- Email: [email protected]
Progesterone regulates chicken embryonic germ cell meiotic initiation independent of retinoic acid signaling
Theriogenology xxx (2014) 1–9
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Progesterone regulates chicken embryonic germ cell meiotic initiation independent of retinoic acid signaling Yuling Mi 1, Bin He 1, Jian Li, Caiqiao Zhang* Key Laboratory of Molecular Animal Nutrition, Ministry of Education and Department of Veterinary Medicine, College of Animal Sciences, Zhejiang University, Hangzhou, P. R. China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 April 2013 Received in revised form 22 March 2014 Accepted 22 March 2014
The signaling molecule retinoic acid (RA) is known to trigger germ cells to enter meiosis. However, RA may not be the only secreted inducer of meiosis. Our previous data indicate that luteinizing hormone also promotes germ cell meiotic initiation by upregulating 3bHSDII transcription. Here, using chicken embryos, we investigate the role of progesterone (P4) in regulating germ cell meiotic initiation. Progesterone treatment at embryonic Day 9.5 accelerated germ cell meiosis entry in the female chicken embryos. However, P4 treatment in vivo did no influence on testicular germ cells but triggered their meiotic initiation in the cultured testes. As treatment with an RA receptor (RAR) inhibitor did not block the stimulatory effect of P4 on germ cell meiotic initiation, this P4 stimulatory effect seems to be independent of RAR-mediated signaling. The abundance of RA metabolismrelated enzymes and RAR (RARb) mRNAs did not differ significantly between P4-treated and control individuals. The RA concentration in the ovaries remained unchanged by P4 treatment in vivo. Because no inhibition by the P4 receptor (PR) nuclear receptor antagonist mifepristone on P4 effect was observed in either in vitro or in vivo experiments, the effect of P4 on germ cell meiotic initiation is probably mediated by membrane PRs (mPR). The mPRa, mPRb, and mPRg mRNAs were all expressed in the embryonic ovaries. The expression of mPRa and mPRb was higher than that of mPRg. Immunohistochemical results showed that mPRa-positive cells were mainly scattered in the ovarian cortex area where most germ cells were distributed. The mPRb-positive cells were widely distributed in the ovaries, and positive cells were clustered with a similar morphology to that of germ cell clusters. In conclusion, P4 may regulate embryonic germ cell meiotic initiation independent of RA signaling through the membrane PRs. This study provides a new insight into the mechanisms of germ cell meiotic initiation in the chicken. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Progesterone Germ cell Meiotic initiation Retinoic acid Chicken Progesterone receptor
1. Introduction Germ cells are unique because they undergo meiosis to generate haploid cells and form the basis for sexual reproduction. The signaling molecule retinoic acid (RA) has been identified as the key factor required for germ cells to enter meiosis [1,2]. Moreover, RA has been proved to trigger
* Corresponding author. Tel./fax: þ86 571 88982976. E-mail address: [email protected] (C. Zhang). 1 These authors contributed equally to this work. 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.03.021
germ cell meiotic initiation in the chicken [3,4]. However, recent observations have suggested that the first meiotic division does not necessarily require endogenous RA [5,6]. Germ cells in the fetal ovary are seen to enter meiosis in Raldh2/ or Raldh2//Raldh3/ mice which lack all RA synthesis and signaling [6]. These findings suggest that RA may not be the only inducer of meiosis secreted. Our previous results indicate that LH causes a significant increase of D5-3b-hydroxysteroid dehydrogenase (D53bHSD) transcription and promotes germ cell meiotic initiation [7]. The 3bHSD enzyme converts pregnenolone to progesterone (P4). In vertebrates, P4, along with other sex
2
Y. Mi et al. / Theriogenology xxx (2014) 1–9
steroid hormones, plays an important role in gametogenesis. In teleost fish, in which no RA signaling triggers have been reported [8,9], evidence indicates that progestin is an important factor for the initiation of meiosis for both spermatogenesis and oogenesis. However, it remains unclear whether progestins are able to modulate development of the fetal germ cells in species in which RA usually triggers meiotic initiation. The biological effects of P4 on target cells are elicited through two specific intracellular receptors, designated P4 receptor (PR) A and B [10]. The two PR subtypes are both expressed in the chicken embryonic gonads [11]. In the female chicken, P4 has been detected in serum during embryonic development and its level is increased from embryonic Day 9 (E9) to E15 and then was stabilized at E18 [12]. However, in these studies, the physiological role of this steroid was not clear. Nevertheless, the increase of serum P4 levels was coincident with the meiotic initiation of the germ cells in the ovaries of embryonic chickens [3,4]. It would be interesting to know if P4 acts as another signaling molecule, alongside RA, to initiate meiosis in vertebrates. In this study, we use both in vivo and in vitro systems to investigate the role of P4 in early stages of gametogenesis in the embryonic chicken. Moreover, we detected whether RA signaling is involved in this induction. The results will help to determine if P4 exists as another inducer, beyond that of RA, to regulate germ cell meiotic initiation. These results will provide a new insight into the mechanisms of germ cell meiotic initiation in the chicken. 2. Materials and methods 2.1. Animals Fertilized Hyline chicken (Gallus gallus) eggs were obtained from a commercial hatchery and incubated in an egg incubator at 38.5 C and at 60% humidity. All procedures were performed in accordance with the Guiding Principles for the Care and Use of Laboratory Animals of Zhejiang University. 2.2. Treatment of animal and tissue collection All in vivo injections were performed under sterile conditions using autoclave-sterilized instruments. Injections were applied to the air sac at E9.5. A dose of 2 mg/mL of P4 (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in sterile DMSO in a volume of 50 mL. A single dose of 50 mL P4 was administered per egg. The control was injected with 50 mL of DMSO. Left ovaries or testes were collected on the second day postinjection for RA concentration analysis, and Days 1, 2, 3, and 4 days postinjection for total RNA extraction and reversed transcription–polymerase chain reaction (RT-PCR) or fixation in 4% paraformaldehyde for fluorescence immunohistochemistry or 5 days postinjection for conventional paraffin histology with hematoxylin/eosin (H&E) staining. 2.3. Organ culture Individual left ovaries from E10.5 embryos or left testis from E13.5 embryos without mesonephros were removed for organ culture. Gonads were cultured on Millipore filters
according to a previously published method [13]. Each gonad was placed into a well of a 24-well plate containing 500 mL Dulbecco’s Modified Eagle Medium (GIBCO, Invitrogen Co., NY, USA) supplemented with 10 mg/mL insulin, 5 mg/mL transferrin, and 30 nM selenite (Sigma-Aldrich) as the complete medium. After 2 days of culture at 38.5 C/5% CO2, the ovaries were fixed in 4% paraformaldehyde for fluorescence immunohistochemistry. At the beginning of culture, the ovaries were challenged with 1 ng/mL P4 with or without AGN193109 (1 mM; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). 2.4. RNA extraction and RT-PCR Trizol reagent (Invitrogen Co., Carlsbad, CA, USA) was used to extract total RNA from tissues. The RNA purity and concentration was determined using a One Drop OD-1000þ Spectrophotometer (Nanjing Wuyi Technology Co., Nanjing, China) at 260/280 nm in the range of 1.8 to 2.0. Total RNA (2 mg) was reverse transcribed using a Fermentas One step RT-PCR kit (MBI Fermentas, Burlington, ON, Canada) according to the manufacturer’s instruction and further amplified by PCR. The PCR primers of mPRa, mPRb, and mPRg are listed in Table 1. 2.5. Real-time quantitative RT-PCR Real-time quantitative RT-PCR (qRT-PCR) was used to assess the expression of the premeiotic marker Stra8 (stimulated by RA gene), the meiotic markers Scp3 (a gene encoding a synaptonemal complex protein) and Dmc1 (a gene encoding a meiotic recombinase), RA metabolismrelated enzymes Raldh2 (a gene encoding retinaldehyde dehydrogenase, type 2, also called as Aldh1a2), and Cyp26b1 and RA receptor RARb (Table 1). The qPCR was carried out on an ABI 7300 HT real-time PCR machine (Applied Biosystems, Foster City, CA, USA) with the reaction volume of 20 mL consisting of complementary DNA from 10 ng of the original RNA template, 400 nM of each of the gene-specific forward and reverse primers, and 10 mL SYBR Premix Ex Taq (TaKaRa Bio Inc. Co., Dalian, China). Then, qRT-PCR was carried out in triplicate with a SYBR Premix Ex Taq in an ABI 7500 realtime PCR Detection System (Applied Biosystems). After normalization with the germ cell marker gene Cvh (a chicken homolog of vasa gene) or b-actin, relative RNA levels in the samples were calculated by the comparative threshold cycle method. The sequences of primers for PCR are listed in Table 1. The delta–delta Ct method was used to calculate relative fold-change values between samples [14]. 2.6. Immunofluorescence colocalization The Dazl protein (deleted in azoospermia-like, which is expressed in germ cells that enable those cells to initiate meiosis) was used as the germ cell marker [15]. The gH2AX protein (a phosphorylated histone variant found to be characteristic of double-strand breaks repair in mitotic cells) was used as the meiosis marker [16]. Frozen ovarian sections were performed with rabbit anti-Dazl antibody (1:200, ab113517; Abcam, Cambridge, UK) and mouse antigH2AX antibody (1:500, ab26350; Abcam) fluorescence
Y. Mi et al. / Theriogenology xxx (2014) 1–9
3
Table 1 Primers for PCR analysis. Gene
Accession no.
