleotides 998 – 1016 and 1098 –1076 respectively; ␤-actinS (sense, 5=GCA CCA CAC CTT CTA CAA TGA G3=), and ␤-actinAS (antisense, 5=CTC CTG AGC GCA AGT ACT CTG T3=), corresponding to nucleotides 338 –360 and 1075–1053 of the ␤-actin sequences, respectively. Two additional sets of agrin primers were used to study the expression of agrin isoforms that differ in their N-terminal regions. For these experiments we used the following primers: long Nterminal (LN) agrin isoform: forward primer 5=AGC CCA CAA GAA TGA GTT GAT GC3=, and reverse primer 5=AAG CCA CAT ACC ATT CCC CTG C3= as described by Burgess et al. (2000). To detect the expression of the short N-terminal (SN) agrin isoform we used the following primers: forward primer 5=TGC CTC CAT GCT GGT TCG ATA CTT3=, and the reverse primer 5=TAA GCA GCT GGC ATT CAC TAG GGT3= corresponding to nucleotides in positions 246 –270 and 761–785, respectively (Rupp et al., 1992). Each primer set was tested for the linearity of the PCR amplification by performing preliminary experiments using different number of cycles as previously described (Ilse Raats et al., 2000). For the agrin primer sets, an initial denaturation cycle of 2 min at 94 °C followed by 34 cycles (1.5 min at 94 °C, 1.5 min at 58 °C and 1.5 min at 72 °C) and a prolonged final extension time of 10 min at 72 °C after the 34 cycles were completed (Ilse Raats et al., 2000; Mantych and Ferreira, 2001). PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining. PCR product quantification was performed using a UMAX Power Look flatbed scanner and Adobe® PhotoShop® software on an Apple Power Mac G4 system.

Immunocytochemistry Hippocampal cultures were fixed for 15 min with 4% paraformaldehyde in phosphate-buffered saline (PBS) containing 0.12 M sucrose. They were then permeabilized in 0.3% Triton X-100 in PBS for 5 min and rinsed three times in PBS. The coverslips were preincubated in 10% bovine serum albumin (BSA) in PBS for 1 h at room temperature and exposed to the primary antibodies (diluted in 1% BSA in PBS) overnight at 4 °C. Finally, the cultures were rinsed in PBS and incubated with secondary antibodies for 1 h at 37 °C. The following primary antibodies were used: anti-␣tubulin (clone DM1A, 1:200; Sigma, St. Louis, MO, USA), antisynaptophysin (1:75; Chemicon, Temecula, CA, USA), anti-microtubule-associated protein 2 (MAP2) (clone AP14, 1:100; Caceres et al., 1984), anti-synapsin 1 (1:100; Zymed Laboratories, Inc., San Francisco, CA, USA), anti-postsynaptic density protein 95 (PSD-95) (1:100; Upstate Biotechnology, Charlottesville, VA, USA). The following secondary antibodies were used: Alexa Fluor® 488 goat anti-mouse IgG, Alexa Fluor® 568 goat antimouse IgG, Alexa Fluor® 488 goat anti-rabbit IgG, and Alexa Fluor® 568 goat anti-rabbit IgG (all diluted 1:200; Molecular Probes, Eugene, OR, USA). Fluorescent images of equal exposure from hippocampal neurons cultured under different experimental conditions were acquired with a Photometric Cool Snap FX color digital camera on a Nikon microscope.

Detection of synapses Synapse formation was determined using synaptophysin and synapsin I as presynaptic markers and PSD-95 as a postsynaptic marker. The number of synapses was determined by counting the synaptophysin immunoreactive dots (presynaptic specializations) juxtaposed to cell bodies or dendrites per cell using Metamorph Image Analysis software (Universal Imaging Corporation, Fryer Company Inc., Huntley, IL, USA). The colocalization of synaptophysin immunoreactive dots with PSD-95 ones was determined in hippocampal neurons double-stained using specific antibodies. An average of 90 cells was analyzed for each experimental condition. Synaptic density was determined by counting the number of synapsin 1 immunoreactive dots per 10 ␮m of dendritic length. For

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338 these experiments, cultures were double stained using antibodies against synapsin 1 and MAP2 as synaptic and dendritic markers, respectively. Dendritic length from randomly selected cells was measured using Metamorph software. Synaptic density was determined in 40 cells for each experimental condition. All quantitative data were obtained blind as to treatment condition. For some experiments, hippocampal neurons stained using the MAP2 antibody were used to determine the number of primary dendrites emerging from the cell bodies.

Determination of cell viability Cell viability was assessed by the Trypan Blue exclusion method as previously described (Black and Berenbaum, 1964). Briefly, hippocampal cultures co-cultured for 11 days with astrocytes using serum containing medium alone, serum-containing medium supplemented with progesterone, and N2 serum-free medium were incubated in 0.4% Trypan Blue (Sigma) for 5 min at room temperature. The cells were rinsed in PBS and immediately counted. The ratio of dead/total number of neurons per field was determined using phase-contrast microscopy. Cells that did not exclude Trypan Blue (“blue” neurons) were counted as dead cells. Ten non-overlapping microscopic fields from three independent cultures were analyzed for each experimental condition.

Protein electrophoresis and immunoblotting Astrocytes were rinsed twice in warmed PBS, scraped into Laemmli buffer, and homogenized in a boiling waterbath for 10 min. Sodium dodecyl sulfate (SDS)-polyacrylamide gels were run according to Laemmli (1970). Transfer of protein to Immobilon membranes (Millipore, Bedford, MA, USA) and immunodetection were performed according to Towbin et al. (1979) as modified by Ferreira et al. (1989). The following antibodies were used: anti-␣tubulin (clone DM1A, 1:200,000; Sigma), anti-agrin 530 (all agrin isoforms) and 520 (neuron-specific agrin isoform) (both 1:75; Stressgen, Victoria, BC, Canada), and anti-thrombospondin (1: 200; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Secondary antibodies conjugated to HRP (1:1,000; Promega, Madison, WI, USA) followed by enhanced chemiluminescence reagents (Amersham Pharmacia Biotech, Chicago, IL, USA) were used for the detection of proteins. In some experiments, blots were stripped in 60 mM Tris, 2% SDS and 0.8% ␤-mercaptoethanol at 55 °C for 30 min, and then reprobed with a different antibody. Densitometry was performed initially using a UMAX Power Look flatbed scanner and Adobe® PhotoShop® software on an Apple Power Mac G4 system. Films were scanned at 600 dpi using light transmittance, and volume analysis was performed on the appropriate bands. Membranes were also imaged using a ChemiDoc gel documentation system (Bio Rad, Hercules, CA, USA). Bands were analyzed using Quantity One Analysis Software (Bio Rad). Densitometry values were normalized using ␣-tubulin as an internal control. Scanning of the Western blots demonstrated the curve to be linear in the range used for each antibody. All results were expressed as mean⫾S.E.M. obtained from three independent experiments.

