Proinflammatory Cytokines Induce Lymphocyte Apoptosis in Acute African Swine Fever Infection

J. Comp. Path. 2005, Vol. 132, 289–302

www.elsevier.com/locate/jcpa

Proinflammatory Cytokines Induce Lymphocyte Apoptosis in Acute African Swine Fever Infection F. J. Salguero, P. J. Sa´nchez-Cordo´n, A. Nu´n˜ez, M. Ferna´ndez de Marco and J. C. Go´mez-Villamandos Departamento de Anatomı´a y Anatomı´a Patolo´gica Comparadas, Edificio de Sanidad Animal, Campus Universitario de Rabanales, Universidad de Co´rdoba, 14014 Co´rdoba, Spain

Summary Twenty-one pigs inoculated with a highly virulent isolate (E70) of African swine fever (ASF) virus were killed 1–7 days later; a further three animals served as uninfected controls. An early increase in TNF-a, IL1a, IL-1b and IL-6 expression was detected in lymphoid organs from infected animals, together with an increase in the serum concentrations of TNF-a and IL-1b. These changes were accompanied by increased apoptosis of lymphocytes, and the presence of infected and uninfected macrophages showing changes indicative of secretory and phagocytic activation. The present study demonstrated an increase in the number of macrophages expressing TNF-a, IL-1 and IL-6 in proximity to lymphocytes undergoing apoptosis, supporting previous suggestions that in acute ASF proinflammatory cytokines induce lymphocyte apoptosis. q 2005 Elsevier Ltd. All rights reserved. Keywords: African swine fever; apoptosis; cytokines; pig; viral infection

Introduction African swine fever (ASF) is a viral disease that affects animals of the Suidae family (Wardley et al., 1983), and soft ticks of the genus Ornithodoros (Plowright et al., 1969) can also be infected. It is caused by the only member of the recently created family Asfarviridae (Dixon et al., 2000). ASF was first described in Kenya in 1921 (Montgomery, 1921) as an acute disease with high mortality and extensive haemorrhages in tissues, and was subsequently recognized in other countries of Africa, where it continues to be economically devastating (Oura et al., 1998). The most characteristic lesions are severe lymphoid depletion and haemorrhages in lymphoid organs (Moulton and Coggins, 1968; Wilkinson et al., 1981; Carrasco et al., 1996, 1997). Acute ASF is characterized by lymphopenia and a state of Correspondence to: J.C. Go´mez-Villamandos. 0021-9975/$ - see front matter

doi:10.1016/j.jcpa.2004.11.004

immunodeficiency (Sa´nchez-Vizcaı´no et al., 1981), but the factors contributing to the development of these phenomena are unknown (Oura et al., 1998). The destruction of the lymphoid tissues was initially described as necrotic cell death (Konno et al., 1972; Mebus, 1987, 1988). Recently, however, it has been attributed to apoptosis, because it has been observed in uninfected lymphocytes in lymph nodes and in the interstitium of liver and kidney tissues (Go´mez-Villamandos et al., 1995a,b; Carrasco et al., 1996; Oura et al., 1998). The main target cell of ASF virus (ASFV) is the monocyte-macrophage (Mebus, 1988) and this is believed to play a critical role in the pathogenesis of the disease (Colgrove et al., 1969; Go´mezVillamandos et al., 1995a; Go´mez del Moral et al., 1999). Monocyte-macrophages secrete a large range of soluble mediators, including proinflammatory cytokines such as interleukin-1 (IL-1), IL-6 and tumour necrosis factor alpha (TNF-a) (Murtaugh et al., 1996). q 2005 Elsevier Ltd. All rights reserved.

290

F.J. Salguero et al.

Recently, the increase in TNF-a expression was suggested to play a role in the pathogenesis of ASF (Go´mez del Moral et al., 1999). Moreover, Salguero et al. (2002) described an increase in the serum concentrations of TNF-a and IL-1b in acute ASF, together with an increase in the number of cells expressing TNF-a, IL-1a, IL-1b and IL-6 in spleen and lymph nodes. The aim of the present study was to examine, in pigs infected with a highly virulent isolate of ASFV, the expression pattern of TNF-a, IL-1 and IL-6 and the quantitative and qualitative changes in lymphocytes and monocyte-macrophages in lymphoid organs (spleen, lymph nodes and thymus).

Materials and Methods Animals, Virus and Experimental Design Large White!Landrace pigs (nZ24) of either sex, weighing 30 kg, were used. The animals, which were clinically healthy and free of antibodies against the viruses of ASF, classical swine fever, Aujeszky’s disease and porcine reproductive and respiratory syndrome were housed in isolation at the Centro de Investigacio´n en Sanidad Animal (CISA-INIA) in Valdeolmos, Spain. Twenty-one pigs were inoculated intramuscularly in the shoulder with 105 haemagglutinating doses (HAD)50 of a highly virulent isolate of ASFV (Espan ˜ a-70; “E-70”) and killed daily in batches of three at 1–7 days postinoculation (dpi). The remaining three pigs (uninoculated controls) were housed in a separate box and killed at the end of the experiment. This experiment was carried out in accordance with the Code of Practice for Housing and Care of Animals used in Scientific Procedures (Directive 86/609/EEC).