Primer sequences (50 –30 )
Product length (bp)
Stra8
XM_416179
166
Scp3
XM_416330
Dmc1
XM_425477
Raldh2
NM_204995
Cyp26b1
XM_426366
RARb
NM_205326
Cvh
NM_204708
mPRa
XM_003641865.2
mPRb
NM_001008462.1
mPRg
NM_001163651.1
b-actin
NM_205518
GTGAGGGACAGTGGAGGTAA CAGAAATGCCGCTTGTAAAT CTGTATTTCAGCAGTGGGATG TGCGAAGTTCATTTTGTGC AGATGACAACAAGACGAGCACT CAATCCCACCACCCAGAA GGCAGTTCTTGCTACTATGGA TCTGCCCAACCAGCGTAAT TTCGCCTCTTCACCCCCAT TGGAACCTGCCCTCCTTGTC CCTCGTGTTCACCTTTGC AGGCTTGTTGGGTCGTCT CGGATGATGAAAGATGGTGTA ATTTGACGGATTGAATGACCT CTCCTGCCCGTGACAATAACT CAACCAGAACAACCAACAGAAC CTTCCACACCTTCCTTGCTATC GAAAATCTCCTGCCTGTTCTTG ACTTCTCTGCCCTGTGTGTCTT GCCCCAAATCTCAATCTTCTT ACACCCACACCCCTGTGATGAA TGCTGCTGACACCTTCACCATTC
225 195 144 205 193 188 138 82 111 136
Abbreviation: PCR, polymerase chain reaction.
immunohistochemistry according to a previous method [7]. Furthermore, three mPRs a, b, and g were detected by immunofluorescence. Goat anti-mPRa, b, or g polyclonal antibodies (2 mg/mL) (sc-50111, sc-50109, or sc-28019, respectively; Santa Cruz Biotechnology Inc., CA, USA) were the primary antibodies. DyLight 549-rabbit anti-goat immunoglobulin G (1:1000; KPL Inc., Gaithersburg, MD, USA) was used as the secondary antibody. Sections were counterstained with 40 , 6-diamidino-2-phenylindole (Sigma-Aldrich). A negative control section was incubated with normal serum instead of primary antibodies. Mounted slides were visualized using a laser-scanning confocal microscope (FV1000; Olympus, Co., Tokyo, Japan). 2.7. Histologic observation For histologic study, gonads from E14.5 or E17.5 chickens with or without P4 treatment at E9.5 in vivo were dissected from embryos and fixed in 4% paraformaldehyde solution and then dehydrated in graded ethanol. Tissues were then embedded in paraffin. Five micron sections were mounted onto gelatin-coated slides and stained with standard H&E staining. Germ cells were recognized by their large size (20 mm) and pale cytoplasm relative to somatic cells. Meiotic germ cells were distinguished by the presence of condensed thread-like chromatins, as assessed by H&E staining. 2.8. High-performance liquid chromatography analysis of RA The tissues were homogenized in Dulbecco’s PBS using a tissue grinder in the presence of chloroform/methanol (1:1). Subsequently, the sample was extracted three times with addition of chloroform and centrifuged at 1000 g for 5 minutes. After passage through a reversed phase (C18 Sep-Pak; Millipore) cartridge with 0.1% trifluoroacetic acid
in methanol, the extract was concentrated through evaporation of the solvent under gas and was redissolved in 50% methanolic chloroform. An Alliance system (Waters Corp., Milford, MA, USA) equipped with a 2695 Separation Module, 2996 photodiode array detector, and 2475 multi l fluorescence detector was used for high-performance liquid chromatography analysis. For compound elution, an Atlantis dC18 (3 mm, 4.6 150 mm; Waters Corp.) reversephase column was used for the stationary phase. For the mobile phase, a gradient of acetonitrile in water with 0.1% trifluoroacetic acid: 75% to 90% acetonitrile (0–30 minutes); 90% to 100% acetonitrile (30–40 minutes); 100% acetonitrile (40–80 minutes) with a flow rate of 0.5 mL/min was used. Detection was by photodiode array, which was set at 350 nm. 2.9. Statistical analysis All data were expressed as the means standard error of the means and analyzed by t-test using the SPSS 16.0 software. P < 0.05 was considered as statistically different. 3. Results 3.1. P4 promoted female germ cell meiotic initiation To confirm meiotic induction resulting from P4 treatment in the embryonic ovarian germ cells, we first investigated the transcription of premeiotic marker Stra8 and meiotic markers Scp3 and Dmc1 in ovaries. Progesterone treatment significantly increased the expression levels of Stra8 mRNA from 3 days and Scp3 mRNA from 2 days (Fig. 1; P < 0.05). In contrast, Dmc1 mRNA expression was not increased (Fig. 1; P > 0.05), as detected by qRT-PCR. Progesterone induction of meiosis of P4, was further confirmed by gH2AX, as a marker of DNA double-strand breaks and
4
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 1. Expression of Stra8, Scp3, and Dmc1 of mRNAs in embryonic chicken ovaries after P4 treatment. Quantitative RT-PCR analysis of premeiosis marker Stra8, meiosis markers Scp3 and Dmc1 mRNAs expression in ovaries treated with P4 on E9.5 for 1, 2, 3, and 4 days, respectively. Cvh was used as the normalization control. Values are mean SEM of six experiments. An asterisk represents significant difference (P < 0.05); NS indicates no significant difference (P > 0.05). E, embryonic day; NS, not significant; P4, progesterone; RT-PCR, reversed transcription–polymerase chain reaction; SEM, standard error of the mean.
Dazl, a hallmark of meiosis and a germ cell marker, as revealed by double fluorescence staining on cryosections. Germ cells were detected in the cortex of the left ovary with Dazl immunolocalized in the cytoplasm. gH2AX was immunolocalized to the nuclei of germ cells in the ovarian cortex at E12.5 after P4 treatment (Fig. 2A). No gH2AX/Dazl double positive cells were demonstrated in the control individuals (Fig. 2A). As detected by H&E staining, meiosis germ cells were displayed in the control female ovarian cortex in E17.5 embryos (Fig. 2B). Most germ cells in the
E14.5 ovaries entered into meiosis with P4 treatment in E9.5, but no meiotic germ cells were observed in the control individuals in E14.5 ovaries (Fig. 2B). 3.2. P4 promoted male germ cell meiotic initiation in vitro but not in vivo To examine the effect of P4 in the male embryonic germ cells, we investigated the transcription of Stra8, Scp3, and Dmc1 mRNAs in left testes. From 1 to 4 days, no significant
Fig. 2. Effects of P4 on ovarian germ cell meiotic initiation by morphologic demonstration. (A) Histologic sections of the left ovaries with immunofluorescent labeling of germ cell marker, Dazl, and meiosis marker, gH2AX, after treatment with P4 on E9.5 for 3 days. (B) H&E staining of ovarian sections from E14.5 with or without P4 treatment and E17.5 embryos. Distribution of meiotic stages in germ cells in H&E staining sections after P4 treatment at E9.5 for 5 days or E17.5 ovaries. Arrowheads represent meiosis entry germ cells (red) and nonmeiosis entry germ cells (green). Scale bars: 20 mm. E, embryonic day; H&E, hematoxylin and eosin staining; P4, progesterone.
