Progesterone receptor isoform B in the human Fallopian tube and endometrium following mifepristone

Contraception 67 (2003) 319 –326

Original research article

Progesterone receptor isoform B in the human Fallopian tube and endometrium following mifepristone Xiaoxi Sun, Alexander Christow, Lena Marions, Kristina Gemzell-Danielsson* Department of Woman and Child Health, Division for Obstetrics and Gynecology, Karolinska Hospital/Institute, S-171 76 Stockholm, Sweden Received 10 September 2002; received in revised form 12 November 2002; accepted 18 November 2002

Abstract The distribution of progesterone receptor isoform B may have important clinical significance. The aim of this study was to compare the expression, localization and regulation of progesterone receptor isoform B in the human Fallopian tube and endometrium following mifepristone in a dose effective for contraception. Fertile women were treated with a single dose of 200 mg mifepristone on day luteinizing hormone (LH)⫹2. Biopsies were obtained from the Fallopian tube on day LH⫹4 to LH⫹6 and from the endometrium on day LH⫹6 to LH⫹8. Progesterone receptor isoform B expression was analyzed by immunohistochemistry and reverse transcriptase polymerase chain reaction. Treatment with mifepristone increased progesterone receptor isoform B concentration in epithelial and stromal cells in the Fallopian tube and also increased progesterone receptor isoform B concentration in the glandular cells of the endometrium. These results further support the hypothesis that the contraceptive effect of mifepristone when given postovulatory is primarily due to alteration of the peri-implantation milieu influencing endometrial receptivity. © 2003 Elsevier Science Inc. All rights reserved. Keywords: Progesterone receptor isoform B; Human Fallopian tube; Endometrium; Mifepristone; Contraception

1. Introduction Progesterone is an essential regulator of female reproductive functions associated with the establishment and maintenance of pregnancy, including ovulation and uterine endometrial development. The physiological effects of progesterone are mediated by interaction with progesterone receptors (PR). PR have been found both in the human endometrium and Fallopian tube [1]. The number of receptors varies as a consequence of the menstrual cycle [2,3]. The cyclic changes in both hormone and receptor levels are critical in determining the functional state of the human endometrium and could also be expected to be critical for tubal function like capacitation of sperm and tubal transport [4]. The human PR is composed of two isoforms, PR-A (94 kDa) and PR-B (116 kDa) [5,6]. PR-A is a truncated form of PR-B lacking 164 amino acids from the N-terminus. Both isoforms are products of a single gene and are translated from individual messenger ribonucleid acid species under * Corresponding author. Tel: ⫹46-8-517-721-28; fax: ⫹46-8-517-74314. E-mail address: [email protected] (K. Gemzell-Danielsson).

the control of distinct promoters [7]. Antibodies have been generated to the unique portion of PR-B and are therefore specific for that isoform. Since there is no part of PR-A which is unique, no specific PR-A antibody is available [8]. Both PR-A and PR-B function as ligand-activated transcription factors, but the selective physiological roles of the two isoforms of PR are predicted to differ based on different structural and functional properties of the individual proteins observed using in vitro assay systems [9,10]. In general, PR-B is transcriptionally the more active of the two isoforms. Furthermore, PR-A can act as a dominant repressor of PR-B activation of progestin-sensitive reporter genes [11], and similarly inhibits the transcriptional activity of receptors for androgens, glucocorticoids and mineralocorticoids [12]. Mifepristone is a potent antiprogestin that blocks progesterone action at the receptor level [13]. The effect depends on the stage of the menstrual cycle and the dose given. We have previously shown that once-monthly administration of 200 mg mifepristone on day luteinizing hormone (LH)⫹2 is a highly effective contraceptive method [14]. Although mifepristone given postovulatory has been shown to be effective for contraception, the precise mechanism of action if still poorly understood. A better understanding of the

0010-7824/03/$ – see front matter © 2003 Elsevier Science Inc. All rights reserved. doi:10.1016/S0010-7824(02)00513-9