Blood Collection and ELISA Blood samples were taken from the anterior vena cava of control animals to obtain baseline values, and from inoculated animals at 2, 4 and 6 dpi. Serum was separated for ELISA analysis. Commercial ELISA kits were used to measure TNF-a (Porcine Tumor Necrosis Factor Alpha ELISAw; Endogen, Woburn, CA, USA) and IL-1b (Swine IL1b Cytoscreenw; Biosource, Camarillo, CA, USA). Absorbency of ELISA plates was measured by spectrophotometry (Easy Reader EAR 400w; SLTLabInstruments, Wien, Austria).

Tissue Samples Animals were tranquilized with azaperone (Stresnilw; Janssen Animal Health, Beerese, Belgium) and killed with a lethal dose of sodium thiopental (Thiovetw; Vet Limited, Leyland, Lancashire, England). Samples from spleen, thymus and renal and gastrohepatic lymph nodes were fixed in 10% buffered formalin, acetic formalin, Bouin’s solution or paraformaldehyde-lysine-periodate (PLP). After fixation, the samples were dehydrated through a graded series of alcohol to xylol and embedded in paraffin wax. For structural and immunohistochemical analysis, sections (3 mm) were cut and stained with haematoxylin and eosin (HE) or processed for immunohistochemical examination. Samples for transmission electron microscopy (TEM) were embedded in Epon 812 (Fluka, Buchs, Switzerland) and sections (50 nm) were stained with uranyl acetate and lead citrate and viewed with a Philips CM-10 electron microscope. Immunohistochemical Methods The avidin-biotin-peroxidase complex (ABC) technique was used (1) to detect monocyte-macrophages, with a monoclonal anti-SWC3 antibody, as previously described (Salguero et al., 2002), and (2) to study expression of TNF-a, IL-1a, IL-1b, IL-6 (with monoclonal and polyclonal antibodies as described by Salguero et al. [2001]), C1q as described by Ruiz-Villamor et al. (2001) and viral protein 73 (vp73) of ASFV (as described by Pe´rez et al. [1994]). After dewaxing and dehydration, endogenous peroxidase activity was quenched by incubation with hydrogen peroxide 3% in methanol for 45 min at room temperature. Enzymatic digestion with pronase 0.1% in phosphate-buffered saline (PBS) or “permeabilization” with Tween-20 0.1% in PBS was used to unmask antigens. Tissue sections were then rinsed in 0.01 M PBS, pH 7.4, and incubated with 10% normal goat serum (NGS) (Sigma Chemical Company, Poole, Dorset, UK) for 30 min at room temperature. Primary antibody, diluted in NGS 10%, was incubated overnight at 48C. Details of the primary antibodies, dilutions and antigen retrieval techniques are shown in Table 1. For detection of TNF-a, IL-1a, IL-b and IL-6, a secondary goat anti-rabbit immunoglobulin G (Vector Laboratories, Burlingame, CA, USA) diluted 1 in 20 in PBS was used; and for detection of vp73 and SWC3, a secondary goat anti-mouse immunoglobulin G (Dako, Glostrup, Denmark) diluted 1 in 100 in PBS was used. An avidinperoxidase-complex kit (Vectastain ABC Kit Elite;

291

Cytokines and Apoptosis in Acute ASF Table 1 Details of the immunolabelling reagents Specificity

pAb/mAb

ASFV vp73

mAb

Human IL-1a Human IL-1b Human TNF-a Porcine IL-6 SWC3 Swine C1q

pAb pAb pAb pAb mAb pAb

Dilution*

Fixative 10% Buffered formalin solution Bouin’s solution Acetic formalin PLP Bouin’s solution Bouin’s solution 10% Buffered formalin solution

Pretreatment †

Source

1 in 10

Pronase

Ingenasa, Madrid, Spain

1 in 100 1 in 150 1 in 500 1 in 10 1 in 10 1 in 5000

Tween 20‡ None Microwave§ Tween 20 Microwave Pronase

Endogen, Woburn, CA, USA Endogen, Woburn, CA, USA Genzyme, Cambridge, CA, USA Endogen, Woburn, CA, USA Biovet-UCO, Co´rdoba, Spain Institut fu¨r Pathologie, Tierarztlichen Hochschule, Hannover, Germany

pAb, Polyclonal antibody; mAb, monoclonal antibody; PLP, paraformaldehyde-lysine-periodate. * In PBS containing normal goat serum 10%. † Incubation with pronase 0.1% in PBS for 10 min at RT. ‡ Incubation with Tween 20 0.1% in PBS for 10 min at RT. § Incubation with 0.1 M citric acid (pH 6.0) for 5 min in microwave oven.