Y. Mi et al. / Theriogenology xxx (2014) 1–9
5
Fig. 3. Effects of P4 on testicular germ cell meiotic initiation. (A) Quantitative RT-PCR analysis of premeiosis marker Stra8, meiosis markers Scp3 and Dmc1 mRNAs in testes of embryos after treatment with P4 in E9.5 for 1, 2, 3, and 4 days, respectively. Cvh was used as the normalization control. Values are mean SEM of six experiments. NS indicates not significant difference (P > 0.05). (B) Histologic sections of E13.5 testes were cultured for 2 days in the presence or absence of 1 mg/ mL P4 with immunofluorescent labeling of the germ cell marker, Dazl, and meiosis marker, gH2AX. Scale bars: 20 mm. E, embryonic day; P4, progesterone; NS, not significant; RT-PCR, reversed transcription–polymerase chain reaction; SEM, standard error of the mean.
change of Stra8, Scp3, or Dmc1 mRNAs was shown in the testes after P4 treatment in vivo (Fig. 3A; P > 0.05). Moreover, no gH2AX-positive cells were immunolocalized to the nuclei of germ cells in the testes at E12.5 after treatment with P4 in E9.5 for 3 days (data not shown). In the next experiment, the E13.5 testes were separated from the mesonephros and cultured for 2 days in a serumfree medium with 1 ng/mL P4. In the testes cultured in the presence of P4, germ cells presented typical features of meiosis. The gH2AX were immunolocalized in germ cells with Dazl in the cytoplasm after P4 treatment (Fig. 3B). No gH2AX/Dazl double positive cells were demonstrated in the control testes (Fig. 3B). 3.3. P4 promoted germ cell meiosis independent of RA To examine signaling mechanisms involved in the stimulatory effect of P4, we treated the cultured E10.5 ovaries with P4 in the presence of the pan-RAR inhibitor AGN193109. Germ cells in the cultured ovaries entered into meiosis after treatment with P4 for 2 days as in the previous result [7]. Retinoic acid did stimulate germ cells to enter into meiosis, but AGN193109 blocked this stimulatory effect of RA on germ cell meiotic initiation. However,
AGN193109 did not block the stimulatory effect of P4 on germ cell meiotic initiation (Fig. 4A). Meanwhile, the expression of several enzymes crucial for the RA metabolism was also examined. Treatment with P4 did not cause significant changes in the mRNAs abundance of the RA synthesizing enzyme Raldh2 and the RA degrading enzyme Cyp26b1 from 1 to 4 days in the ovaries (Fig. 4B; P > 0.05). Furthermore, qRT-PCR did not reveal any significant changes in RAR (RARb) mRNA expression after treatment with P4 (Fig. 4B; P > 0.05). We next investigated whether the concentrations of RA in the ovaries were changed after P4 by high-performance liquid chromatography. No significant difference was detected in the E11.5 ovaries between the P4-treated (at E9.5 for 2 days) and the control individuals (Fig. 5). 3.4. Expression of membrane PRs by RT-PCR in the embryonic ovaries Because blockade of the nuclear PR by mifepristone failed to inhibit the action of P4 on meiotic initiation of embryonic ovarian germ cells, the membrane PR (mPR) may be involved in this mediation. Therefore, we detected the expression of three subtypes of mPR mRNAs in the
6
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 4. Effects of P4 on germ cell meiotic initiation independent of RA. (A) Histologic sections of E10.5 ovaries after treatment by P4 and RA with or without AGN193109 for 2 days with immunofluorescent labeling of the germ cell marker, Dazl, and meiosis marker, gH2AX. Scale bars: 20 mm. (B) Transcription of Raldh2, Cyp26b1, and RARb mRNAs in ovaries from the embryos which were treated with P4 at E9.5 for 1, 2, 3, and 4 days, respectively. Values are mean SEM of six experiments. NS indicates not significant difference (P > 0.05). E, embryonic day; NS, not significant; P4, progesterone; RA, retinoic acid; SEM, standard error of the mean.
ovaries at E13.5. All subtypes of mPRa, mPRb, and mPRg mRNA were detected in the ovaries (Fig. 6A). Among these subtypes, the gene expressions of mPRa and mPRb were higher than those of mPRg.
cells positive for mPRa and mPRb. These morphologic results are in accordance with the RT-PCR result.
3.5. Immunohistochemical demonstration of mPR in the embryonic ovaries
Successful gametogenesis requires the accurate interplay of many factors that orchestrate germ cell migration, proliferation, and meiosis initiation. Retinoic acid has been reported as a meiosis-inducing substance. Recently, many studies have revealed that germ cell meiotic initiation does not require endogenous RA [5,6]. To address this question, using an in vivo approach, we have demonstrated for the first time the potential role for P4 to act as a signaling molecule of germ cells differentiation independent of RA. Previous studies in chickens have indicated that premeiotic DNA synthesis begins in the germ cells of the left ovary between E15 and E16 [3,4,17]. In the female embryonic chicken, the plasma P4 levels increased about threefold
Finally, we demonstrated the distribution of mPRa, mPRb, and mPRg proteins in the embryonic ovaries at E13.5 by immunohistochemistry. The mPRa-positive cells were mainly scattered in the ovarian cortex area where most germ cells were distributed (Fig 6B). The mPRb-positive cells were widely distributed in the ovaries, and these positive cells were clustered in a manner similar to that of germ cell clusters in morphology. The mPRg-positive cells were scattered in the mesenchymal tissue, and the number of mPRg-positive cells was much lower than number of
4. Discussion
Y. Mi et al. / Theriogenology xxx (2014) 1–9
7
Fig. 5. Effects of P4 treatment on RA concentration in embryonic ovaries. Retinoic acid concentration in ovaries of E11.5 embryos that were treated with P4 at E9.5 for 2 days. (A) Standard reference (all-trans-retinoic acid 500 ng/mL); (B) control ovaries; (C) P4-treated ovaries. E, embryonic day; P4, progesterone; RA, retinoic acid.
8
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 6. Demonstration of the membrane progesterone receptor expression by RT-PCR (A) and immunohistochemistry (B) in embryonic ovaries. (A) RT-PCR analysis of mPRa, mPRb, and mPRg mRNAs expression in ovaries in E13.5. b-actin was used as the normalization control. (B) Histologic sections of E13.5 ovaries were immunofluorescent labeled with mPRa, mPRb, and mPRg, respectively. The negative control section was incubated with normal serum instead of primary antibodies. Scale bars: 20 mm. E, embryonic day; RT-PCR, reversed transcription–polymerase chain reaction.