Agrin antisense oligonucleotide treatment To block the expression of agrin in cultured astrocytes, we performed experiments using antisense oligonucleotides extensively characterized in our laboratory (Ferreira, 1999; Mantych and Ferreira, 2001). For these experiments, cultured astrocytes kept in MEM were incubated with the specific agrin antisense oligonucleotide ⫺12⫹12 (5=CAGAGGAGGCATGATACATACAGC3=) based upon the sequence of rat agrin (Rupp et al., 1991). This oligonucleotide is specific for the SN (transmembrane) agrin isoform. The corresponding sense oligonucleotide was used as an additional control. Oligonucleotides, S-modified in the last three bases in the

1329

3= terminal region, were synthesized on an Applied Biosystems 380B synthesizer (Applied Biosystems, Inc. Foster City, CA, USA), purified over a NAP5 column (Pharmacia LKB Biotechnology, Inc., Piscataway, NJ, USA), ethanol precipitated, and taken up in media. The oligonucleotides were added at a 50 ␮M final concentration every 24 h. We have previously shown that while this antisense oligonucleotide was able to block the expression of agrin in a dose-dependent manner, the corresponding sense oligonucleotide did not affect agrin levels (Ferreira, 1999; Mantych and Ferreira, 2001). Hippocampal neurons kept in culture for 5 days were placed face down on sense- and antisense-treated astrocytes and cultured for 48 h in the presence or absence of progesterone. Neurons were then fixed and synaptic contacts counted as described above. All experiments were performed in triplicate using neurons and astrocytes obtained from three independent preparations.

Reagents The C-terminal agrin construct lacking inserts in the Y and Z splicing sites (C-Ag12,0,0) (Ferns et al., 1993) was transfected into astrocytes as previously described (Paganoni and Ferreira, 2005). Briefly, transfections were performed with the NucleofectorTM apparatus (Amaxa, Gaithersburg, MD, USA). Astrocytes were resuspended in Amaxa rat glia nucleofector solution, transferred to an electroporation cuvette and “nucleofected” according to the manufacturer’s protocol (program T-20). For each reaction, 4,000,000 astrocytes and 3 ␮g of cDNA were used. Astrocytes were then plated at a density of 20,000 cells/cm2. For some experiments, we collected the medium in which these transfected glial cells were maintained. This medium was then used to co-culture hippocampal neurons and agrin antisense-treated astrocytes. For some experiments, astrocytes were incubated with the antiprogestin RU 486 (Mifepristone, Tocris Bioscience, Ellisville, MO, USA) at a final concentration of 100 nM. Both RU486 and progesterone were added at the same time as previously described (Jung-Testas and Baulieu, 1998). Whole cell extracts were prepared 24 h later and agrin levels were detected by means of Western blot analysis as described above.

Detection of agrin in glia-conditioned medium A confluent monolayer of astrocytes was cultured for 24 h in MEM10, MEM10 plus progesterone (6.3 ng/ml), or N2 serum-free medium. The glial-conditioned medium was then collected and clarified by centrifugation to remove cells and cellular debris. High molecular weight proteins were concentrated using an Amicon Ultra-4 centrifugal filter unit (NMWL, 100,000 kDa; Millipore Corporation). Samples were diluted 1:1 in Laemmli buffer 2⫻, boiled for 5 min, and used in dot-immunobinding assays according to protocols already described (Ferreira et al., 1989). Quantitative analysis of agrin immunoreactive spots was performed using the Quantity One Analysis Software (Bio Rad) as described above.

Statistical analysis Data were presented as means⫾S.E.M. All data were analyzed using one-way ANOVA followed by Fisher’s LSD post hoc test.

RESULTS Effect of astrocytes on synapse formation in hippocampal neurons It has been previously shown that astrocytes enhanced synapse formation in retinal ganglion cells (Mauch et al., 2001; Christopherson et al., 2005). However, no comparable information is available regarding the effect of astro-

1330

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

Fig. 1. Astrocytes induced synapse formation in cultured hippocampal neurons. Hippocampal neurons were cultured for 11 days in MEM⫹10% horse serum (MEM10) (A and C) or MEM⫹N2 supplements (N2) (B and D) media in the absence (A and B) or in the presence (C and D) of an astrocyte monolayer. Neurons were then stained using synaptophysin as a synaptic marker. Note the increased number of synapses in hippocampal neurons cultured in N2 in the presence of astrocytes when compared with the ones grown either in the absence of these glial cells or in MEM10 medium. Scale bar⫽20 ␮m. (E) Quantitative analysis of the number of synapses/cell present under the experimental conditions described above. The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from all other experimental conditions, P⬍0.01. (F) Quantitative analysis of the number of synapses/10 ␮m of dendritic length present in hippocampal neurons co-cultured with astrocytes using MEM10 or N2 serum-free media. The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from MEM10 controls, P⬍0.01; w/o, without.

cytes on synapse formation in other central neurons. To obtain further insights into such a glial role, we analyzed the formation of synaptic contacts in hippocampal neurons that developed in the presence or absence of astrocytes. For these experiments, coverslips containing freshly plated hippocampal neurons were placed face down on an astrocyte monolayer. Separation of these two cell types was achieved by placing paraplast dots on the coverslips containing the neuronal cultures as previously described (Goslin and Banker, 1991). Eleven days later, the coverslips were fixed, and the number of synaptic contacts was determined using synaptophysin as a synaptic marker. Synaptophysin, a synaptic vesicle integral membrane protein, has been extensively used to quantify synaptic contacts (Fletcher et al., 1991; Holgado and Ferreira, 2000). These studies have shown that the majority (⬃90%) of the synaptophysin immunoreactive spots correspond to synapses as defined at the ultrastructural level in cultured hippocampal neurons (Fletcher et al., 1991; Ferreira et al., 1995; Holgado and Ferreira, 2000). Thus, synaptophysin immunoreactive spots labeled accumulations of synaptic vesicles in presynaptic terminals that were separated from a postsynaptic density by a narrow synaptic cleft. Using this

method, we detected a similar number of synaptophysincontaining puncta outlining the cell bodies and dendrites of hippocampal neurons cultured in serum-containing medium in the presence or absence of glial cells (Fig. 1). Synaptic contacts were also detected in hippocampal neurons cultured in the presence or absence of astrocytes using N2 serum-free medium (Fig. 1). In contrast to the lack of effect of astrocytes on synaptogenesis when cocultured in serum containing medium, a significant increase (⬃two-fold) in the number of synaptophysin immunoreactive spots was detected in hippocampal neurons cultured in the presence of astrocytes using N2 serum-free medium when compared with the ones grown using the same medium but in the absence of these glial cells (Fig. 1E). It is worth mentioning that the majority of these synaptophysin immunoreactive spots colocalized with the postsynaptic densities using PSD-95 as a postsynaptic marker in hippocampal neurons cultured in N2 serum-free medium both in the presence and absence of astrocytes (82⫾3% vs. 85⫾4%, respectively). We then ruled out that the increase in the number of synapses detected in hippocampal neurons co-cultured with astrocytes in N2 serum-free medium was a result of