Vector) was used and 3,3 0 -diaminobenzidine tetrahydrochloride (DAB; Sigma) diluted to 0.035% in Tris buffered saline (pH 7.6) containing hydrogen peroxide 0.01% was applied for 1 min as chromogen. The streptavidin-biotin-alkaline phosphatase technique (SABAP) (StrAviGen; Biogenex, San Ramo´n, CA, USA) was also used in accordance with the manufacturer’s instructions. The slides were then counterstained with Mayer’s haematoxylin for 1 min, dehydrated, and mounted. Specific primary antibodies were replaced by PBS, normal mouse serum or normal rabbit serum in negative control sections. In-situ Hybridization (ISH) Samples used for these studies were treated in conditions and environments free of RNAses. Sections were dewaxed, rehydrated and incubated in PBS containing proteinase K (Roche, Basel, Switzerland) 1 mg/ml for 15 min at 378C. Samples were rinsed in glycine 0.2% in PBS. Acetylation was performed, to reduce the nonspecific binding of

the probe to other reactive groups, in 0.1 M triethanolamine (pH 8.0); after incubation for 5 min at room temperature (RT), acetic anhydride 0.25% was added and 5 min later the sections were rinsed in distilled water. Sections were rinsed in 2! standard saline citrate (SSC) (1! SSC is 150 M NaCl plus 15 M sodium citrate [pH 7.0]) and denatured in deionized formamide 60% in 0.1! SSC for 15 min at 658C. Sections were incubated for 45 min at 378C in a prehybridization mixture containing 50% deionized formamide, 2x SSC, 1% Denhardt’s solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), salmon testis DNA 500 mg/ml and polyadenosine 500 mg/ml, in diethylpyrocarbonate (DEPC)-treated water. The sections were then incubated in the hybridization mixture containing dextran sulphate 10% and 0.1 ng of labelled probe. DNA probes specific for hybridization with TNF-a, IL-1a and IL-b mRNAs (Table 2) were labelled by means of a commercial kit (DIG Oligonucleotide Tailing Kit; Boehringer Mannheim Corp., Indianapolis, USA).

Table 2 Sequences of probes Cytokine TNF-a (Genbank x57321)

IL-1a (Genbank x52731)

IL-1b (Genbank M86725)

Sequence 244–291: GCCTCTTCTCCTTCCTCCTGGTCGCAGGAGCCACCACGCTCTTCTGCC 456–490: AGTGGGTATGCCAATGCCCTCCTGGCCAACGGCGT 573–607: TGCCCTTCCACCAACGTTTTCCTCACTCACACCAT 604–653: CCATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCCTCTCT 111–158: ATATCGACCATCTCTCTCTGAATCAGAAGTCCTTCTATGATGCCAGCT 441–475: GCATCCTGAATGATGCCCGCAATCAAAGCATCATT 541–588: TGACATGGCTGCTTATACATCAAATGATGATTCGCAACTTCCTGTGAC 127–174: GACCTGTTATTTGAGGCTGATGGCCCCAAAGAGATGAAGTGCTGCACC 354–388: CTTTGAAGAAGAGCCCATCATCCTTGAAACGTGCA 861–907: CTCTCCCTAAGGAAAGCCATACCCAGAGGTCCACATGGGCTGAAGAA

292

F.J. Salguero et al.

The hybridization was carried out overnight at 428C, after which the slides were washed twice in 2! SSC for 5 min at 428C and once in each of the following: 1! SSC for 5 min at 428C, 0.5! SSC for 5 min at 428C, 0.1! SSC for 5 min at 428C, and Tris–HCl buffer (pH 7.4) for 5 min at RT. Sections were incubated in a solution of bovine serum albumin 1% and Triton X-100 0.1% in Tris–HCl buffer (pH 7.4). The anti-digoxigenin-alkaline phosphatase conjugate (Boehringer Mannheim) was diluted 1 in 400 in buffer II (1% blocking reagent in buffer I; Boehringer Mannheim) and then added to the tissue sections. Incubation was carried out in a humidified chamber for 1 h at RT. Slides were washed at RT, twice in buffer I (5 min each wash) and once in buffer III (100 mM Tris–HCl, 100 mM NaCl, 50 mM MgCl2 [pH 9.5]) for 5 min. Finally, slides were incubated in the dark with colour substrate solution consisting of 4-nitroblue tetrazolium chloride (Boehringer Mannheim) and 5-bromo-4-chloro-3-indolylphosphate (X-phosphate; Boehringer Mannheim) in buffer III. The colour reaction was stopped in TE buffer (10 mM Tris–HCl, 1 mM EDTA [pH 8.0]). Slides were washed with distilled water, air dried, and “coverslipped” before light microscopical examination. Positive and negative controls were always included. Peripheral blood mononuclear cells (PBMCs) stimulated with lipopolysaccharide (LPS) were used as a positive control of the technique, and negative controls did not include the labelled probe. In–situ Detection of Apoptosis Tissue sections were dewaxed, rehydrated, and treated for quenching of endogenous peroxidase activity as described above. Sections were permeabilized by incubation in PBS containing proteinase K (Roche) 20 mg/ml in PBS for 20 min and washed twice for 5 min in PBS. The terminal

deoxynucleotidyltransferase-mediated dUTP nick end labelling (TUNEL) method was used for the histological detection of apoptotic cells. The cells were detected with a kit containing horseradish peroxidase (In Situ Cell Death Detection kit, PODw; Roche) according to the manufacturer’s directions. The colour reaction was developed with DAB and slides were counterstained with Mayer’s haematoxylin. Negative controls were always included in each series of sections assayed.