from E9 to E15, coincident with the initiation of the germ cell meiosis [12]. Here, we found that treatment with P4 in E9.5 embryos stimulated ovarian germ cells meiosis entry 3 days before the normal individuals. Moreover, histologic observations of the early stages of oogenesis suggest that P4 is involved in the initiation of the first meiotic division of oogonia. Our previous studies have demonstrated that P4induced germ cells in the cultured ovaries to enter into meiosis [7]. Altogether, these data suggest that P4 represents an important steroid in the initiation of meiosis in ovarian germ cells for the embryonic chicken. Progesterone treatment could not stimulate testicular germ cells meiosis entry in vivo. Interestingly, a low concentration of P4 was sufficient to promote testicular germ cell meiosis entry in the cultured testes. Taken together, P4 may be the initiator of germ cell meiotic initiation for both males and females. There was a very low level of P4 in the testes because, in the male gonads, P4 is converted to testosterone by steroidogenic enzymes, such as 17a-hydroxylase and/or 17b-hydroxysteroid dehydrogenase [18]. Therefore, the gonadal P4 levels and its metabolism determine whether female and male germ cells initiate meiosis during embryogenesis. It is likely that additional diffusible factors that were produced outside the testis may act to prevent germ cell meiosis entry in vivo. Previous studies have reported that Fgf9, Nanos2, Nodal signaling, and other factors are required for reinforcement of the male germ cell fate and act in preventing meiosis in the embryonic germ
cells [19–22]. More data here would help to explain why P4 was unable to induce testicular germ cells meiotic initiation in vivo and how testicular germ cells choose a male fate. The importance of RA in germ cell meiotic initiation has been suggested by several studies [1,2]. The retinoid signals are transduced by two families of receptors, RAR (RARa, b, and g) and RXR (RXRa, b, and g) receptors. Inhibition of RAR action has been shown to inhibit meiosis in RA-treated mouse fetal testes and ovaries [2]. To understand whether P4 action is related to RA signaling, we inhibited RAR using the RAR antagonist AGN193109 in the organ culture system. AGN194310 could not abolish the stimulatory effect of P4 on germ cell meiosis entry, indicating no involvement of RAR-mediated signaling in the P4-induced germ cell meiosis entry. Using qRT-PCR, we found no significant difference in the mRNA abundances of Raldh2, Cyp26b1, and RARb mRNAs between P4-treated and control ovaries. These results, taken together, demonstrate that there is no significant difference in RA concentrations between the P4treated and control ovaries, indicating that P4 may control meiosis progression independently to RA. Because no inhibition by the PR nuclear receptor antagonist mifepristone on P4 effect was observed in either in vitro or in vivo experiments, the effect of P4 on germ cell meiotic initiation is probably mediated by the mPRs. The mPRs are G protein–coupled receptors belonging to the adipoQ receptor family that mediate the P4 actions on the cell surface in the reproductive system. Interestingly,
Y. Mi et al. / Theriogenology xxx (2014) 1–9
the mPRs are restricted to the germ cells [23,24], and P4 is seen to regulate zebrafish spermatogenesis via PR [25]. A recent report showed that P4 could downregulate the PR mRNA expression in the granulosa cells of hens [26]. These studies indicate that P4 may interact with the mPRs, which are located on the germ cell and influence their development or physiological function. By RT-PCR and immunohistochemistry, we manifested the expression of mPRa, mPRb, and mPRg mRNAs and proteins in the embryonic ovaries. This result provides strong support for the involvement of mPR to mediate the P4 action on meiotic initiation in the embryonic germ cells. However, this hypothesis awaits further clarification. 4.1. Conclusions In conclusion, this study showed that P4 treatment at E9.5 can accelerate germ cell meiosis entry in the female chicken embryos and the common meiosis inducer RA was not involved in this process. These results suggest the existence of P4 as an inducer of meiosis initiation and P4 regulates embryonic germ cell meiotic initiation in a manner independent of RA signaling in the chicken. This study provides a new insight into the mechanisms of germ cell meiotic initiation in the chicken. Acknowledgments This study was supported by the National Natural Science Foundation of China (No. 31272525), Zhejiang Provincial Natural Science Foundation (Z3110115), Program for New Century Excellent Talents in University (NCET-13– 0519) and the Ph.D. Programs Foundation of Ministry of Education of China (20110101110099). We are grateful to Jun Li, Jie Li, and Weidong Zeng (Zhejiang University) for help in the experiments and Dr. Chris Wood (Zhejiang University) for English improvement in the manuscript. References [1] Bowles J, Knight D, Smith C, Wilhelm D, Richman J, Mamiya S, et al. Retinoid signaling determines germ cell fate in mice. Science 2006; 312:596–600. [2] Koubova J, Menke DB, Zhou Q, Capel B, Griswold MD, Page DC. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc Natl Acad Sci U S A 2006;103:2474–9. [3] Smith CA, Roeszler KN, Bowles J, Koopman P, Sinclair AH. Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid. BMC Dev Biol 2008;8:85. [4] Yu M, Yu P, Leghari IH, Ge C, Mi Y, Zhang C. Raldh2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in germ cells of the female embryonic chickens. Amino Acids 2013;44:405–12. [5] Griswold MD, Hogarth CA, Bowles J, Koopman P. Initiating meiosis: the case for retinoic acid. Biol Reprod 2012;86:35.
9
[6] Kumar S, Chatzi C, Brade T, Cunningham TJ, Zhao X, Duester G. Sexspecific timing of meiotic initiation is regulated by Cyp26b1 independent of retinoic acid signaling. Nat Commun 2011;2:151. [7] He B, Mi Y, Zhang C. Gonadotropins regulate ovarian germ cell mitosis/meiosis decision in the embryonic chicken. Mol Cell Endocrinol 2013;370:32–41. [8] Miura C, Higashino T, Miura T. A progestin and an estrogen regulate early stages of oogenesis in fish. Biol Reprod 2007;77:822–8. [9] Miura T, Higuchi M, Ozaki Y, Ohta T, Miura C. Progestin is an essential factor for the initiation of the meiosis in spermatogenetic cells of the eel. Proc Natl Acad Sci U S A 2006;103:7333–8. [10] Conneely OM, Maxwell BL, Toft DO, Schrader WT, O’Malley BW. The A and B forms of the chicken progesterone receptor arise by alternate initiation of translation of a unique mRNA. Biochem Biophys Res Commun 1987;149:493–501. [11] Gasc JM. Distribution and regulation of progesterone receptor in the urogenital tract of the chick embryo. An immunohistochemical study. Anat Embryol (Berl) 1991;183:415–26. [12] Martin B, Gasc JM, Thibier M. C21-Steroid binding proteins and progesterone levels in chicken plasma during ontogenesis. J Steroid Biochem 1977;8:161–6. [13] He B, Lin J, Li J, Mi Y, Zeng W, Zhang C. Basic fibroblast growth factor suppresses meiosis and promotes mitosis of ovarian germ cells in embryonic chickens. Gen Comp Endocrinol 2012;176: 173–81. [14] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101–8. [15] Gill ME, Hu YC, Lin Y, Page DC. Licensing of gametogenesis, dependent on RNA binding protein DAZL, as a gateway to sexual differentiation of fetal germ cells. Proc Natl Acad Sci U S A 2011;108: 7443–8. [16] Hunter N, Börner GV, Lichten M, Kleckner N. Gamma-H2AX illuminates meiosis. Nat Genet 2001;27:236–8. [17] Callebaut M. Premeiosis and premeiotic DNA synthesis in the left ovary of the female chick embryo. J Embryol Exp Morphol 1967;18: 299–304. [18] Sechman A, Hrabia A, Lis MW, Niedzió1ka J. Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on steroid concentrations in blood and gonads of chicken embryo. Toxicol Lett 2011;205:190–5. [19] Barrios F, Filipponi D, Pellegrini M, Paronetto MP, Di Siena S, Geremia R, et al. Opposing effects of retinoic acid and FGF9 on Nanos2 expression and meiotic entry of mouse germ cells. J Cell Sci 2010;123:871–80. [20] Bowles J, Feng CW, Spiller C, Davidson TL, Jackson A, Koopman P. FGF9 suppresses meiosis and promotes male germ cell fate in mice. Dev Cell 2010;19:440–9. [21] Guerquin MJ, Duquenne C, Lahaye JB, Tourpin S, Habert R, Livera G. New testicular mechanisms involved in the prevention of fetal meiotic initiation in mice. Dev Biol 2010;346:320–30. [22] Souquet B, Tourpin S, Messiaen S, Moison D, Habert R, Livera G. Nodal signaling regulates the entry into meiosis in fetal germ cells. Endocrinology 2012;153:2466–73. [23] Hanna RN, Zhu Y. Expression of membrane progestin receptors in zebrafish (Danio rerio) oocytes, testis and pituitary. Gen Comp Endocrinol 2009;161:153–7. [24] Thomas P, Tubbs C, Detweiler C, Das S, Ford L, BreckenridgeMiller D. Binding characteristics, hormonal regulation and identity of the sperm membrane progestin receptor in Atlantic croaker. Steroids 2005;70:427–33. [25] Chen SX, Bogerd J, García-López A, de Jonge H, de Waal PP, Hong WS, et al. Molecular cloning and functional characterization of a zebrafish nuclear progesterone receptor. Biol Reprod 2010;82: 171–81. [26] Wei Q, Zhu G, Cui X, Kang L, Cao D, Jiang Y. Expression of CCT6A mRNA in chicken granulosa cells is regulated by progesterone. Gen Comp Endocrinol 2013;189:15–23.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Progesterone regulates chicken embryonic germ cell meiotic initiation independent of retinoic acid signaling Yuling Mi 1, Bin He 1, Jian Li, Caiqiao Zhang* Key Laboratory of Molecular Animal Nutrition, Ministry of Education and Department of Veterinary Medicine, College of Animal Sciences, Zhejiang University, Hangzhou, P. R. China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 April 2013 Received in revised form 22 March 2014 Accepted 22 March 2014