320

X. Sun et al. / Contraception 67 (2003) 319 –326

mechanisms of action of mifepristone, when used for contraception, is important for further development and for optimizing the use of the regimen. We have previously studied the effect of mifepristone on PR in the Fallopian tube and endometrium [15,16]. However, there is no previous data on PR isoform expression in the human oviduct following mifepristone. The aim of the present study was to investigate the localization and evaluate the expression of PR-B in different parts of the human Fallopian tube and in the endometrium after treatment with mifepristone immediately after ovulation.

sion of PR-B in the tubal and endometrial biopsies was analyzed by immunohistochemistry and PR-B mRNA by reverse transcriptase-polymerase chain reaction (RT-PCR). 2.1. Hormone determination Daily morning urine samples were analyzed for estroneand pregnandiol-glucuronides and LH using enzyme immunoassay (EIA) [17]. The hormones were expressed in nmol per mmol creatinine for estrone- and pregnandiol-glucuronide and mIU per mmol creatinine for LH [18]. For creatinine analysis, a commercial kit (Sigma Diagnostics, St Louis, MO, USA) was used.

2. Materials and methods 2.2. Immunohistochemistry The study includes 21 women (26 – 45 years) with regular menstrual cycles (24 –35 days interval) and proven fertility. None of the women had been treated with any hormonal contraceptives for a period of at least 3 months prior to the study. Approval from the ethics committee was obtained for each part of the study, and all women provided written informed consent. For the studies on the Fallopian tube, 14 women were recruited among women admitted to the hospital for sterilization by laparoscopic technique and using a plastic ring (Lay; Instrumenta AB, Stockholm, Sweden). With this technique, an elastic plastic ring is put over a loop of the tube that in this way will be blocked. Following inclusion, the participants were randomly allocated to control (n ⫽ 7) or treatment (n ⫽ 7) groups using sealed envelopes. Women allocated to the treatment group obtained a single dose of 200 mg mifepristone immediately after ovulation (day LH⫹2). Surgery was performed on day LH⫹4 to LH⫹6 in both the control and treatment groups, i.e., approximately the time for the embryo, when still in the Fallopian tube, to reach the morula to blastocyst transitional stage. At surgery, the loop of the Fallopian tube contained in the plastic ring was excised leaving two open ends of the tube. The biopsy from the right side was taken from the isthmical part of the tube, while on the left side the biopsy was taken from the distal, ampullar part of the tube. Seven healthy, women with proven fertility volunteered for endometrial biopsies. The women served as their own controls and were followed for control and treatment cycles. An endometrial biopsy was obtained from the uterine fundus, using a Randall curette, in the mid-luted phase (LH⫹6 to ⫹8), i.e., the expected time for endometrial receptivity and implantation. During the treatment cycles, the subjects received a single dose of 200 mg mifepristone on day LH⫹2. The day of the LH peak was estimated by Clear Plan (Searle Unipath, Bedford, UK) measurement in urine twice daily from day 10 to the day of the LH peak, performed by the women themselves. In addition, all patients collected daily morning urine samples during the cycle for analyses of estrone- and pregnandiol-glucuronide and LH. The expres-

Each biopsy was immediately frozen and stored in liquid nitrogen and was later sectioned to 9 ␮m using a ReichertJung Cryocut 1800 (Cambridge Instruments GmbH, Nussloch, Germany). The sections were placed on glass slides and immersed in 100% methanol for 30 s, and acetone for 3 min to complete the fixation. Thereafter, the mounted sections were wrapped in parafilm and stored at ⫺70°C. A standard immunohistochemical technique (avidin-biotin-peroxidase) was used to visualize PR-B immunostaining intensity and distribution. A mouse antihuman antibody was used for detection of PR-B (Affinity Bioreagents Co., Golden, CO, USA) that is known to react with high affinity to the B form of human PR. After rinsing with phosphatebuffered saline (PBS), endogenous peroxidases were quenched with incubation in 0.3% H2O2 in MeOH for 30 min. Repeated rinses with 0.05% bovine serum albumin in PBS were performed. The slides were then exposed to nonimmunoblock using 1.5% normal horse serum in a humidified chamber for 30 min at room temperature. The primary antibody against PR-B (1:200) was placed on sections and incubated at 4°C overnight. Slides were washed in PBS three times for 5 min. The secondary antibody, consisting of biotinylated, horse antimouse antibody (1:300; Vector Laboratories Inc., Burlingame, CA, USA), was then placed on the cryosections and incubated for 30 min at room temperature followed by two further washes with PBS. Avidin-biotin-peroxidase complex (Vector Laboratories Inc.) was added to the sections for 45 min before adding 3,3⬘-diaminobenzidine in H2O2 (Vector Laboratories Inc.). After rinsing with distilled water, the sections were counterstained with hematoxylin and mounted. Negative controls were incubated similarly, but PBS replaced the primary antibody. To check for primary antibody specificity, the primary antibody was replaced with nonimmunoserum of equivalent concentration from the same species (mouse IgG1; DAKO, Glostrup, Denmark). Immunohistochemical staining was evaluated blindly by three independent persons, using a Zeiss light microscope at ⫻200 magnification. The staining intensity was graded on a scale of 0 ⫽ 0% stained cells, 1 ⫽ weak (⬍25% stained