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

1331

Fig. 2. N2 medium induced agrin expression in cultured astrocytes. (A) Western blot analysis of agrin levels in whole cell extracts obtained from astrocytes cultured for 24 h in MEM10 or N2 media. Tubulin levels were used as internal controls. (B) Quantitative analysis of agrin immunoreactive bands. The numbers represent the mean⫾S.E.M. for three independent experiments. Note the significant increase in agrin levels in astrocytes cultured in N2 medium as compared with the ones cultured in MEM10. * Differs from MEM10 controls, P⬍0.01. (C, D) RT-PCR of agrin mRNA in astrocytes cultured for 6 h (C) and 24 h (D) in MEM10 and N2 media. Actin RT-PCR products were used as internal controls. Note the significant increase in the agrin RT-PCR product in astrocytes cultured in N2 for 24 h as compared with the ones grown in MEM10 medium.

an enhanced survival and/or dendritic outgrowth. Quantitative analysis using Trypan Blue showed no differences in the number of dead cells in co-cultures of hippocampal neurons and astrocytes in N2 serum-free medium when compared with the ones kept in serum-containing medium (5⫾0.7% of dead cells vs. 5⫾1% of dead cells, respectively). Neither did we detect differences in the number of primary dendrites extended by hippocampal neurons when co-cultured with astrocytes in N2 serum-free medium as compared with the ones cultured in serumcontaining medium (4.2⫾0.2 vs. 4.5⫾0.3, respectively). We next determined whether the increase in synapses observed in hippocampal neurons co-cultured with astrocytes in N2 serum-free medium was due to enhanced dendritic elongation. For these experiments, we calculated synaptic density as the number of axodendritic synapses per 10 ␮m of dendrite length in hippocampal neurons cocultured with glial cells using either serum-containing medium or N2 serum-free medium. Cultures were fixed 11 days after plating, and double stained using antibodies against the MAP2 and synapsin 1 as dendritic and synaptic markers, respectively. Numerous synapsin 1-immunoreactive spots decorated MAP2-positive processes under both experimental conditions (data not shown). However, quantitative analysis showed a marked increase (⬃two-fold) in synaptic density in hippocampal neurons co-cultured with astrocytes in N2 serum-free medium when compared with their counterparts grown in serum-containing medium (Fig. 1). Agrin is expressed in astrocytes cultured in N2 serum-free medium The experiments described above showed that astrocytes induced synapse formation in hippocampal neurons when co-cultured in N2 serum-free medium. In addition, these results suggested that a released factor(s) was responsible for this effect since these two cell types were not in direct contact. To determine whether agrin could be one of

such factors, we analyzed its expression in cultured astrocytes. RT-PCR experiments were performed using specific primers designed using the N-terminal sequence of either the SN (transmembrane) or the long N-terminal (secreted) agrin isoforms. Our results indicated that both agrin isoforms were expressed in cultured astrocytes (data not shown). We next determined whether agrin protein was present in whole cell lysates. For these experiments, cultured astrocytes were kept in either serum-containing medium or N2 serum-free medium. The cells were then scraped into Laemmli buffer and whole cell extracts were prepared as described in the Experimental Procedures section. Western blot analysis performed using isoformspecific antibodies (see Experimental Procedures) showed that neuron-specific agrin was not detected in astrocytes independently of the media used to culture them (data not shown). By contrast non-neuron-specific agrin was detected in astrocytes cultured in either serum-containing medium or N2 serum-free medium (Fig. 2). However, agrin levels were significantly different under these two experimental conditions. Thus, a faint agrin immunoreactive band was detected in astrocytes cultured in serum containing medium (Fig. 2). On the other hand, a strong agrin immunoreactive band was detected in astrocytes cultured in N2 serum-free medium (Fig. 2). Quantitative analysis of immunoreactive bands showed a significant increase (⬃50%) in agrin levels in astrocytes cultured in N2 serumfree medium when compared with the ones obtained in astrocytes kept in serum-containing medium (Fig. 2). We next performed RT-PCR experiments using specific agrin primers to determine whether the increase in agrin levels detected in astrocytes cultured in N2 serumfree medium was the result of enhanced agrin transcription. For these experiments, actin PCR products were used as internal controls as previously described (Ilse Raats et al., 2000; Mantych and Ferreira, 2001). No significant differences in the levels of agrin mRNA were de-

1332

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

tected in astrocytes cultured in N2 serum-free medium when compared with the ones grown in serum-containing medium 6 h after the media change (105⫾8% vs. 100%, respectively). On the other hand, a marked increase in agrin mRNA levels was detected in astrocytes cultured in N2 serum-free medium for 24 h when compared with ones cultured in serum-containing medium (152⫾17% vs. 100%, respectively; P⬍0.01) (Fig. 2). We determined next whether an increase in agrin levels was also detectable in the N2 serum-free medium in which astrocytes were cultured. For these experiments, the glia-conditioned media was concentrated using Amicon filter units and agrin levels were analyzed by dot immunobinding assays as described in the Experimental Procedures section. Quantitative analysis showed a significant increase in agrin levels in the N2 serum-free medium in which astrocytes were cultured for 24 h when compared with the serum-containing one (193⫾11% vs. 100%, respectively; n⫽3 independent experiments). Since several studies have shown that glia-derived thrombospondin modulates synapse formation, we also assessed changes in its levels in astrocytes cultured in serum-containing medium and N2 serum-free medium by means of Western blot analysis. Quantitative analysis of immunoreactive bands showed no significant differences in thrombospondin levels in whole cells extracts obtained from astrocytes cultured in either one of these media (100% vs. 105⫾10%, respectively; n⫽3 astrocyte preparations obtained from different glia preparations). Progesterone induced agrin expression in cultured astrocytes The results described above indicated that N2 serum-free medium was able to significantly induce the expression of agrin in cultured astrocytes. To identify the component(s) of the N2 mixture responsible for this effect, we incubated astrocytes with serum-containing medium supplemented with each one of the N2 components. These components were used at final concentrations identical to the ones present in the N2 mixture (see below). Western blot analysis of whole cell extracts obtained from astrocytes cultured under these experimental conditions for 24 h was conducted using agrin antibodies. Our results showed no changes in agrin expression in astrocytes cultured in serum-containing medium plus insulin (5 ␮g/ml), selenium (30 nM), transferrin (100 ␮g/ml), or putrescine (100 ␮M) (Fig. 3A). On the other hand, a significant increase in agrin expression was detected when astrocytes were cultured in serum-containing medium plus progesterone (6.3 ng/ml) (Fig. 3B). We verified the effect of progesterone on agrin expression in astrocytes by treating these glial cells with RU 486, an antagonist of the progesterone receptor. For these experiments, astrocytes were treated with progesterone (6.3 ng/ml) alone or in combination with RU 486 (100 nM) for 24 h as previously described (Jung-Testas and Baulieu, 1998). The levels of agrin were then determined by Western blot analysis. Quantitative analysis of agrin immunoreactive bands showed a marked increase in agrin levels in astrocytes treated with progesterone alone