The signaling molecule retinoic acid (RA) is known to trigger germ cells to enter meiosis. However, RA may not be the only secreted inducer of meiosis. Our previous data indicate that luteinizing hormone also promotes germ cell meiotic initiation by upregulating 3bHSDII transcription. Here, using chicken embryos, we investigate the role of progesterone (P4) in regulating germ cell meiotic initiation. Progesterone treatment at embryonic Day 9.5 accelerated germ cell meiosis entry in the female chicken embryos. However, P4 treatment in vivo did no influence on testicular germ cells but triggered their meiotic initiation in the cultured testes. As treatment with an RA receptor (RAR) inhibitor did not block the stimulatory effect of P4 on germ cell meiotic initiation, this P4 stimulatory effect seems to be independent of RAR-mediated signaling. The abundance of RA metabolismrelated enzymes and RAR (RARb) mRNAs did not differ significantly between P4-treated and control individuals. The RA concentration in the ovaries remained unchanged by P4 treatment in vivo. Because no inhibition by the P4 receptor (PR) nuclear receptor antagonist mifepristone on P4 effect was observed in either in vitro or in vivo experiments, the effect of P4 on germ cell meiotic initiation is probably mediated by membrane PRs (mPR). The mPRa, mPRb, and mPRg mRNAs were all expressed in the embryonic ovaries. The expression of mPRa and mPRb was higher than that of mPRg. Immunohistochemical results showed that mPRa-positive cells were mainly scattered in the ovarian cortex area where most germ cells were distributed. The mPRb-positive cells were widely distributed in the ovaries, and positive cells were clustered with a similar morphology to that of germ cell clusters. In conclusion, P4 may regulate embryonic germ cell meiotic initiation independent of RA signaling through the membrane PRs. This study provides a new insight into the mechanisms of germ cell meiotic initiation in the chicken. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Progesterone Germ cell Meiotic initiation Retinoic acid Chicken Progesterone receptor
1. Introduction Germ cells are unique because they undergo meiosis to generate haploid cells and form the basis for sexual reproduction. The signaling molecule retinoic acid (RA) has been identified as the key factor required for germ cells to enter meiosis [1,2]. Moreover, RA has been proved to trigger
* Corresponding author. Tel./fax: þ86 571 88982976. E-mail address: [email protected] (C. Zhang). 1 These authors contributed equally to this work. 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.03.021
germ cell meiotic initiation in the chicken [3,4]. However, recent observations have suggested that the first meiotic division does not necessarily require endogenous RA [5,6]. Germ cells in the fetal ovary are seen to enter meiosis in Raldh2/ or Raldh2//Raldh3/ mice which lack all RA synthesis and signaling [6]. These findings suggest that RA may not be the only inducer of meiosis secreted. Our previous results indicate that LH causes a significant increase of D5-3b-hydroxysteroid dehydrogenase (D53bHSD) transcription and promotes germ cell meiotic initiation [7]. The 3bHSD enzyme converts pregnenolone to progesterone (P4). In vertebrates, P4, along with other sex
2
Y. Mi et al. / Theriogenology xxx (2014) 1–9
steroid hormones, plays an important role in gametogenesis. In teleost fish, in which no RA signaling triggers have been reported [8,9], evidence indicates that progestin is an important factor for the initiation of meiosis for both spermatogenesis and oogenesis. However, it remains unclear whether progestins are able to modulate development of the fetal germ cells in species in which RA usually triggers meiotic initiation. The biological effects of P4 on target cells are elicited through two specific intracellular receptors, designated P4 receptor (PR) A and B [10]. The two PR subtypes are both expressed in the chicken embryonic gonads [11]. In the female chicken, P4 has been detected in serum during embryonic development and its level is increased from embryonic Day 9 (E9) to E15 and then was stabilized at E18 [12]. However, in these studies, the physiological role of this steroid was not clear. Nevertheless, the increase of serum P4 levels was coincident with the meiotic initiation of the germ cells in the ovaries of embryonic chickens [3,4]. It would be interesting to know if P4 acts as another signaling molecule, alongside RA, to initiate meiosis in vertebrates. In this study, we use both in vivo and in vitro systems to investigate the role of P4 in early stages of gametogenesis in the embryonic chicken. Moreover, we detected whether RA signaling is involved in this induction. The results will help to determine if P4 exists as another inducer, beyond that of RA, to regulate germ cell meiotic initiation. These results will provide a new insight into the mechanisms of germ cell meiotic initiation in the chicken. 2. Materials and methods 2.1. Animals Fertilized Hyline chicken (Gallus gallus) eggs were obtained from a commercial hatchery and incubated in an egg incubator at 38.5 C and at 60% humidity. All procedures were performed in accordance with the Guiding Principles for the Care and Use of Laboratory Animals of Zhejiang University. 2.2. Treatment of animal and tissue collection All in vivo injections were performed under sterile conditions using autoclave-sterilized instruments. Injections were applied to the air sac at E9.5. A dose of 2 mg/mL of P4 (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in sterile DMSO in a volume of 50 mL. A single dose of 50 mL P4 was administered per egg. The control was injected with 50 mL of DMSO. Left ovaries or testes were collected on the second day postinjection for RA concentration analysis, and Days 1, 2, 3, and 4 days postinjection for total RNA extraction and reversed transcription–polymerase chain reaction (RT-PCR) or fixation in 4% paraformaldehyde for fluorescence immunohistochemistry or 5 days postinjection for conventional paraffin histology with hematoxylin/eosin (H&E) staining. 2.3. Organ culture Individual left ovaries from E10.5 embryos or left testis from E13.5 embryos without mesonephros were removed for organ culture. Gonads were cultured on Millipore filters
according to a previously published method [13]. Each gonad was placed into a well of a 24-well plate containing 500 mL Dulbecco’s Modified Eagle Medium (GIBCO, Invitrogen Co., NY, USA) supplemented with 10 mg/mL insulin, 5 mg/mL transferrin, and 30 nM selenite (Sigma-Aldrich) as the complete medium. After 2 days of culture at 38.5 C/5% CO2, the ovaries were fixed in 4% paraformaldehyde for fluorescence immunohistochemistry. At the beginning of culture, the ovaries were challenged with 1 ng/mL P4 with or without AGN193109 (1 mM; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). 2.4. RNA extraction and RT-PCR Trizol reagent (Invitrogen Co., Carlsbad, CA, USA) was used to extract total RNA from tissues. The RNA purity and concentration was determined using a One Drop OD-1000þ Spectrophotometer (Nanjing Wuyi Technology Co., Nanjing, China) at 260/280 nm in the range of 1.8 to 2.0. Total RNA (2 mg) was reverse transcribed using a Fermentas One step RT-PCR kit (MBI Fermentas, Burlington, ON, Canada) according to the manufacturer’s instruction and further amplified by PCR. The PCR primers of mPRa, mPRb, and mPRg are listed in Table 1. 2.5. Real-time quantitative RT-PCR Real-time quantitative RT-PCR (qRT-PCR) was used to assess the expression of the premeiotic marker Stra8 (stimulated by RA gene), the meiotic markers Scp3 (a gene encoding a synaptonemal complex protein) and Dmc1 (a gene encoding a meiotic recombinase), RA metabolismrelated enzymes Raldh2 (a gene encoding retinaldehyde dehydrogenase, type 2, also called as Aldh1a2), and Cyp26b1 and RA receptor RARb (Table 1). The qPCR was carried out on an ABI 7300 HT real-time PCR machine (Applied Biosystems, Foster City, CA, USA) with the reaction volume of 20 mL consisting of complementary DNA from 10 ng of the original RNA template, 400 nM of each of the gene-specific forward and reverse primers, and 10 mL SYBR Premix Ex Taq (TaKaRa Bio Inc. Co., Dalian, China). Then, qRT-PCR was carried out in triplicate with a SYBR Premix Ex Taq in an ABI 7500 realtime PCR Detection System (Applied Biosystems). After normalization with the germ cell marker gene Cvh (a chicken homolog of vasa gene) or b-actin, relative RNA levels in the samples were calculated by the comparative threshold cycle method. The sequences of primers for PCR are listed in Table 1. The delta–delta Ct method was used to calculate relative fold-change values between samples [14]. 2.6. Immunofluorescence colocalization The Dazl protein (deleted in azoospermia-like, which is expressed in germ cells that enable those cells to initiate meiosis) was used as the germ cell marker [15]. The gH2AX protein (a phosphorylated histone variant found to be characteristic of double-strand breaks repair in mitotic cells) was used as the meiosis marker [16]. Frozen ovarian sections were performed with rabbit anti-Dazl antibody (1:200, ab113517; Abcam, Cambridge, UK) and mouse antigH2AX antibody (1:500, ab26350; Abcam) fluorescence
Y. Mi et al. / Theriogenology xxx (2014) 1–9
3
Table 1 Primers for PCR analysis. Gene
Accession no.