Cell Counting and Statistical Analysis Cells immunolabelled for TNF-a IL-1a, IL-1b or IL-6 were counted in 50 randomly selected, high magnification fields of 0.20 mm2 (red pulp of the spleen, medulla and cortex of lymph nodes and thymus) or 50 randomly selected structures (splenic follicles and splenic marginal zones) for each inoculated or uninoculated animal. The numbers of m-Mf (monocyte-macrophages) were counted in tissue sections immunolabelled with SWC3. Results were expressed as meanGstandard deviation (xGSD) of immunoreactive cells per mm2 (red pulp of the spleen, medulla and cortex of lymph nodes) or cells per structure (splenic follicles or splenic marginal zone). Data were examined by the analysis of variance, followed by the t-paired Student test for mean comparisons. Differences between control and inoculated animals were considered to be significant at P!0.05. Samples labelled with TUNEL, anti-ASFV vp73 or anti-C1q were counted in 25 fields of 0.20 mm2 (red pulp of the spleen, medulla and cortex of lymph nodes and thymus) or 25 structures (splenic follicles and splenic marginal zones). Results (number of cells per mm2 or structure) were recorded as follows: –, none; K/C, 1–5; C, 6–25; CC, 26–50; CCC, 51–100; CCCC, O100.

Table 3 Positive cells immunolabelled for ASFV vp73 Immunopositive cells* detected in groups of 3 pigs Infected pigs, at the stated times (dpi) Organ and structure Splenic cords† Splenic marginal zone‡ Splenic follicle‡ Lymph node cortex† Lymph node medulla† Thymic cortex† Thymic medulla†

Controls

1

2

3

4

5

6

7

– – – – – – –

K/C K/C – – K/C – –

CC K/C K/C C CC – –

CC C C CC CCC K/C CC

CCCC CC CC CC CCC CC CCC

CCCC CC C CCC CCCC CCC CCC

CCC C C CCC CCC CC CCC

CCC C C CC CC C CC

*Number of cells per mm2 (†) or per structure (‡): –, none; K/C, 1–5; C, 6–25; CC, 26–50; CCC, 51–100; CCCC, O100.

Cytokines and Apoptosis in Acute ASF

293

Fig. 1 A–D. Immunohistochemical detection of the viral protein 73 of ASFV (ABC technique) in the spleen (A, !400), renal lymph node (B, !400) and thymus (C, !630) at 5 dpi. Virus “factory” in the cytoplasm of a macrophage of the splenic cords (TEM) at 5 dpi (D, !14 000).

294

F.J. Salguero et al.

The control animals remained healthy, but from 2 dpi inoculated animals began to show nonspecific clinical signs, consisting of fever, loss of appetite, and respiratory and digestive disorders. Macroscopical post-mortem lesions, typical of ASF and seen from 2 dpi, consisted of haemorrhagic splenomegaly and haemorrhagic lymphadenitis (especially of gastrohepatic and renal lymph nodes). Some animals showed hydrothorax, hydropericardium, and petechiae in the kidney, epicardium and gall bladder. The thymus showed no macroscopical change.

depletion from 3 dpi, affecting follicles and diffuse lymphoid tissue. The thymus showed no change until 3 dpi, when lymphoid depletion was observed, initially in the medulla. Lymphoid depletion appeared in the cortex at 4 dpi, thereafter increasing in severity. Some “tingible-body” macrophages, with abundant cytoplasm containing cell debris were identified from 3 dpi, predominantly in the cortex. These processes gave rise to the so-called “starry-sky” appearance, leading to an intense depletion of the thymic cortex at 6–7 dpi. No significant vascular changes were noted in the course of the disease, apart from a light perivascular infiltrate of mononuclear cells in the cortex and capsule from 5 dpi.

Cytokines in Sera

Viral Infection

Results for controls animals were invariably below the sensitivity of the kit used, but cytokines in the blood of infected pigs were significantly increased from 2 dpi onwards. Thus, TNF-a values (pg/ml) were 63G16 at 2 dpi, 109G24 at 4 dpi and 202G26 at 6 dpi. IL-1b values (pg/ml) were 311G73 at 2 dpi and 1214G164 at 4 dpi, decreasing to 188G 21 at 6 dpi.

Viral antigen was detected in inoculated animals from 1 dpi onwards in the spleen and lymph nodes and from 3 dpi onwards in the thymus (Table 3). No positive cells were found in uninfected controls. Most immunopositive cells were monocyte-macrophages, but some positive reticular-epithelial cells and fibroblasts were also observed. Positive cells were more abundant in splenic structures, mainly the splenic cords, from 1 dpi until 4–5 dpi (Fig. 1A). Thereafter, the number of positive cells decreased, and immune reactions were occasionally observed in cell debris. The number of immunopositive cells increased in the cortex and medulla of lymph nodes from 1 to 6 dpi (Fig. 1B); a decrease at 7 dpi coincided with immunolabelling of cell debris. The thymus showed positive cells from 3 dpi onwards, mainly in the medulla and the corticomedullary junction (Fig.1C) Viral infection was confirmed by electron microscopy. Infected cells were found to contain typical ASFV replication sites and a cytopathogenic effect, consisting of rounding of nuclei, peripheral margination of chromatin, and development of