X. Sun et al. / Contraception 67 (2003) 319 –326

321

Table 1 Position and sequence of synthesized oligonucleotides used for PCR amplifications of PR-B and GADPH Gene

Sense primers

Sequence

Antisense primers

Sequence

Product size (bp)

PR-B GADPH

248–267 152–175

GAGGGGGCAGTGGAACTCAG CCACCCATGGCAAATTCCATGGCA

522–541 726–749

AGGGGAACTGTGGCTGTCGT TCTAGACGGCAGGTCAGGTCCACC

293 598

cells), 2 ⫽ moderate (25–50% stained cells), 3 ⫽ strong (50 –75% stained cells) and 4 ⫽ very strong (⬎75% stained cells).

compared it with published PR-B sequences (BLAST similarity search; http://www.ncbi.nlm.nih.gov). We found 100% homology with the published PR-B sequences.

2.3. RNA isolation and RT-PCR

2.4. Statistics

Total tissue RNA was isolated by using ULTRASPECRNA Isolation system (Biotech Laboratories, Inc., Houston, TX, USA) according to protocols provided by the manufacturer. Two micrograms of total RNA was reverse-transcribed by using the First-strand cDNA synthesis Kit (Pharmacia Biotech AB, Uppsala, Sweden). For cDNA amplification, 1 ␮g cDNA was amplified in a volume of 25 ␮L, containing 10 ⫻ PCR buffer (100 mM Tris-HCl, pH 8.4, 500 mM KCl), 1.5 mM MgCl2, 200 ␮M of each deoxynucleotide, 0.4 ␮M of each primer and 2.5 IU Tag DNA polymerase. The primer sequences for PR-B and GADPH are given in Table 1. The amplifications were performed in the following steps: for PR-B, 92°C for 1 min, annealing at 65°C for 45 s, and extension at 72°C for 1 min. For GADPH, 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 1 min. The optimal PCR cycle number for each message was chosen to yield product levels at the linear portion of the serial dilution curve (curves not shown). Thus, 26 cycles for PR-B, 28 cycles for GADPH were chosen. The PCR products were electrophoresed through a 1.5% agarose gel and visualized with ethidium bromide. A 100base pair ladder (Pharmacia Biotech AB) was used as a DNA standard for each gel. All PCR conditions were optimized for quantification of relative message contents with respect to GADPH product levels. The bands were scanned for measurements of integrated optical density using Scion Image version 1.62 (Wayne Rasband, National Institutes of Health, Bethesda, MD, USA). The arbitrary densitometric level of signals was determined for each band. The relative mRNA amounts of PR-B were expressed as a ratio of specific mRNA to GADPH mRNA. To exclude the possibility of amplification of contaminating genomic DNA, PCR procedures were carried out directly in RNA samples (i.e., without RT) using each primer set. A negative control reaction in which no RNA or cDNA template was added was included in each experiment. To ensure that we amplified an PR-B cDNA-specific fragment, we sequenced the amplified PR-B product and

Differences in urinary hormone concentrations between the control and treatment cycles were analyzed using the Student’s t-test. The Mann-Whitney U or the Wilcoxon signed ranks tests were used when appropriate, for evaluating differences in PR-B levels between the control and treatment groups in the Fallopian tube and endometrium, respectively. PR-B mRNA levels were presented as a mean ⫾ SE. Data were analyzed by Fisher’s exact test. P-values ⬍0.05 was considered as statistically significant.