Fig. 3. Effect of different components of N2 medium on agrin expression in astrocytes. (A–C) Western blot analysis of agrin levels in whole cell extracts obtained from astrocytes cultured in M, M plus each one of the components of the N2 medium or PR plus RU 486. Note that only PR induced agrin expression in cultured astrocytes (B). This increase in agrin levels was not detected when astrocytes were cultured in the presence of PR plus RU 486 (C). (D) Quantitative analysis of agrin content in astrocytes cultured under the experimental conditions described above. The numbers represent the mean⫾S.E.M. for three independent experiments considering the values obtained in astrocytes cultured in MEM10 as 100%. * Differs from MEM10, P⬍0.01. I, insulin; M, MEM10; PR, progesterone; PU, putrescine; S, selenium; T, transferrin.

when compared with non-treated astrocytes (Fig. 3C). On the other hand, no significant changes in agrin levels were detected when astrocytes were treated with RU 486 and progesterone combined as compared with the ones observed in non-treated astrocytes (Fig. 3C and D). We determined next whether an increase in agrin levels was also detectable in the medium in which astrocytes treated with progesterone were cultured. Quantitative analysis of dot-immunobinding assays showed a significant increase in agrin levels in the culture medium of astrocytes treated with progesterone for 24 h when compared with the ones detected in the medium collected from non-treated astrocyte cultures (171⫾10% vs. 100%, respectively; n⫽3 independent experiments). To further test the effect of progesterone on agrin expression, we cultured astrocytes in serum-containing medium plus progesterone for up to 5 days. Quantitative analysis of agrin immunoreactive bands indicated that progesterone significantly increased the levels of this protein as early as 24 h after the addition of the steroid (Fig. 4). These levels remained significantly higher than the ones observed when astrocytes were cultured in serum-containing medium alone throughout the whole period analyzed (Fig. 4). We also determined whether progesterone induced agrin expression in a dose-dependent manner. For these experiments, astrocytes were cultured in the presence of progesterone at final concentrations ranging from 3.1–50.4 ng/ml. Western blot analysis of the expression of agrin indicated that the effect of progesterone on agrin expression reached its peak when used at a final concentration of 6.3 ng/ml (the concentration used in the N2 mixture). Surprisingly, no increase in agrin expression was detected when astrocytes were cultured in the presence of

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

Fig. 4. Effect of progesterone on agrin expression in astrocytes. Western blot analysis of time course (A and B) and dose-dependency (C and D) effects of progesterone on agrin expression in astrocytes. Agrin immunoreactive bands were quantified using tubulin as internal control (B and D). The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from MEM10-treated astrocytes, P⬍0.01.

higher progesterone concentrations (Fig. 4). This lack of biological response at higher progesterone levels has already been described in central neurons. Thus, progesterone failed to induce changes in dendritic area in Purkinje cells when added at final concentrations higher than 10⫺8 M (Sakamoto et al., 2001). Progesterone induced synapse formation in hippocampal neurons co-cultured with astrocytes The results described above indicated that progesterone was the only component of the N2 mixture that induced agrin expression in astrocytes. We next analyzed whether progesterone was also able to induce synapse formation in

1333

hippocampal neurons co-cultured with astrocytes. For these experiments, synaptic contacts were detected using synaptophysin and PSD-95 as synaptic markers as described above. Quantitative analysis showed that the number of synaptophysin immunoreactive puncta detected in both neurons co-cultured with astrocytes in serum containing medium supplemented with progesterone or N2 serumfree medium was significantly higher than the one observed in serum-containing media alone (Fig. 5). In addition, most of the synaptophysin immunoreactive spots colocalized with PSD-95 immunoreactive ones in neurons co-cultured with astrocytes in serum containing medium in the absence or presence of progesterone or in N2 serumfree medium (89⫾2% vs. 83⫾4% vs. 83⫾6%, respectively). Synaptic density was also significantly increased in hippocampal neurons co-cultured with astrocytes in serum-containing medium plus progesterone or N2 serumfree medium when compared with the ones kept in serumcontaining medium alone (Fig. 5). It is worth noting that progesterone had no effect on neuronal survival and/or the number of primary dendrites elongated by hippocampal neurons as compared with neurons cultured in serumcontaining media alone or N2 serum-free medium (4.5⫾1.3% vs. 5⫾1.2% vs. 5⫾0.7% of dead cells, respectively; and 4.3⫾0.2, vs. 4.5⫾0.3 vs. 4.2⫾0.2 number of primary dendrites, respectively). Progesterone receptors have been localized not only in astrocytes but also in neurons in the rat brain (Jung-Testas et al., 1992; Kato et al., 1994). Therefore, we also performed a series of experiments to rule out any direct effect of progesterone on hippocampal neurons. For these experiments, hippocampal neurons cultured in the absence of astrocytes were incubated with serum-containing medium, serum-containing medium plus progesterone, or N2 serum-free medium. Our results showed no differences in the number of synapses in hippocampal neurons cultured under these experimental conditions (Fig. 6). No differences were detected either when synaptic density was determined in hippocampal neurons cultured in the absence of astrocytes in serum-containing medium, serum containing medium plus progesterone, or N2 serum-free medium (23⫾0.9 vs. 27⫾0.9 vs. 28⫾1 synapses/10 ␮m of dendritic length, respectively). Finally, we determined to what extent astrocyte-derived agrin mediated progesterone-induced synapse formation in hippocampal neurons co-cultured with this glial cell type. For these experiments, we used agrin-specific antisense oligonucleotides to block its expression in astrocytes. We have previously shown that while the agrin antisense oligonucleotide (⫺12⫹12) blocked the expression of agrin in hippocampal neurons in a dose-dependent manner, its sense counterpart had no effect on agrin levels (Ferreira, 1999; Mantych and Ferreira, 2001). In this study, we tested whether this antisense oligonucleotide was also able to suppress the basal and/or progesterone-induced agrin expression in glial cells. For these experiments, astrocytes were incubated with agrin antisense oligonucleotides alone or in addition to progesterone for 24 h. The cells were then scraped in Laemmli buffer and agrin levels