Results Clinical Findings and Gross Pathology

Histopathology No pathological changes were found in control animals. Haemorrhagic splenomegaly increased in intensity as the disease developed, and the splenic red pulp became filled with erythrocytes, fibrin deposits and cellular debris. The marginal zone surrounding follicles was filled with erythrocytes. Foci of dead cells were present from 2 dpi in splenic follicles, lymphocyte depletion being severe at such sites from 3 dpi. Lymphocyte depletion was also observed in perivascular lymphoid sheaths. Haemorrhages in the lymph nodes were observed from 3 dpi, and there was severe lymphoid

Table 4 Apoptotic cells detected by TUNEL method Apoptotic cells* detected in groups of 3 pigs Infected pigs, at the stated times (dpi) Organ and structure †

Splenic cords Splenic marginal zone‡ Splenic follicle‡ Lymph node cortex† Lymph node medulla† Thymic cortex† Thymic medulla†

Controls K/C K/C K/C CC C CC C

1

2

3

C K/C K/C CC C CC C

CC C CC CCC CC CC C

CCC C CC CCC CCC CCC CC

4 CCCC CC CCC CCCC CC CCCC CCC

5 CCCC CC CCC CCCC CCC CCCC CCCC

6 CCCC CC CC CCC CC CCCC CCC

*Number of cells per mm2 (†) or per structure (‡): K/C, 0–5; C, 6–25; CC, 26–50; CCC, 51–100; CCCC, O100.

7 CCC C CC CCC CC CCCC CCC

Cytokines and Apoptosis in Acute ASF Fig. 2 A–D. Apoptosis of lymphocytes in the splenic cords at 5 dpi (TUNEL technique); presence of apoptotic bodies phagocytized by macrophages (A, !630; B, !630). Apoptotic lymphocytes in splenic follicle at 5 dpi (TEM) showing condensation and fragmentation of the chromatin (C, !2000) and phagocytosis of an apoptotic body by a macrophage of the splenic cords at 5 dpi (D, !9000).

295

296

F.J. Salguero et al.

cytoplasmic vacuoles. Elongated membranous structures and viral particles of 175–195 nm diameter, some with an electron-dense nucleoid, were observed in these replication sites (Fig. 1D). Apoptosis TUNEL-positive cells (Table 4) increased in number from 2 dpi onwards in spleen and lymph nodes, and from 3 dpi onwards in thymus. These cells included pyknotic lymphocytes and macrophages (Fig. 2A), the latter displaying phagocytosis of strongly labelled apoptotic bodies (Fig. 2B). Apoptotic lymphocytes were observed in both B and T areas of lymphoid organs. The number of TUNELpositive cells peaked between 3 and 5 dpi and then decreased strikingly in the splenic follicles and the lymph nodes, leading to atrophy. Ultrastructural examination confirmed the apoptosis observed by histopathological and TUNEL examination. Apoptosis was characterized by condensation and margination of chromatin,

and by fragmentation of cell nuclei and cytoplasm (Fig. 2C), these features being more widespread than in uninoculated controls. As the disease progressed, the characteristic signs of apoptosis increased, including the appearance of apoptotic bodies (membrane-bounded fragments of cytoplasm and condensed nuclear chromatin), some of which were phagocytized by macrophages (Fig. 2D). Changes in Monocyte-Macrophages The number of m-Mf increased in the splenic structures from 2 dpi, decreasing in the splenic marginal zone from 4 dpi and in splenic cords from 6 dpi onwards, to levels equal to or lower than those recorded in the uninoculated controls. The number of m-Mf in the splenic follicles increased significantly from 2 dpi onwards and in the gastrohepatic and renal lymph nodes from 3 dpi onwards, mainly in the cortex. In the lymph node medulla, the number decreased from 5 dpi

Fig. 3 A–C. Numbers (meansGSD) of the immunolabelled m-Mf expressing IL-1a (&), TNF-a (,), IL-1b ( ) and IL-6 ( ) in splenic cords (A), splenic marginal zone (B) and splenic follicles (C). * Significantly different (P!0.05) from controls.

Cytokines and Apoptosis in Acute ASF

297

Fig. 4 A, B. Numbers (meansGSD) of the immunolabelled m-Mf expressing IL-1a (&), TNF-a (,), IL-1b ( ) and IL-6 ( ) in lymph node cortex (A) and medulla (B). * Significantly different (P!0.05) from controls.

onwards to levels below those observed in uninoculated controls. In the thymus, the m-Mf increased significantly from 3 dpi onwards in the cortex and from 4 dpi onwards in the medulla. Immunopositivity in respect of all the cytokines studied was seen mainly in monocyte-macrophages, although some neutrophils and reticular endothelial cells were immunolabelled for TNF-a and

IL-1a. A few IL-1b-positive fibroblasts were observed. M-Mf also exhibited subcellular changes indicative of secretory activation, in the same areas in which lymphocyte apoptosis was taking place; these changes included a decrease in heterochromatin, the proliferation of rough endoplasmic reticulum cisternae, and Golgi complex activation.