Primer sequences (50 –30 )
Product length (bp)
Stra8
XM_416179
166
Scp3
XM_416330
Dmc1
XM_425477
Raldh2
NM_204995
Cyp26b1
XM_426366
RARb
NM_205326
Cvh
NM_204708
mPRa
XM_003641865.2
mPRb
NM_001008462.1
mPRg
NM_001163651.1
b-actin
NM_205518
GTGAGGGACAGTGGAGGTAA CAGAAATGCCGCTTGTAAAT CTGTATTTCAGCAGTGGGATG TGCGAAGTTCATTTTGTGC AGATGACAACAAGACGAGCACT CAATCCCACCACCCAGAA GGCAGTTCTTGCTACTATGGA TCTGCCCAACCAGCGTAAT TTCGCCTCTTCACCCCCAT TGGAACCTGCCCTCCTTGTC CCTCGTGTTCACCTTTGC AGGCTTGTTGGGTCGTCT CGGATGATGAAAGATGGTGTA ATTTGACGGATTGAATGACCT CTCCTGCCCGTGACAATAACT CAACCAGAACAACCAACAGAAC CTTCCACACCTTCCTTGCTATC GAAAATCTCCTGCCTGTTCTTG ACTTCTCTGCCCTGTGTGTCTT GCCCCAAATCTCAATCTTCTT ACACCCACACCCCTGTGATGAA TGCTGCTGACACCTTCACCATTC
225 195 144 205 193 188 138 82 111 136
Abbreviation: PCR, polymerase chain reaction.
immunohistochemistry according to a previous method [7]. Furthermore, three mPRs a, b, and g were detected by immunofluorescence. Goat anti-mPRa, b, or g polyclonal antibodies (2 mg/mL) (sc-50111, sc-50109, or sc-28019, respectively; Santa Cruz Biotechnology Inc., CA, USA) were the primary antibodies. DyLight 549-rabbit anti-goat immunoglobulin G (1:1000; KPL Inc., Gaithersburg, MD, USA) was used as the secondary antibody. Sections were counterstained with 40 , 6-diamidino-2-phenylindole (Sigma-Aldrich). A negative control section was incubated with normal serum instead of primary antibodies. Mounted slides were visualized using a laser-scanning confocal microscope (FV1000; Olympus, Co., Tokyo, Japan). 2.7. Histologic observation For histologic study, gonads from E14.5 or E17.5 chickens with or without P4 treatment at E9.5 in vivo were dissected from embryos and fixed in 4% paraformaldehyde solution and then dehydrated in graded ethanol. Tissues were then embedded in paraffin. Five micron sections were mounted onto gelatin-coated slides and stained with standard H&E staining. Germ cells were recognized by their large size (20 mm) and pale cytoplasm relative to somatic cells. Meiotic germ cells were distinguished by the presence of condensed thread-like chromatins, as assessed by H&E staining. 2.8. High-performance liquid chromatography analysis of RA The tissues were homogenized in Dulbecco’s PBS using a tissue grinder in the presence of chloroform/methanol (1:1). Subsequently, the sample was extracted three times with addition of chloroform and centrifuged at 1000 g for 5 minutes. After passage through a reversed phase (C18 Sep-Pak; Millipore) cartridge with 0.1% trifluoroacetic acid
in methanol, the extract was concentrated through evaporation of the solvent under gas and was redissolved in 50% methanolic chloroform. An Alliance system (Waters Corp., Milford, MA, USA) equipped with a 2695 Separation Module, 2996 photodiode array detector, and 2475 multi l fluorescence detector was used for high-performance liquid chromatography analysis. For compound elution, an Atlantis dC18 (3 mm, 4.6 150 mm; Waters Corp.) reversephase column was used for the stationary phase. For the mobile phase, a gradient of acetonitrile in water with 0.1% trifluoroacetic acid: 75% to 90% acetonitrile (0–30 minutes); 90% to 100% acetonitrile (30–40 minutes); 100% acetonitrile (40–80 minutes) with a flow rate of 0.5 mL/min was used. Detection was by photodiode array, which was set at 350 nm. 2.9. Statistical analysis All data were expressed as the means standard error of the means and analyzed by t-test using the SPSS 16.0 software. P < 0.05 was considered as statistically different. 3. Results 3.1. P4 promoted female germ cell meiotic initiation To confirm meiotic induction resulting from P4 treatment in the embryonic ovarian germ cells, we first investigated the transcription of premeiotic marker Stra8 and meiotic markers Scp3 and Dmc1 in ovaries. Progesterone treatment significantly increased the expression levels of Stra8 mRNA from 3 days and Scp3 mRNA from 2 days (Fig. 1; P < 0.05). In contrast, Dmc1 mRNA expression was not increased (Fig. 1; P > 0.05), as detected by qRT-PCR. Progesterone induction of meiosis of P4, was further confirmed by gH2AX, as a marker of DNA double-strand breaks and
4
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 1. Expression of Stra8, Scp3, and Dmc1 of mRNAs in embryonic chicken ovaries after P4 treatment. Quantitative RT-PCR analysis of premeiosis marker Stra8, meiosis markers Scp3 and Dmc1 mRNAs expression in ovaries treated with P4 on E9.5 for 1, 2, 3, and 4 days, respectively. Cvh was used as the normalization control. Values are mean SEM of six experiments. An asterisk represents significant difference (P < 0.05); NS indicates no significant difference (P > 0.05). E, embryonic day; NS, not significant; P4, progesterone; RT-PCR, reversed transcription–polymerase chain reaction; SEM, standard error of the mean.
Dazl, a hallmark of meiosis and a germ cell marker, as revealed by double fluorescence staining on cryosections. Germ cells were detected in the cortex of the left ovary with Dazl immunolocalized in the cytoplasm. gH2AX was immunolocalized to the nuclei of germ cells in the ovarian cortex at E12.5 after P4 treatment (Fig. 2A). No gH2AX/Dazl double positive cells were demonstrated in the control individuals (Fig. 2A). As detected by H&E staining, meiosis germ cells were displayed in the control female ovarian cortex in E17.5 embryos (Fig. 2B). Most germ cells in the
E14.5 ovaries entered into meiosis with P4 treatment in E9.5, but no meiotic germ cells were observed in the control individuals in E14.5 ovaries (Fig. 2B). 3.2. P4 promoted male germ cell meiotic initiation in vitro but not in vivo To examine the effect of P4 in the male embryonic germ cells, we investigated the transcription of Stra8, Scp3, and Dmc1 mRNAs in left testes. From 1 to 4 days, no significant
Fig. 2. Effects of P4 on ovarian germ cell meiotic initiation by morphologic demonstration. (A) Histologic sections of the left ovaries with immunofluorescent labeling of germ cell marker, Dazl, and meiosis marker, gH2AX, after treatment with P4 on E9.5 for 3 days. (B) H&E staining of ovarian sections from E14.5 with or without P4 treatment and E17.5 embryos. Distribution of meiotic stages in germ cells in H&E staining sections after P4 treatment at E9.5 for 5 days or E17.5 ovaries. Arrowheads represent meiosis entry germ cells (red) and nonmeiosis entry germ cells (green). Scale bars: 20 mm. E, embryonic day; H&E, hematoxylin and eosin staining; P4, progesterone.