3. Results All women showed a normal, ovulatory cycle with a mid-cycle urinary LH peak and normal luteal phase estroneand pregnandiol-glucuronide levels (data not shown). No significant changes occurred in cycle length, bleeding pattern or in hormonal profiles following treatment (data not shown). There was a good correlation (less than 1 day difference) between the preliminary dating of the LH peak based on Clear Plan measurement and the hormonal levels in urine determined by EIA. 3.1. Immunohistochemical expression of PR-B in the Fallopian tubes Immunohistochemical staining for PR-B was present in the nuclei of cells in stromal and epithelial cells. No staining could be observed in the perivascular cells. No significant differences in spatial expression of PR-B in the control group could be demonstrated, i.e., the PR-B concentration in epithelial and stromal cells did not differ significantly between the ampullar and isthmical part of the Fallopian tube. After treatment with mifepristone, there was a significantly increased immunoreactivity in the epithelial (p ⬍ 0.05) and stromal (p ⬍ 0.01) cells when compared to the control group. The increase was evident in both the isthmical part (p ⬍ 0.05) and ampullar part (p ⬍ 0.01) (Table 2, Fig. 1).

322

X. Sun et al. / Contraception 67 (2003) 319 –326

Table 2 The expression of PR-B in the Fallopian tube in control and after treatment with mifepristone Location

Epithelium Stroma Total

Control (n ⫽ 7)

Mifepristone (n ⫽ 7)

Isthmical

Ampullar

Total

Isthmical

Ampullar

Total

1.0 (0–3) 1.0 (0–4) 1.0 (0–4)

1.0 (0–3) 2.0 (0–3) 1.0 (0–3)

1.0 (0–3) 1.5 (0–4) 1.0 (0–4)

2.0 (0–4) 4.0 (2–4) 2.5 (0–4)*

3.0 (1–4) 4.0 (1–4) 3.5 (1–4)**

3.0 (0–4)* 4.0 (1–4)** 3.0 (0–4)**

Values are median and (range). * p ⬍ 0.05, **p ⬍ 0.01.

Fig. 1. The expression of progesterone receptor isoform B (PR-B) in human Fallopian tubes and endometrium in controls and after treatment with mifepristone using immunohistochemical staining (A–F). (A) Isthmic region in control sample; (B) ampullar region of control sample; (C) isthmic region after treatment with mifepristone; (D) ampullar region after treatment with mifepristone; (E) control sample from endometrium; (F) endometrium after treatment with mifepristone. Magnification: ⫻200; Scale bar ⫽ 100 ␮m.

X. Sun et al. / Contraception 67 (2003) 319 –326 Table 3 The expression of PR-B in human endometrium in control and after treatment with mifepristone Location

Control (n ⫽ 7)

Mifepristone (n ⫽ 7)

Glandular cells Stromal cells Total

1.0 (0–3) 2.0 (1–3) 2.0 (0–3)

4.0 (0–4)* 3.0 (2–4) 4.0 (0–4)**

Values are median and (range). * p ⬍ 0.05, **p ⬍ 0.01.

3.2. Immunohistochemical localization of PR-B in the endometrium A significant increase in PR-B was found in the glandular cells but not in the stromal cells after treatment with mifepristone (p ⬍ 0.05) (Table 3, Fig. 1). 3.3. Effect of mifepristone and levonorgestrel on expression of PR-B mRNA in the human Fallopian tube and endometrium Following treatment with mifepristone, a significant increase in PR-B mRNA level was found in both isthmical and ampullar regions (p ⬍ 0.05, total compared to control: p ⬍ 0.01) (Figs. 2 and 3). Compared with the control group, a significant increase in PR-B mRNA level was found in the endometrium after treatment with mifepristone (p ⬍ 0.05) (Figs. 4 and 5).