Fig. 5 A,B. Numbers (meansGSD) of the immunolabelled m-Mf expressing IL-1a (&), TNF-a (,), IL-1b ( ) and IL-6 ( ) in thymus cortex (A) and medulla (B). * Significantly different (P!0.05) from controls.

298

F.J. Salguero et al.

IL-1a was the first chemical mediator that increased in the different splenic structures, while TNF-a was expressed particularly strongly in the later stages of the experiment in the splenic cords and the splenic follicles. IL-1a increased significantly from 2 dpi in the splenic cords and the marginal zone and from 4 dpi in the follicles. Striking expression of proinflammatory cytokines by m-Mf in the spleen was observed at 1–3 dpi in the marginal zone, at 5–7 dpi in the splenic follicles and at two peaks in the splenic cords; one of these peaks (at 1–3 dpi) coincided with the maximum expression of IL-1a, and the other (at 5–7 dpi)

coincided with the maximum expression of TNF-a in this structure (Fig. 3). As observed in the spleen, IL-1a increased significantly from 1 dpi in the lymph node cortex. TNF-a and IL-6, were expressed strongly in the lymph node medulla. The increase of these cytokines coincided with the presence of apoptotic lymphocytes and haemorrhages in renal and gastrohepatic lymph nodes (Fig. 4). The cytokines studied increased significantly from 3–5 dpi in the thymic cortex and medulla until the end of the experiment (Fig. 5). This resembled the results in the splenic follicles in

Fig. 6 A–F. Splenic follicle, 5 dpi. Hypocellularity and pyknosis (A: HE, !200), apoptosis of lymphocytes (B: TUNEL technique; ! 200), increased number of m-Mf (C: immunohistochemical detection of SWC3 by ABC technique; !400), and expression of TNF-a (D: SABAP, !400), IL-1a (E: ABC; !200) and IL-1b (F: ABC; !200).

299

Cytokines and Apoptosis in Acute ASF

Moreover, the number of m-Mf immunolabelled for C1q complement factor increased from 3–4 dpi, mainly in the splenic follicles and the cortex and the medulla of the thymus and lymph nodes; thereafter, the number declined (at 6–7 dpi) in the splenic structures to levels similar to those observed in the uninoculated controls (Table 5).

Discussion

Fig. 7 A–D. Thymus, 6 dpi. “Starry-sky” appearance (A: HE; ! 100) and ISH detection of IL-1a mRNA (B; !200), IL-1b mRNA (C; !200) and TNF-a mRNA (D; !200).

respect of the association with lymphocyte apoptosis, with an increase in the number of m-Mf and with the production of IL-1a, TNF-a, IL-1b and IL-6 in the splenic follicles (Fig. 6). The expression of mRNA of IL-1a, TNF-a and IL1b accorded with the immunolabelling of these cytokines and with the presence of histopathological changes (Fig. 7).

The destruction of monocyte-macrophages in ASF is due to the action of ASFV on these cells (Mebus, 1987). This destruction has been attributed to apoptosis (Ramiro-Iban ˜ ez et al., 1996) or necrosis (Sierra et al., 1989), the former being considered more likely (Go´mez-Villamandos et al., 1995a,b; Carrasco et al., 1996). Moreover, the ASFV genome contains two open reading frames that are homologous with proteins known to inhibit apoptosis (Brun et al., 1996). An ASFV gene, 5-HL, contains all known protein domains associated with bcl-2 activity (Afonso et al., 1996) and its protein product, p21, was found to suppress apoptotic cell death in a mammalian lymphoid cell line (Oura et al., 1998). A second ASFV gene was found to be homologous with baculovirus iap genes, which encode proteins that inhibit apoptosis during viral infection (Chaco´n et al., 1995; Ya´nez et al., 1995). These two genes may promote survival of infected macrophages, resulting in a more efficient productive infection (Oura et al., 1998). The factors that contribute to the severe lymphopenia observed in ASF are still unknown (Oura et al., 1998). Acute ASF is characterized by lymphopenia and a state of immunodeficiency (Sa´nchez-Vizcaı´no et al., 1981), together with haemorrhages. The characteristic massive destruction of lymphoid tissues was initially described as necrotic cell-death (Konno et al., 1972; Mebus, 1987). Recent TEM studies demonstrated that lymphocyte cell-death in pigs inoculated with a virulent ASFV isolate (Malawi’83) was due to apoptosis (Go´mez-Villamandos et al., 1995a,b; Carrasco et al., 1996). By the TUNEL technique, a large proportion of lymphocytes from B and T areas, and from the marginal zone of the spleen, showed positivity in pigs inoculated with the Malawi’83 isolate (Oura et al., 1998). In the present study, similar results were obtained with the virulent Espan ˜ a-70 isolate. Phagocytic activation of monocyte-macrophages has been described in ASFV infection (Go´mezVillamandos et al., 1995a; Carrasco et al., 1997) and is not affected by viral replication in these cells.