Y. Mi et al. / Theriogenology xxx (2014) 1–9
5
Fig. 3. Effects of P4 on testicular germ cell meiotic initiation. (A) Quantitative RT-PCR analysis of premeiosis marker Stra8, meiosis markers Scp3 and Dmc1 mRNAs in testes of embryos after treatment with P4 in E9.5 for 1, 2, 3, and 4 days, respectively. Cvh was used as the normalization control. Values are mean SEM of six experiments. NS indicates not significant difference (P > 0.05). (B) Histologic sections of E13.5 testes were cultured for 2 days in the presence or absence of 1 mg/ mL P4 with immunofluorescent labeling of the germ cell marker, Dazl, and meiosis marker, gH2AX. Scale bars: 20 mm. E, embryonic day; P4, progesterone; NS, not significant; RT-PCR, reversed transcription–polymerase chain reaction; SEM, standard error of the mean.
change of Stra8, Scp3, or Dmc1 mRNAs was shown in the testes after P4 treatment in vivo (Fig. 3A; P > 0.05). Moreover, no gH2AX-positive cells were immunolocalized to the nuclei of germ cells in the testes at E12.5 after treatment with P4 in E9.5 for 3 days (data not shown). In the next experiment, the E13.5 testes were separated from the mesonephros and cultured for 2 days in a serumfree medium with 1 ng/mL P4. In the testes cultured in the presence of P4, germ cells presented typical features of meiosis. The gH2AX were immunolocalized in germ cells with Dazl in the cytoplasm after P4 treatment (Fig. 3B). No gH2AX/Dazl double positive cells were demonstrated in the control testes (Fig. 3B). 3.3. P4 promoted germ cell meiosis independent of RA To examine signaling mechanisms involved in the stimulatory effect of P4, we treated the cultured E10.5 ovaries with P4 in the presence of the pan-RAR inhibitor AGN193109. Germ cells in the cultured ovaries entered into meiosis after treatment with P4 for 2 days as in the previous result [7]. Retinoic acid did stimulate germ cells to enter into meiosis, but AGN193109 blocked this stimulatory effect of RA on germ cell meiotic initiation. However,
AGN193109 did not block the stimulatory effect of P4 on germ cell meiotic initiation (Fig. 4A). Meanwhile, the expression of several enzymes crucial for the RA metabolism was also examined. Treatment with P4 did not cause significant changes in the mRNAs abundance of the RA synthesizing enzyme Raldh2 and the RA degrading enzyme Cyp26b1 from 1 to 4 days in the ovaries (Fig. 4B; P > 0.05). Furthermore, qRT-PCR did not reveal any significant changes in RAR (RARb) mRNA expression after treatment with P4 (Fig. 4B; P > 0.05). We next investigated whether the concentrations of RA in the ovaries were changed after P4 by high-performance liquid chromatography. No significant difference was detected in the E11.5 ovaries between the P4-treated (at E9.5 for 2 days) and the control individuals (Fig. 5). 3.4. Expression of membrane PRs by RT-PCR in the embryonic ovaries Because blockade of the nuclear PR by mifepristone failed to inhibit the action of P4 on meiotic initiation of embryonic ovarian germ cells, the membrane PR (mPR) may be involved in this mediation. Therefore, we detected the expression of three subtypes of mPR mRNAs in the
6
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 4. Effects of P4 on germ cell meiotic initiation independent of RA. (A) Histologic sections of E10.5 ovaries after treatment by P4 and RA with or without AGN193109 for 2 days with immunofluorescent labeling of the germ cell marker, Dazl, and meiosis marker, gH2AX. Scale bars: 20 mm. (B) Transcription of Raldh2, Cyp26b1, and RARb mRNAs in ovaries from the embryos which were treated with P4 at E9.5 for 1, 2, 3, and 4 days, respectively. Values are mean SEM of six experiments. NS indicates not significant difference (P > 0.05). E, embryonic day; NS, not significant; P4, progesterone; RA, retinoic acid; SEM, standard error of the mean.
ovaries at E13.5. All subtypes of mPRa, mPRb, and mPRg mRNA were detected in the ovaries (Fig. 6A). Among these subtypes, the gene expressions of mPRa and mPRb were higher than those of mPRg.
cells positive for mPRa and mPRb. These morphologic results are in accordance with the RT-PCR result.
3.5. Immunohistochemical demonstration of mPR in the embryonic ovaries
Successful gametogenesis requires the accurate interplay of many factors that orchestrate germ cell migration, proliferation, and meiosis initiation. Retinoic acid has been reported as a meiosis-inducing substance. Recently, many studies have revealed that germ cell meiotic initiation does not require endogenous RA [5,6]. To address this question, using an in vivo approach, we have demonstrated for the first time the potential role for P4 to act as a signaling molecule of germ cells differentiation independent of RA. Previous studies in chickens have indicated that premeiotic DNA synthesis begins in the germ cells of the left ovary between E15 and E16 [3,4,17]. In the female embryonic chicken, the plasma P4 levels increased about threefold
Finally, we demonstrated the distribution of mPRa, mPRb, and mPRg proteins in the embryonic ovaries at E13.5 by immunohistochemistry. The mPRa-positive cells were mainly scattered in the ovarian cortex area where most germ cells were distributed (Fig 6B). The mPRb-positive cells were widely distributed in the ovaries, and these positive cells were clustered in a manner similar to that of germ cell clusters in morphology. The mPRg-positive cells were scattered in the mesenchymal tissue, and the number of mPRg-positive cells was much lower than number of
4. Discussion
Y. Mi et al. / Theriogenology xxx (2014) 1–9
7
Fig. 5. Effects of P4 treatment on RA concentration in embryonic ovaries. Retinoic acid concentration in ovaries of E11.5 embryos that were treated with P4 at E9.5 for 2 days. (A) Standard reference (all-trans-retinoic acid 500 ng/mL); (B) control ovaries; (C) P4-treated ovaries. E, embryonic day; P4, progesterone; RA, retinoic acid.
8
Y. Mi et al. / Theriogenology xxx (2014) 1–9
Fig. 6. Demonstration of the membrane progesterone receptor expression by RT-PCR (A) and immunohistochemistry (B) in embryonic ovaries. (A) RT-PCR analysis of mPRa, mPRb, and mPRg mRNAs expression in ovaries in E13.5. b-actin was used as the normalization control. (B) Histologic sections of E13.5 ovaries were immunofluorescent labeled with mPRa, mPRb, and mPRg, respectively. The negative control section was incubated with normal serum instead of primary antibodies. Scale bars: 20 mm. E, embryonic day; RT-PCR, reversed transcription–polymerase chain reaction.