4. Discussion In the present study, the regulation and expression of the PR isoform B in the human Fallopian tube and endometrium was investigated at the expected time of blastocyst development and implantation. Successful implantation depends on a synchronous development of the endometrium and the blastocyst. Even a minor discrepancy may prevent implan-

323

tation [19]. Regulation of PR-B seems to be closely connected to the onset of endometrial receptivity. Pinopodes have been suggested to be an ultrastructural marker of receptivity but the function in humans remains largely unknown. Recently, it was shown that down-regulation of PR-B occurs at the onset of pinopod formation in the human endometrium [20]. However, reports on variation in the expression of PR-B in human endometrium during the menstrual cycle are not conclusive. Using immunofluorescent histochemistry, Mote and coworkers [21] reported that PR-B expression increased during the proliferate phase and reached the highest expression during the late proliferative phase. In the mid-secretory phase, PR-B was the predominant isoform expressed in most glands [21]. Wang and colleagues [22] demonstrated with immunohistochemistry that PR-B was present in glands and stroma in the proliferative phase, and was dramatically reduced in the glands during the secretory phase. Scores for PR-B immunostaining in stromal cells were slightly higher than that in glandular cells. Our results on PR-B expression in the endometrium of the control group are consistent with the latter findings. The conflicting reports on PR-B expression may be explained in part by different PR isoform antibodies, which have different affinity capability and characteristics, and especially by the fact that it is not possible to raise antibodies specific to PR-A. Thus, all immunohistochemical analysis of PR-A is by subtractive inference. To directly compare mRNA levels between PR-A⫹B and PR-B is also inconclusive since the optimal PCR cycle numbers differ between the two compounds. In the present paper, we, therefore, chose to look exclusively at expression and regulation of PR-B. Considerable progress has been made in elucidating the mechanism of action of antiprogestins. In vivo treatment with mifepristone results in a major influence on endometrial differentiation. Its inhibitory effect on the development and function of the endometrium by interfering with the PR has been demonstrated by our previous studies [23,24]. Previously, we also demonstrated a spatial expression of PR

Fig. 2. Representative samples showing the expression of PR mRNA analyzed by RT-PCR in Fallopian tube in control and after treatment with mifepristone (1– 4). (M) DNA marker. (1) Isthmic region of control sample; (2) ampullar region of control sample; (3) isthmic region after treatment with mifepristone; (4) ampullar region after treatment with mifepristone.

324

X. Sun et al. / Contraception 67 (2003) 319 –326

Fig. 3. The relative mRNA amounts of PR-B in controls (n ⫽ 5) and after treatment with mifepristone (n ⫽ 5) in Fallopian tube (isthmic and ampullar regions). Values are mean ⫾ SEM. **Significantly (p ⬍ 0.01) greater compared with controls.

in the human Fallopian tube [15]. Mifepristone has been shown to exert differential effects on endometrial epithelial and stromal cells and tissue-dependent differences between the endometrium and the Fallopian tube in primates has been demonstrated [25]. Interestingly, PR-A and PR-B proteins have been shown to respond differently to progestin antagonists [26]. In the present study, the results from immunohistochemistry demonstrate that mifepristone up-regulated the PR-B level in both the ampullar and isthmic region of the Fallopian tube with no spatial differences, which is in contrast to the effect on total PR levels [15]. There was a corresponding increase in expression of PR-B mRNA levels. Immunohistochemical staining localized the increased expression of PR-B to both epithelial and stromal cells, but was more pronounced in the stromal cells. In the endometrium, PR-B levels were also increased after treatment with mifepristone. Interestingly, in contrast to Fallopian tube, there was a predominant expression of the PR-B isoform in the glandular cells. Recently, isoform-specific knock-out mice that selectively express PR-B (PRAKO)

have been generated [27]. This has demonstrated that PR-B isoform is sufficient to elicit normal proliferation and differentiation responses of the endometrial glands to progesterone in the absence of PR-A [27,28]. It is unknown whether differential expression levels of PR-B in the Fallopian tube and in the endometrium results in different responses to steroid exposure. From the present data, it might be suggested that the effect of mifepristone on endometrial development and function previously reported is mainly through an effect on PR-B [23,29,30]. In conclusion, we have investigated the expression and regulation of PR-B on both mRNA and protein levels in the human Fallopian tube and endometrium at the expected time of blastocyst development and implantation. PR-B was present in low levels in the mid-luteal phase and located to both the stromal and epithelial cells. No significant difference was found between various localization’s of the Fallopian tube. Following treatment with 200 mg mifepristone on cycle day LH⫹2, both PR-B mRNA and protein concentrations were significantly increased in the ampullar and