300

F.J. Salguero et al. Table 5 Positive cells immunolabelled for C1q Immunopositive cells* detected in groups of 3 pigs Infected pigs, at the stated times (dpi)

Organ and structure †

Splenic cords Splenic marginal zone‡ Splenic follicle‡ Lymph node cortex† Lymph node medulla† Thymic cortex† Thymic medulla†

Controls CCC CCC K/C C CC – C

1 CCC CCCC K/C C CC K/C C

2 CCC CCC C CC CC K/C C

3 CCCC CCC CC CC CCC C CC

4

5

CCCC CC CC CCC CCCC CC CC

CCCC CCC CC CCC CCCC CC CCC

6 CCCC CC CC CCC CCC CC CCC

7 CCC C C CC CCC CC CC

*Number of cells per mm2 (†) or per structure (‡): K, none; K/C, 1K5; C, 6–25; CC, 26–50; CCC, 51–100; CCCC, O100.

These results accord with those obtained in vitro (McCullough et al., 1993). Secretory activation of monocyte-macrophages has also been described in ASFV infection, and these cells show an increase in the expression of TNF-a, IL-1a, IL-1b and IL-6 in spleen and lymph nodes, together with an increase in the serum concentrations of TNF-a and IL-1b (Salguero et al., 2002). The mechanism of lymphocyte apoptosis induced by ASFV infection is still unknown. However, several authors suggested that expression of cytokines such as TNF-a was responsible (Go´mez-Villamandos et al., 1995a; Carrasco et al., 1996; Oura et al., 1998). In this study, it was observed that lymphocyte apoptosis coincided in time and situation with the expression of TNF-a, IL-1a and IL-1b. These cytokines are secreted mainly by monocyte-macrophages (Tracey and Cerami, 1994; Murtaugh et al., 1996), the main target cells of ASFV. Several cytokines (e.g., TNF-a, IL-1b and IL-6) are capable of inducing apoptosis in a variety of cell lines (Herna´ndez-Caselles and Stutman, 1993; McDevitt et al., 1993; Saldeen, 2000). The expression of these cytokines plays a critical role in some viral diseases that cause immunosuppression (Andrews et al., 1978; Ohno et al., 1993; Razvi and Welsh, 1993; Inoue et al., 1994) and it has been suggested recently that cytokines play an important role in Ebola virus infection (Geisbert et al., 2000). We suspect that TNF-a, IL-1a, IL-1b and IL-6 act as cytotoxic factors (Olson et al., 1995; Saldeen, 2000) and that they induce apoptosis in B and T lymphocytes of lymphoid organs; this suspicion arose from the observation of numerous macrophages, immunolabelled for those cytokines, in the lymphoid follicles of the spleen and lymph nodes from 3 dpi and in the thymus from 4 dpi, accompanied simultaneously by severe lymphopenia due to apoptosis.

The expression of cytokines and their mRNA varied in intensity in the different organs examined; nonetheless, it coincided with ASFV detection and with morphological changes in macrophages indicating secretory and phagocytic activation. The virus may increase cytokine secretion in infected and adjacent cells as a result of an autocrine effect (Murtaugh et al., 1996). The number of macrophages immunolabelled for C1q increased in all organs examined. The results support the hypothesis that macrophage activation plays an essential role in the pathogenesis of ASF. The changes described may have been the consequence of an increase in the number of macrophages as well as of their activation; only 10% of macrophages in the splenic red pulp express C1q under normal conditions (Schwaeble et al., 1995). It is also possible that C1q plays a role in the pathogenesis of ASF as a modulator of antigenpresentation phenomena (Ghebrehiwet and Peerschke, 1993; Schwaeble et al., 1995), in the elimination of immune complexes (Kaul and Loos, 1993) and production of cytokines (Schwaeble et al., 1995). These results show than an aberrant cytokine profile is directly related to the appearance of lymphocyte apoptosis in the lymphoid organs in acute African swine fever infection.

Acknowledgments We thank J.M. Sa´nchez-Vizcaı´no (CISA-INIA, Valdeolmos, Spain) for providing the ASFV isolate E-70 and K. van Reeth and M.B. Pensaert (University of Ghent, Belgium) for providing the probes. This work was supported by grants PB95-0588 and PB98-1033 from the D.G.E.S., Spain.