1334

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

Fig. 5. Progesterone (P) induced synapse formation in hippocampal neurons cultured in the presence of astrocytes. Hippocampal neurons were grown in the presence of an astrocyte monolayer in MEM10 (A), MEM10⫹P (B), and N2 (C) media for 11 days. The cells were then fixed and stained using a synaptophysin antibody. Note the increase in synaptophysin immunoreactive dots in hippocampal neurons cultured in MEM10⫹P, and N2 media. Scale bar⫽20 ␮m. (D) Quantitative analysis of the number of synapses present under the experimental conditions described above. The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from MEM10 controls, P⬍0.01. (E) Quantitative analysis of the number of synapses/10 ␮m of dendritic length present under the experimental conditions described above. The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from MEM 10 controls, P⬍0.01.

were assessed by Western blot analysis. Quantitative analysis of immunoreactive bands showed that the incu-

bation with this antisense oligonucleotide suppressed the basal levels of agrin expression in astrocytes. Further-

Fig. 6. Progesterone did not induce synapse formation in hippocampal neurons cultured in the absence of astrocytes. Hippocampal neurons were grown in the absence of astrocytes in MEM10 (A), MEM10⫹progesterone (B), and N2 (C) media for 11 days. The cells were then fixed and stained using a synaptophysin antibody. No increase in synaptophysin immunoreactive dots was detected in hippocampal neurons cultured in MEM10⫹progesterone and N2 media in the absence of astrocytes when compared with the ones grown in MEM10. Scale bar⫽20 ␮m. (D) Quantitative analysis of the number of synapses/cell present under the experimental conditions described above. The numbers represent the mean⫾S.E.M. for three independent experiments.

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

1335

Table 1. Quantification of synapse formation in hippocampal neurons co-cultured with astrocytes in which agrin expression was either up- or down-regulated Glia treatment

None None Agrin sense oligonucleotidesb Agrin sense oligonucleotidesb Agrin antisense oligonucleotidesb Agrin antisense oligonucleotidesb C-Ag12,0,0 transfected Agrin antisense oligonucleotides plus glial-conditioned medium containing C-Ag12,0,0 None

Progesteronea

Media

Synapses Per cell

Per 10 ␮m length

MEM MEM MEM MEM MEM MEM MEM MEM

(⫺) (⫹) (⫺) (⫹) (⫺) (⫹) (⫺) (⫺)

25⫾3 60⫾5* 31⫾5 50⫾7* 20⫾6 17⫾2 62⫾4* 58⫾5*

3⫾0.4 5⫾0.8* 3⫾1 5⫾0.5* 2⫾0.9 2⫾0.5 6⫾0.7* 5⫾0.2*

N2 serum-free medium

(⫺)

85⫾5*

6⫾0.3*

Quantitative analysis of the number of synapses/cell (synaptophysin (⫹) puncta) and synaptic density (synaptophysin (⫹) puncta/10 ␮m of dendritic length) was performed using E18 hippocampal neurons kept in culture for 7 days (n⫽ 240 neurons per experimental condition). The numbers represent the mean⫾S.E.M. for three independent experiments. * Differs from controls (non-treated glia cultured in MEM), P⬍0.01. a The dose of progesterone used for these experiments was 6.3 ng/ml. b The dose of oligonucleotides used for these experiments was 50 ␮M.

more, it prevented the increase in agrin levels observed upon the addition of progesterone. Thus, no significant differences in the levels of agrin were detected in antisense-treated astrocytes cultured in the presence of progesterone when compared with the ones observed in antisense-treated astrocytes cultured in its absence. In both experimental conditions, agrin levels were significantly lower than in non-treated astrocytes (48⫾17%, 58⫾11%, vs. 100%, respectively). No increase in agrin levels was detected either when the content of this protein was determined in the culture medium in which antisense-treated astrocytes have been kept in the presence or absence of progesterone as compared with untreated controls (37⫾10% vs. 42⫾5% vs. 100%, respectively; n⫽3 independent experiments). It is worth mentioning that progesterone did induce an increase in agrin expression in agrin sense-treated astrocytes when compared with agrin sense-treated ones cultured in the absence of this hormone (140⫾9%, vs. 100%, respectively). We then analyzed the effect of progesterone on the number and/or the density of synaptic contacts in hippocampal neurons cocultured with agrin antisense-treated astrocytes. Quantitative analysis of the number of synaptophysin-positive puncta detected no differences in the number of synapses per cell or synaptic density under these experimental conditions (Table 1). On the other hand, a significant increase in both the number of synapses per cell and synaptic density was detected in hippocampal neurons co-cultured with agrin sense-treated astrocytes in the presence of progesterone when compared with the ones co-cultured with astrocytes treated with agrin sense oligonucleotides alone (Table 1). Effect of non-neuron specific agrin on synapse formation The experiments described above strongly suggested that glia-derived agrin could induce synapse formation in

cultured hippocampal neurons. To obtain more direct evidence of such an effect, we transfected astrocytes using a plasmid encoding the soluble C-terminal half of the rat agrin lacking any inserts in the Y and Z splicing sites (C-Ag 12,0,0). This isoform is not expressed in neurons. Coverslips containing 5 days in culture hippocampal neurons were placed facing down on a glia monolayer one day after the transfection. Two days later, hippocampal neurons co-cultured in the presence of transfected and non-transfected astrocytes were fixed and stained using synaptophysin and PSD-95 as synaptic markers. Quantitative analysis showed a significant increase in the number of synapses (⬃two-fold increase) and in synaptic density in hippocampal neurons co-cultured with C-Ag 12,0,0-overexpressing astrocytes as compared with the ones co-cultured with non-transfected astrocytes (Table 1). On the other hand, no differences in the number of synapses per cell or synaptic density were detected when neurons co-cultured with agrin-overexpressing astrocytes were compared with the ones co-cultured with non-transfected astrocytes maintained in N2 serum-free medium (Table 1). Furthermore, the medium conditioned by agrin-overexpressing astrocytes was able to restore the number of synapses per cell as well as synaptic density in hippocampal neurons co-cultured with agrin antisense-treated astrocytes for 72 h (Table 1).