Fig. 4. Expression of PR mRNA analyzed by RT-PCR in the endometrium after treatment with mifepristone (n ⫽ 4). (1– 8). (M) DNA marker. (1– 4) Control samples; (5– 8) treatment with mifepristone.

X. Sun et al. / Contraception 67 (2003) 319 –326

325

Fig. 5. The relative mRNA amounts of PR-B in controls (n ⫽ 4) and after treatment with mifepristone (n ⫽ 4) in the endometrium. Values are mean ⫾ SEM. **Significantly (p ⬍ 0.01) greater compared with controls.

isthmic region of the Fallopian tube. The increase was observed in both cell types but was more pronounced in the stromal cells. Treatment with mifepristone also resulted in a significant increase in PR-B levels in the endometrium but, in contrast to the Fallopian tube, this was mainly located to the glandular cells. Differential expression of PR-B in the oviduct and endometrium may explain tissue-dependent differences in the effects of mifepristone. The observed effects of mifepristone on PR-B expression in the Fallopian tube and endometrium during the mid-luteal phase are consistent with the high efficacy of this compound to prevent pregnancy when used as a postovulatory contraceptive method.

[5]

[6] [7]

[8]

[9]

Acknowledgments The authors thank laboratory technician Berit Sta˚ bi for skillful assistance and research nurses Lena Elffors-So¨ derlund and Margareta Hellborg for taking good care of the patients and volunteers. The authors are grateful to Professor Marc Bygdeman for reading the manuscript and for helpful suggestions. This investigation was supported by grants from the Swedish Medical Research Council (project no. A855), the Karolinska Institute and from Prof. Sune Bergstro¨ m, Karolinska Institute.

References [1] Amso NN, Crow J, Shaw RW. Comparative immunohistochemical study of oestrogen and progesterone receptors in the fallopian tube and uterus at different stages of the menstrual cycle and the menopause. Hum Reprod 1994;9:1027–37. [2] Fung HY, Wong YL, Wong FW, Rogers MS. Study of oestrogen and progesterone receptors in normal human endometrium during the menstrual cycle by immunocytochemical analysis. Gynecol Obstet Invest 1994;38:186 –90. [3] Moutsatsou P, Sekeris CE. Estrogen and progesterone receptors in the endometrium. Ann NY Acad Sci 1997;816:99 –115. [4] Kervancioglu ME, Saridogan E, Aitken RJ, Djahanbakhch O. Importance of sperm-to-epithelial cell contact for the capacitation of human

[10]

[11]

[12]

[13]

[14]

[15]

[16]