from E9 to E15, coincident with the initiation of the germ cell meiosis [12]. Here, we found that treatment with P4 in E9.5 embryos stimulated ovarian germ cells meiosis entry 3 days before the normal individuals. Moreover, histologic observations of the early stages of oogenesis suggest that P4 is involved in the initiation of the first meiotic division of oogonia. Our previous studies have demonstrated that P4induced germ cells in the cultured ovaries to enter into meiosis [7]. Altogether, these data suggest that P4 represents an important steroid in the initiation of meiosis in ovarian germ cells for the embryonic chicken. Progesterone treatment could not stimulate testicular germ cells meiosis entry in vivo. Interestingly, a low concentration of P4 was sufficient to promote testicular germ cell meiosis entry in the cultured testes. Taken together, P4 may be the initiator of germ cell meiotic initiation for both males and females. There was a very low level of P4 in the testes because, in the male gonads, P4 is converted to testosterone by steroidogenic enzymes, such as 17a-hydroxylase and/or 17b-hydroxysteroid dehydrogenase [18]. Therefore, the gonadal P4 levels and its metabolism determine whether female and male germ cells initiate meiosis during embryogenesis. It is likely that additional diffusible factors that were produced outside the testis may act to prevent germ cell meiosis entry in vivo. Previous studies have reported that Fgf9, Nanos2, Nodal signaling, and other factors are required for reinforcement of the male germ cell fate and act in preventing meiosis in the embryonic germ
cells [19–22]. More data here would help to explain why P4 was unable to induce testicular germ cells meiotic initiation in vivo and how testicular germ cells choose a male fate. The importance of RA in germ cell meiotic initiation has been suggested by several studies [1,2]. The retinoid signals are transduced by two families of receptors, RAR (RARa, b, and g) and RXR (RXRa, b, and g) receptors. Inhibition of RAR action has been shown to inhibit meiosis in RA-treated mouse fetal testes and ovaries [2]. To understand whether P4 action is related to RA signaling, we inhibited RAR using the RAR antagonist AGN193109 in the organ culture system. AGN194310 could not abolish the stimulatory effect of P4 on germ cell meiosis entry, indicating no involvement of RAR-mediated signaling in the P4-induced germ cell meiosis entry. Using qRT-PCR, we found no significant difference in the mRNA abundances of Raldh2, Cyp26b1, and RARb mRNAs between P4-treated and control ovaries. These results, taken together, demonstrate that there is no significant difference in RA concentrations between the P4treated and control ovaries, indicating that P4 may control meiosis progression independently to RA. Because no inhibition by the PR nuclear receptor antagonist mifepristone on P4 effect was observed in either in vitro or in vivo experiments, the effect of P4 on germ cell meiotic initiation is probably mediated by the mPRs. The mPRs are G protein–coupled receptors belonging to the adipoQ receptor family that mediate the P4 actions on the cell surface in the reproductive system. Interestingly,
Y. Mi et al. / Theriogenology xxx (2014) 1–9
the mPRs are restricted to the germ cells [23,24], and P4 is seen to regulate zebrafish spermatogenesis via PR [25]. A recent report showed that P4 could downregulate the PR mRNA expression in the granulosa cells of hens [26]. These studies indicate that P4 may interact with the mPRs, which are located on the germ cell and influence their development or physiological function. By RT-PCR and immunohistochemistry, we manifested the expression of mPRa, mPRb, and mPRg mRNAs and proteins in the embryonic ovaries. This result provides strong support for the involvement of mPR to mediate the P4 action on meiotic initiation in the embryonic germ cells. However, this hypothesis awaits further clarification. 4.1. Conclusions In conclusion, this study showed that P4 treatment at E9.5 can accelerate germ cell meiosis entry in the female chicken embryos and the common meiosis inducer RA was not involved in this process. These results suggest the existence of P4 as an inducer of meiosis initiation and P4 regulates embryonic germ cell meiotic initiation in a manner independent of RA signaling in the chicken. This study provides a new insight into the mechanisms of germ cell meiotic initiation in the chicken. Acknowledgments This study was supported by the National Natural Science Foundation of China (No. 31272525), Zhejiang Provincial Natural Science Foundation (Z3110115), Program for New Century Excellent Talents in University (NCET-13– 0519) and the Ph.D. Programs Foundation of Ministry of Education of China (20110101110099). We are grateful to Jun Li, Jie Li, and Weidong Zeng (Zhejiang University) for help in the experiments and Dr. Chris Wood (Zhejiang University) for English improvement in the manuscript. References [1] Bowles J, Knight D, Smith C, Wilhelm D, Richman J, Mamiya S, et al. Retinoid signaling determines germ cell fate in mice. Science 2006; 312:596–600. [2] Koubova J, Menke DB, Zhou Q, Capel B, Griswold MD, Page DC. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc Natl Acad Sci U S A 2006;103:2474–9. [3] Smith CA, Roeszler KN, Bowles J, Koopman P, Sinclair AH. Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid. BMC Dev Biol 2008;8:85. [4] Yu M, Yu P, Leghari IH, Ge C, Mi Y, Zhang C. Raldh2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in germ cells of the female embryonic chickens. Amino Acids 2013;44:405–12. [5] Griswold MD, Hogarth CA, Bowles J, Koopman P. Initiating meiosis: the case for retinoic acid. Biol Reprod 2012;86:35.
9
[6] Kumar S, Chatzi C, Brade T, Cunningham TJ, Zhao X, Duester G. Sexspecific timing of meiotic initiation is regulated by Cyp26b1 independent of retinoic acid signaling. Nat Commun 2011;2:151. [7] He B, Mi Y, Zhang C. Gonadotropins regulate ovarian germ cell mitosis/meiosis decision in the embryonic chicken. Mol Cell Endocrinol 2013;370:32–41. [8] Miura C, Higashino T, Miura T. A progestin and an estrogen regulate early stages of oogenesis in fish. Biol Reprod 2007;77:822–8. [9] Miura T, Higuchi M, Ozaki Y, Ohta T, Miura C. Progestin is an essential factor for the initiation of the meiosis in spermatogenetic cells of the eel. Proc Natl Acad Sci U S A 2006;103:7333–8. [10] Conneely OM, Maxwell BL, Toft DO, Schrader WT, O’Malley BW. The A and B forms of the chicken progesterone receptor arise by alternate initiation of translation of a unique mRNA. Biochem Biophys Res Commun 1987;149:493–501. [11] Gasc JM. Distribution and regulation of progesterone receptor in the urogenital tract of the chick embryo. An immunohistochemical study. Anat Embryol (Berl) 1991;183:415–26. [12] Martin B, Gasc JM, Thibier M. C21-Steroid binding proteins and progesterone levels in chicken plasma during ontogenesis. J Steroid Biochem 1977;8:161–6. [13] He B, Lin J, Li J, Mi Y, Zeng W, Zhang C. Basic fibroblast growth factor suppresses meiosis and promotes mitosis of ovarian germ cells in embryonic chickens. Gen Comp Endocrinol 2012;176: 173–81. [14] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101–8. [15] Gill ME, Hu YC, Lin Y, Page DC. Licensing of gametogenesis, dependent on RNA binding protein DAZL, as a gateway to sexual differentiation of fetal germ cells. Proc Natl Acad Sci U S A 2011;108: 7443–8. [16] Hunter N, Börner GV, Lichten M, Kleckner N. Gamma-H2AX illuminates meiosis. Nat Genet 2001;27:236–8. [17] Callebaut M. Premeiosis and premeiotic DNA synthesis in the left ovary of the female chick embryo. J Embryol Exp Morphol 1967;18: 299–304. [18] Sechman A, Hrabia A, Lis MW, Niedzió1ka J. Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on steroid concentrations in blood and gonads of chicken embryo. Toxicol Lett 2011;205:190–5. [19] Barrios F, Filipponi D, Pellegrini M, Paronetto MP, Di Siena S, Geremia R, et al. Opposing effects of retinoic acid and FGF9 on Nanos2 expression and meiotic entry of mouse germ cells. J Cell Sci 2010;123:871–80. [20] Bowles J, Feng CW, Spiller C, Davidson TL, Jackson A, Koopman P. FGF9 suppresses meiosis and promotes male germ cell fate in mice. Dev Cell 2010;19:440–9. [21] Guerquin MJ, Duquenne C, Lahaye JB, Tourpin S, Habert R, Livera G. New testicular mechanisms involved in the prevention of fetal meiotic initiation in mice. Dev Biol 2010;346:320–30. [22] Souquet B, Tourpin S, Messiaen S, Moison D, Habert R, Livera G. Nodal signaling regulates the entry into meiosis in fetal germ cells. Endocrinology 2012;153:2466–73. [23] Hanna RN, Zhu Y. Expression of membrane progestin receptors in zebrafish (Danio rerio) oocytes, testis and pituitary. Gen Comp Endocrinol 2009;161:153–7. [24] Thomas P, Tubbs C, Detweiler C, Das S, Ford L, BreckenridgeMiller D. Binding characteristics, hormonal regulation and identity of the sperm membrane progestin receptor in Atlantic croaker. Steroids 2005;70:427–33. [25] Chen SX, Bogerd J, García-López A, de Jonge H, de Waal PP, Hong WS, et al. Molecular cloning and functional characterization of a zebrafish nuclear progesterone receptor. Biol Reprod 2010;82: 171–81. [26] Wei Q, Zhu G, Cui X, Kang L, Cao D, Jiang Y. Expression of CCT6A mRNA in chicken granulosa cells is regulated by progesterone. Gen Comp Endocrinol 2013;189:15–23.