DISCUSSION The results presented herein indicate that astrocyte-derived agrin could mediate, at least in part, the glia–neuron interactions underlying the establishment and/or maintenance of synaptic contacts in hippocampal neurons. In addition, they suggest that astrocytes might play a key role as a bridge between the endocrine and the nervous systems during synaptogenesis. Agrin is considered one of the most important molecular determinants in the formation of neuromuscular junctions. On the other hand, its potential role in the establish-

1336

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

ment of synaptic contacts between central neurons is not completely understood. Several lines of evidence have suggested that agrin is well-positioned to modulate synaptogenesis in the CNS. This evidence includes the pattern of expression of agrin in different brain areas. Studies using central neurons that develop either in situ or in culture detected the highest agrin levels during periods of active synapse formation. Thus, agrin was detected in the neuroepithelium of E15 rat embryos, the cortical plate of E18 ones, and in the neocortex, allocortices, amygdala and Purkinje cell layers at postnatal days 2 and 6. On the other hand, agrin levels were very low in adult brain (Cohen et al., 1997). This pattern of expression was replicated by hippocampal neurons that developed in culture (Ferreira, 1999). Under these experimental conditions, agrin levels peaked 7 days after plating and declined thereafter (Ferreira, 1999). The potential role of agrin during synapse formation was further supported by functional studies. For example, agrin depletion by means of antisense oligonucleotides resulted in the formation of fewer synaptic contacts among hippocampal neurons (Ferreira, 1999; Bose et al., 2000; Mantych and Ferreira, 2001). Conversely, recombinant agrin induced synapse formation in both cultured hippocampal neurons and cultured sympathetic neurons (Gingras et al., 2002; Mantych and Ferreira, 2001). Our results showing a correlation between agrin expression in astrocytes and the number of synapses formed by hippocampal neurons cultured in their presence provide further insights into the role of agrin in synaptogenesis in central neurons. Furthermore, they provide evidence of a non-neuronal source of agrin with modulatory functions on synapse formation and/or synapse maintenance in hippocampal neurons. The possibility of a non-neuronal agrin isoform (Z (⫺) isoform) capable of inducing synapse formation in the CNS first emerged from the comparison of the agrin-null phenotype obtained by means of antisense oligonucleotides and by homologous recombinant techniques (Ferreira, 1999; Serpinskaya et al., 1999). These studies showed that the acute suppression of the expression of all agrin isoforms achieved using antisense oligonucleotides resulted in a significant decrease in the number of synapses formed between hippocampal neurons (Ferreira, 1999; Bose et al., 2000). This phenotype contrasted with the one obtained when synapse formation was analyzed in cultured hippocampal neurons obtained from agrin mutant mice. In these mutant mice, the neuronspecific agrin isoform was ablated completely but the nonneuron specific agrin isoforms were still present, albeit at only 10% relative to control level. However, no changes in the time course or the extent of synapse formation were detected in mutant neurons when compared with their wild type counterparts (Gautam et al., 1996; Li et al., 1999; Serpinskaya et al., 1999). In addition, electrophysiological analysis demonstrated that the synapses formed by cortical neurons obtained from these mutant mice were functional (Li et al., 1999). Our results showing that agrin could be synthesized by astrocytes provided a possible explanation for the apparent discrepancy in these results, especially, in view of the experimental design used in the stud-

ies using hippocampal neurons obtained from agrin mutant mice (Serpinskaya et al., 1999). In that study, hippocampal neurons obtained from the mutant mice were grown on a monolayer of wild type rat astrocytes. These astrocytes expressed, and most likely released, the non-neuron specific agrin isoforms capable of inducing synapse formation according to the findings included in the present report. Taken collectively, our data suggest that glia-derived agrin might compensate for the loss of neuron-specific agrin and could, at least to a certain extent, sustain synapse formation and/or synapse maintenance in central neurons. Agrin could work in concert with other proteins released by glial cells to regulate synapse formation in central neurons. Some of those proteins have been recently identified. For example, cholesterol complexed with apolipoprotein E-containing lipoproteins (secreted by astrocytes) enhanced synapse formation in retinal ganglion cells (Mauch et al., 2001). Interestingly, a recent study has shown that thrombospondin also induces the ultrastructural differentiation of pre-and post-synaptic specialization. However, these postsynaptic specializations are functionally silent. These authors suggested that an unidentified protein could then be responsible for the insertion and clustering of AMPA receptors at the synaptic sites. Astrocyte-derived agrin might mediate such a functional change. If that were the case, it would suggest that the non-neuronal specific agrin isoforms could have a more direct effect as organizers of the postsynaptic element in interneuronal synapses than at the neuromuscular junction where they are unable to induce the clustering of acetylcholine receptors. This hypothesis seems to be supported by data showing that both neuronal and non-neuronal specific agrin isoforms are able to induce the activation of the same signaling pathways in central neurons (Hilgenberg and Smith, 2004). However, more direct evidence will be required to determine whether agrin does induce the clustering of neurotransmitter receptors in central neurons and whether both isoforms are equally able to induce this effect. Our results obtained using a co-culture system in which neurons and glia were in close proximity but not in contact suggested that agrin could induce synapse formation acting as a diffusible factor. However, we cannot rule out the possibility that agrin could also mediate synapse formation as a membrane-bound factor or a short-range diffusible factor in situ. The role of such factors on synapse formation has recently been demonstrated in co-cultures of hippocampal neurons and astrocytes in which these cell types were in contact (Hama et al., 2004). It is worth mentioning that these two distinct mechanisms by which agrin could regulate interneuronal synapse formation could depend on the expression of both the transmembrane and secreted forms of agrin, isoforms that are enriched in the brain (Burgess et al., 2000; Neumann et al., 2001; Gingras and Ferns, 2002). Either as a membrane-bound or as a diffusible factor, agrin should bind to its receptor(s) to trigger the signal transduction pathway(s) that could lead to synapse formation and/or maintenance in hippocampal neurons. A tyrosine kinase receptor, the muscle specific kinase (MuSK), me-

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

diates the aggregation of the acetylcholine receptors induced by agrin at the neuromuscular junction (Glass et al., 1996). The agrin receptor in central neurons, on the other hand, has yet to be identified. However, recent evidence indicates that agrin could activate also a tyrosine kinase receptor in the CNS (Hilgenberg et al., 1999; Hilgenberg and Smith, 2004). A significant activation of the MAPK signal transduction pathway followed by an increase in the expression of the microtubule-associated proteins and cfos was detected when cultured cortical and hippocampal neurons were grown in the presence of agrin (Hilgenberg et al., 1999; Mantych and Ferreira, 2001; Karasewski and Ferreira, 2003; Hilgenberg and Smith, 2004). These effects were prevented in the presence of inhibitors that block tyrosine kinase phosphorylation (Hilgenberg et al., 1999, Ferreira and Karawseski, unpublished observations). Further studies will be required to identify the agrin receptor in the CNS and to completely decipher the molecular mechanisms by which astrocyte-derived agrin enhances synapse formation and/or maintenance in hippocampal neurons. Regardless of the nature of such mechanisms, our results provide the first evidence suggesting that agrin expression in astrocytes could be regulated by progesterone. Hormonal effects on glia might have important consequences in neuronal development by modulating both differentiation and gene expression in different brain areas. In the last decade, several studies have addressed the responsiveness of astrocytes to steroids in the mammalian brain (Ghoumari et al., 2003; Melcangi et al., 1996; Mong and McCarthy, 1999; Sauvageot and Stiles, 2002). These studies suggest that astrocytes respond to testosterone, estrogen, and/or progesterone in different brain areas including the hypothalamic arcuate nucleus and the hippocampus. The astrocytic response to systemically produced steroids and/or locally synthesized steroids or “neurosteroids” varies from changes in cell morphology to changes in the expression of different proteins. For example, estrogen induced an increase in the area covered by astrocytes in the arcuate nucleus. This increased size was accompanied by an enhanced synthesis of glial fibrillary acid protein (GFAP). Hippocampal astrocytes also responded to changes in the hormonal milieu through morphological changes and synthesis of proteins (reviewed by Mong and McCarthy, 1999). Less is known about the response of astrocytes to progesterone. However, a recent report indicated that progesterone also modulates protein synthesis in central astrocytes (Melcangi et al., 1996). Thus, progesterone significantly increased the synthesis of both GFAP in astrocytes obtained from the rat cortex and myelin basic protein in organotypic slice cultures of rat cerebellum (Ghoumari et al., 2003). Our results provide evidence of a non-structural protein (i.e. agrin) whose expression in astrocytes is also induced by progesterone. Furthermore, the data presented in this study suggest that, through the regulation of agrin expression, progesterone could regulate synapse formation in the CNS. Together, these results suggest that glia might play a significant role in linking the endocrine and nervous sys-