spermatozoa in fallopian tube epithelial cell cocultures. Fertil Steril 2000;74:780 – 4. Horwitz KB, Alexander PS. In situ photolinked nuclear progesterone receptors of human breast cancer cells: subunit molecular weights after transformation and translocation. Endocrinology 1983;113:2195–201. Savouret JF, Misrahi M, Milgrom E. Molecular action of progesterone. Int J Biochem 1990;22:579 –94. Kastner P, Krust A, Turcotte B, et al. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 1990;9:1603– 14. Clarke CL, Zaino RJ, Feil PD, et al. Monoclonal antibodies to human progesterone receptor: characterization by biochemical and immunohistochemical techniques. Endocrinology 1987;121:1123–32. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP. Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrin 1993;7:1244 –55. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP. The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 1994; 14:8356 – 64. Giangrande PH, Pollio G, McDonnell DP. Mapping and characterization of the functional domains responsible for the differential activity of the A and B isoforms of the human progesterone receptor. J Biol Chem 1997;272:32889 –900. McDonnell DP, Shahbaz MM, Vegeto E, Goldman ME. The human progesterone receptor A-form functions as a transcriptional modulator of mineralocorticoid receptor transcriptional activity. J Steroid Biochem Mol Biol 1994;48:425–32. Klein-Hitpass L, Cato AC, Henderson D, Ryffel GU. Two types of antiprogestins identified by their differential action in transcriptionally active extracts from T47D cells. Nucleic Acids Res 1991;19: 1227–34. Gemzell-Danielsson K, Swahn ML, Svalander P, Bygdeman M. Early luteal phase treatment with mifepristone (RU 486) for fertility regulation. Hum Reprod 1993;8:870 –3. Christow A, Sun X, Gemzell-Danielsson K. Effect of mifepristone and levonorgestrel on expression of steroid receptors in the human Fallopian tube. Mol Hum Reprod 2002;8:333– 40. Gemzell-Danielsson K, Svalander P, Swahn M L, Johannisson E, Bygdeman M. Effects of a single post-ovulatory dose of RU486 on endometrial maturation in the implantation phase. Hum Reprod 1994; 9:398 – 404.

326

X. Sun et al. / Contraception 67 (2003) 319 –326

[17] Cekan SZ, Beksac MS, Wang E, et al. The prediction and/or detection of ovulation by means of urinary steroid assays. Contraception 1986; 33:327– 45. [18] Metcalf MG, Hunt EG. Calculation of estrogen excretion rates from urinary estrogen to creatinine ratios. Clin Biochem 1976;9:75–7. [19] Navot D, Bergh P. Preparation of the human endometrium for implantation. Ann NY Acad Sci 1991;622:212–9. [20] Stavreus-Evers A, Nikas G, Sahlin L, Eriksson H, Landgren BM. Formation of pinopodes in human endometrium is associated with the concentrations of progesterone and progesterone receptors. Fertil Steril 2001;76:782–91. [21] Mote PA, Balleine RL, McGowan EM, Clarke CL. Co-localization of progesterone receptors A and B by dual immunofluorescent histochemistry in human endometrium during the menstrual cycle. J Clin Endocrinol Metab 1999;84:2963–71. [22] Wang H, Critchley HO, Kelly RW, Shen D, Baird DT. Progesterone receptor subtype B is differentially regulated in human endometrial stroma. Mol Hum Reprod 1998;4:407–12. [23] Swahn ML, Bygdeman M, Cekan S, Xing S, Masironi B, Johannisson E. The effect of RU 486 administered during the early luteal phase on bleeding pattern, hormonal parameters and endometrium. Hum Reprod 1990;5:402– 8. [24] Gemzell-Danielsson K, Westlund P, Johannisson E, Swahn ML, Bygdeman M, Seppala M. Effect of low weekly doses of mifepristone

[25]

[26]

[27]

[28] [29]

[30]

on ovarian function and endometrial development. Hum Reprod 1996;11:256 – 64. Brenner RM, Slayden OD. Oestrogen action in the endometrium and oviduct of rhesus monkeys during RU486 treatment. Hum Reprod 1994;9(Suppl 1):S82–S97. Giangrande PH, McDonnell DP. The A and B isoforms of the human progesterone receptor: two functionally different transcription factors encoded by a single gene. Recent Prog Horm Res 1999;54:291–313; discussion 313– 4. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM. Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 2000;289:1751– 4. Conneely OM, Lydon JP. Progesterone receptors in reproduction: functional impact of the A and B isoforms. Steroids 2000;65:571–7. Gemzell-Danielsson K, Swahn ML, Bygdeman M. The effect of various doses of mifepristone on endometrial leukaemia inhibitory factor expression in the midluteal phase—an immunohistochemical study. Hum Reprod 1997;12:1293–7. Ghosh D, Kumar PG, Sengupta J. Effect of early luteal phase administration of mifepristone (RU486) on leukaemia inhibitory factor, transforming growth factor-beta and vascular endothelial growth factor in the implantation stage endometrium of the rhesus monkey. J Endocrinol 1998;157:115–25.