1337

tems during synapse formation in central neurons. Further studies would provide insights into the variety of molecular mechanisms underlying such a role of glia both in vivo and in culture conditions. Acknowledgments—We wish to thank Dr. Martin Smith (University of California, Irvine) for the generous gift of the agrin construct used in this study. This work was supported by NIH grant NS046834 to A.F.

REFERENCES Black L, Berenbaum MC (1964) Factors affecting the dye exclusion test for cell viability. Exp Cell Res 35:9 –13. Bose CM, Qui D, Bergamaski A, Gravante B, Bossi M, Villa A, Rupp F, Malgaroli A (2000) Agrin controls synaptic differentiation in hippocampal neurons. J Neurosci 20:9086 –9095. Bottenstein JE, Sato GH (1979) Growth of a rat neuroblastoma cell line in serum-free supplemented media. Proc Natl Acad Sci U S A 76:514 –517. Bowe MA, Fallon JR (1995) The role of agrin in synapse formation. Annu Rev Neurosci 18:443– 462. Burgess RW, Skarnes WC, Sanes JR (2000) Agrin isoforms with distinct amino termini. Differential expression, localization, and function. J Cell Biol 151:41–52. Caceres A, Binder LI, Payne M, Bender P, Rebhum LI, Steward O (1984) Differential subcellular localization of tubulin and the microtubule associated protein MAP-2 in brain tissue as revealed by immunocytochemistry with hybridoma monoclonal antibodies. J Neurosci 4:394 – 410. Christopherson KS, Ullian EM, Stokes CCA, Mullowney CE, Hell JW, Agah A, Lawler J, Mosher DF, Bornstein P, Barres BA (2005) Thrombospondins are astrocyte-secreted proteins that promote CNS synaptogenesis. Cell 120:421– 433. Cohen NA, Kaufmann WE, Worley PH, Rupp F (1997) Expression of agrin in the developing and adult rat brain. Neuroscience 76: 581–596. Deyst KA, McKechnie BA, Fallon JR (1998) The role of alternative splicing in regulating agrin binding to muscle cells. Dev Brain Res 110:185–191. Ferns MJ, Campanelli JT, Hoch W, Scheller RH, Hall Z (1993) The ability of agrin to cluster AChRs depends on alternative splicing and on cell surface proteoglycans. Neuron 11:491–502. Ferreira A (1999) Abnormal synapse formation in agrin depleted hippocampal neurons. J Cell Sci 112:4729 – 4738. Ferreira A, Loomis PA (1998) Isolation and culture of primary neural cells. In: Cells: A laboratory manual (Spector D, Goldman R, Leinwand L, eds), pp 9.1-9. Woodbury, NY: Cold Spring Harbor Laboratory Press. Ferreira A, Busciglio J, Caceres A (1989) Microtubule formation and neurite growth in cerebellar macroneurons which develop in vitro: Evidence for the involvement of the microtubule-associated proteins MAP-1a, HMW-MAP-2 and tau. Dev Brain Res 49:215–228. Ferreira A, Han H-Q, Greengard P, Kosik KS (1995) Suppression of synapsin II inhibits the formation and maintenance of synapses in hippocampal culture. Proc Natl Acad Sci U S A 92:9225–9229. Fletcher TL, Cameron P, DeCamilli P, Banker GA (1991) The distribution of synapsin I and synaptophysin in hippocampal neurons in culture. J Neurosci 11:1617–1626. Gautam M, Noakes PG, Moscoso L, Rupp F, Scheller RH, Merlie JP, Sanes JR (1996) Defective neuromuscular synaptogenesis in agrin-deficient mutant mice. Cell 85:525–535. Ghoumari AM, Ibanez C, El-Etr M, Leclerc P, Eychene B, O’Malley BW, Schumacher M (2003) Progesterone and its metabolites increase myelin basic protein expression in organotypic slice cultures of rat cerebellum. J Neurochem 86:848 – 859. Gingras J, Ferns M (2002) Expression and localization of agrin during sympathetic synapse formation in vitro. J Neurobiol 48:228 –242.

1338

C. E. Tournell et al. / Neuroscience 141 (2006) 1327–1338

Gingras J, Rassadi S, Cooper E, Ferns M (2002) Agrin plays an organizing role in the formation of sympathetic synapses. J Cell Biol 158:1109 –1118. Glass DJ, Yancopoulos GD (1997) Sequential roles of agrin, MuSK and rapsyn during neuromuscular junction formation. Curr Opin Neurobiol 7:379 –384. Glass DJ, Bowen DC, Sitti TN, Radziejewski C, Bruno J, Ryan TE, Gies DR, Shah S, Mattsson K, Budern SJ, DiStefano PS, Valenzuela DM, DeChiara TM, Yancopoulos GD (1996) Agrin acts via a MuSK receptor complex. Cell 85:513–523. Godfrey EW (1991) Comparison of agrin-like proteins from the extracellular matrix of chicken kidney and muscle with neural agrin, a synapse organizing protein. Exp Cell Res 195:99 –109. Godfrey EW, Dietz ME, Morstad AL, Wallskog PA, Yorde DE (1988) Acetylcholine receptor-aggregating proteins are associated with the extracellular matrix of many tissues in Torpedo. J Cell Biol 106:1263–1272. Goslin K, Banker G (1991) Rat hippocampal neurons in low-density culture. In: Culturing nerve cells (Banker G, Goslin K, eds), pp 251–283. Cambridge, MA: MIT Press. Hama H, Hara C, Yamaguchi K, Miyawaki A (2004) PKC signaling mediates global enhancement of excitatory synaptogenesis in neurons triggered by local contact with astrocytes. Neuron 41:405–qj415. Haydon PG (2001) Glia: listening and talking. Nat Rev Neurosci 2:185–193. Hilgenberg LGW, Smith M (2004) Agrin signaling in cortical neurons is mediated by a tyrosine kinase-dependent increase in intracellular Ca2⫹ that engages both CaMKII and MAPK signal pathways. J Neurobiol 61:289 –300. Hilgenberg LGW, Hooever CL, Smith MA (1999) Evidence of an agrin receptor in cortical neurons. J Neurosci 17:7384 –7393. Hoch W, Ferns M, Campanelli JT, Hall ZW, Scheller RH (1993) Developmental regulation of highly active alternatively spliced forms of agrin. Neuron 11:479 – 490. Hoch W, Campanelli JT, Harrison S, Scheller RH (1994) Structural domains of agrin required for clustering of nicotinic acetylcholine receptors. EMBO J 13:2814 –2821. Holgado A, Ferreira A (2000) Synapse formation proceeds independently of dendritic elongation in cultured hippocampal neurons. J Neurobiol 43:121–131. Ilse Raats CJ, van den Born J, Bakker M, Oppers-Walgreen B, Pisa B, Dijkman H, Assmann K, Berden J (2000) Expression of agrin, dystroglycan, and utrophin in normal renal tissue and in experimental glomerulopathies. Am J Pathol 156:1749 –1765. Ji R, Bose C, Lesuisse C, Qui D, Huang C, Zhang Q, Rupp F (1998) Specific agrin isoforms induce cAMP response element binding protein phosphorylation in hippocampal neurons. J Neurosci 18: 9695–9702. Jung-Testas I, Renoir M, Bugnard H, Greene GL, Baulieu EE (1992) Demonstration of steroid hormone receptors and steroid action in primary cultures of rat glial cells. J Steroid Biochem Mol Biol 41:621–631. Jung-Testas I, Baulieu EE (1998) Steroid hormone receptors and steroid action in rat glial cells of the central and peripheral nervous system. J Steroid Biochem Mol Biol 65:243–251. Karasewski L, Ferreira A (2003) The MAPK signal transduction pathway mediates agrin effects on neurite elongation in cultured hippocampal neurons. J Neurobiol 55:14 –24. Kato J, Hirata S, Nozawa A, Yamada-Mouri N (1994) Gene expression of progesterone receptors isoforms in the rat brain. Horm Behav 28:454 – 463. Kroger S, Horton SE, Honig LS (1996) The developing avian retina expresses agrin isoforms during synaptogenesis. J Neurobiol 29:165–182.

Laemmli UK (1970) Cleavage of structural protein during the assembly of the head of the bacteriophage T4. Nature 227:680 – 685. Li Z, Hilgenberg LG, O’Dowd DK, Smith M (1999) Formation of functional synaptic connections between cultured cortical neurons from agrin-deficient mice. J Neurobiol 39:547–557. Magill-Solc C, McMahan UJ (1988) Motor neurons contain agrin-like molecules. J Cell Biol 107:1825–1833. Mann S, Kroger S (1996) Agrin is synthesized by retinal cells and colocalizes with gephyrin. Mol Cell Neurosci 8:1–13. Mantych K, Ferreira A (2001) Agrin differentially regulates the rates of axonal and dendritic elongation in cultured hippocampal neurons. J Neurosci 21:6802– 6809. Mauch DH, Nagler K, Schumacher S, Goritz C, Muller E-V, Otto A, Pfrieger FW (2001) CNS synaptogenesis promoter by glia-derived cholesterol. Science 294:1354 –1357. McMahan UJ (1990) The agrin hypothesis. Cold Spring Harbor Symp Quant Biol 55:407– 418. Melcangi RC, Riva MA, Fumagalli F, Magnaghi V, Racagni G, Martini L (1996) Effect of progesterone, testosterone, and their 5 ␣-reduced metabolites on GFAP gene expression in type 1 astrocytes. Brain Res 711:10 –15. Mong JA, McCarthy MM (1999) Steroid-induced developmental plasticity in hypothalamic astrocytes: implications for synaptic patterning. J Neurobiol 40:602– 619. Neumann FR, Bittcher G, Annies M, Schumacher B, Kroger S, Ruegg M (2001) An alternative amino-terminus expressed in the central nervous system converts agrin to a type II transmembrane protein. Mol Cell Neurosci 17:208 –225. O’Toole JJ, Deyst KA, Bowe MA, Nastuk MA, McKechnie BA, Fallon JR (1996) Alternative splicing of agrin regulates its binding to heparin alpha-dystroglycan, and the cell surface. Proc Natl Acad Sci U S A 93:7369 –9374. Paganoni S, Ferreira A (2005) Neurite extension in central neurons: a novel role for the tyrosine kinase receptors Ror1 and Ror2. J Cell Sci 118:433– 446. Pfrieger FW, Barres BA (1996) New views on synapse-glia interactions. Curr Opin Neurobiol 6:615– 621. Ruegg MA, Tsim KW, Horton SE, Kroger S, Escher G, Gensch EM, McMahan UJ (1992) The agrin gene codes for a family of basal lamina protein differ in function and distribution. Neuron 8:691–699. Ruegg MA, Bixby JL (1998) Agrin orchestrates synaptic differentiation at the vertebrate neuromuscular junction. Trends Neurosci 21:22–27. Rupp F, Payan DG, Magill-Solc C, Cowan DM, Scheller RH (1991) Structure and expression of rat agrin. Neuron 6:811– 823. Rupp F, Ozcelik TH, Linial M, Peterson K, Francke U, Scheller RH (1992) Structure and chromosomal localization of the mammalian agrin gene. J Neurosci 12:3535–3544. Sakamoto H, Ukena K, Tsutsui K (2001) Effects of progesterone synthesized de novo in the developing Purkinje cell on its dendritic growth and synaptogenesis. J Neurosci 21:6221– 6232. Sanes JR (1997) Genetic analysis of postsynaptic differentiation at the vertebrate neuromuscular junction. Curr Opin Neurobiol 7:93–100. Sauvageot CM, Stiles CD (2002) Molecular mechanisms controlling cortical gliogenesis. Curr Opin Neurobiol 12:244 –249. Serpinskaya AS, Feng G, Sanes JR, Craig AM (1999) Synapse formation by hippocampal neurons from agrin-deficient mice. Dev Biol 205:65–78. Slezak M, Pfrieger FW (2003) New roles for astrocytes: Regulation of CNS synaptogenesis. Trends Neurosci 25:531–535. Stone D, Nikolics K (1995) Tissue- and age-specific expression patterns of alternatively spliced agrin mRNA transcripts in embryonic rat suggest novel developmental roles. J Neurosci 15:6767– 6778. Towbin H, Staehelein T, Gordon J (1979) Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76:4354–4356.

(Accepted 4 May 2006) (Available online 13 June 2006)