Cytokines and Apoptosis in Acute ASF

References Afonso, C. L., Neilan, J. G., Cutis, G. F. and Rock, D. L. (1996). An African swine fever virus Bcl-2 homolog, 5-HL, suppresses apoptotic cell-death. Journal of Virology, 70, 4858–4863. Andrews, B. S., Theofilopoulos, A. N., Peters, C. J., Loskutoff, D. J., Brandt, W. E. and Dixon, F. J. (1978). Replication of dengue and junin viruses in cultured rabbit and human endothelial cells. Infection and Immunity, 20, 776–781. Brun, A., Rivas, C., Esteban, M., Escribano, J. M. and Alonso, C. (1996). African swine fever virus gene A179L, a viral homologue of bcl-2, protects cells from programmed cell death. Virology, 225, 227–230. Carrasco, L., Bautista, M. J., Go´mez-Villamandos, J. C., Martı´n de las Mulas, J., Chaco´n-M. de Lara, F., Wilkinson, P. J. and Sierra, M. A. (1997). Development of microscopic lesions in splenic cords of pigs infected with African swine fever virus. Veterinary Research, 28, 93–99. Carrasco, L., Chaco´n-M. de Lara, F., Martı´n de las Mulas, J., Go´mez-Villamandos, J. C., Pe´rez, J., Wilkinson, P. J. and Sierra, M. A. (1996). Apoptosis in lymph nodes in acute African swine fever. Journal of Comparative Pathology, 115, 415–428. Chaco´n, M. R., Almaza´n, F., Nogal, M. L., Vin ˜ uela, E. and Rodrı´guez, J. F. (1995). The African swine fever virus IAP homolog is a late structural polypeptide. Virology, 214, 670–674. Colgrove, G. S., Halterman, E. O. and Coggins, L. (1969). Pathogenesis of African swine fever in young pigs. American Journal of Veterinary Research, 30, 1343– 1359. Dixon LK, Costa JV, Escribano JM, Rock DL, Vin ˜ uela E, Wilkinson PJ. (2000). Asfarviridae. In: Virus taxonomy, classification and nomenclature of viruses. Proceedings of the Seventh Report of the International Committee on Taxonomy of Viruses. MHV Van Regenmortel, CM Fauquet, DHL Bishop, EB Carstens, MK Estes, SM Lemon, J Maniloff, MA Mayo, DJ McGeoch, CR Pringle, RB Wickkner, editors. Academic Press, San Diego, pp. 159–165. Geisbert, T. W., Hensley, L. E., Gibb, T. R., Steels, K. E., Jaax, N. K. and Jahrling, P. B. (2000). Apoptosis induced in vitro and in vivo during infection by Ebola and Marburg viruses. Laboratory Investigation, 80, 171– 186. Ghebrehiwet, B. and Peerschke, E. I. (1993). The C1q-R participates in immunoregulation and signal transduction. Behring Institute Mitteilungen, 93, 236–240. Go´mez del Moral, M., Ortun ˜ o, E., Ferna´ndez-Zapatero, P., Alonso, F., Alonso, C., Ezquerra, A. and Dom´ınguez, J. (1999). African swine fever virus infection induces tumor necrosis factor alpha production: implications in pathogenesis. Journal of Virology, 73, 2173–2180. Go´mez-Villamandos, J. C., Herva´s, J., Me´ndez, A., Carrasco, L., Martı´n de las Mulas, J., Villeda, C. J.,

301

Wilkinson, P. J. and Sierra, M. A. (1995a). Experimental African swine fever: apoptosis of lymphocytes and virus replication in other cells. Journal of General Virology, 76, 2399–2405. Go´mez-Villamandos, J. C., Herva´s, J., Me´ndez, A., Carrasco, L., Villeda, C. J., Wilkinson, P. J. and Sierra, M. A. (1995b). Pathological changes in renal interstitial capillaries of pigs inoculated with two different strains of African swine fever virus. Journal of Comparative Pathology, 112, 283–298. Herna´ndez-Caselles, T. and Stutman, O. (1993). Immune functions of tumor necrosis factor. 1. Tumor necrosis factor induces apoptosis of thymocytes and can also stimulate or inhibit IL-6 induced proliferation depending on the concentration of mitogenic co-stimulation. Journal of Immunology, 151, 3999–4012. Inoue, M., Fukuda, M. and Miyano, K. (1994). Thymic lesions in chicken infected with infectious bursal disease. Avian Diseases, 38, 839–846. Kaul, M. and Loos, M. (1993). C1q, the collagen-like subcomponent of the first component of complement C1, is a membrane protein of guinea pig macrophages. European Journal of Immunology, 23, 2166–2174. Konno, S., Taylor, W. D., Hess, W. R. and Heuschele, W. P. (1972). Spleen pathology in ASF. Cornell Veterinarian, 62, 486–506. McCullough, K. C., Schaffner, R., Fraefel, W. and Kihm, U. (1993). The relative density of CD-44 positive porcine monocytic cell populations varies between isolations and upon culture and influences susceptibility to infection by African swine fever virus. Immunology Letters, 37, 83–90. McDevitt, J., Feighery, C. F., Martin, G., O’Farrelly, C. and Kelleher, D. (1993). Tumor necrosis factor (TNF) induced apoptosis of small bowel epithelial cells. Gastroenterology, 104, A740. Mebus, C. A. (1987). Pathobiology and pathogenesis. In: African Swine Fever, Y. Becker, Ed., Martinus Nijhoff, Boston, pp. 21–30. Mebus, C. A. (1988). African swine fever. Advances in Virus Research, 35, 251–269. Montgomery, R. F. (1921). On a form of swine fever occurring in British East Africa (Kenya Colony). Journal of Comparative Pathology, 34, 159–191. Moulton, J. and Coggins, L. (1968). Comparison of lesions in acute and chronic African swine fever. Cornell Veterinarian, 58, 364–388. Murtaugh, M. P., Baarsch, M. J., Zhou, Y., Scamurra, R. W. and Lin, G. (1996). Inflammatory cytokines in animal health and disease. Veterinary Immunology and Immunopathology, 54, 45–55. Ohno, K., Nakano, T., Matsumoto, Y., Watari, T., Goitsuka, R., Nakayama, H., Tsujumoto, H. and Hasegawa, A. (1993). Apoptosis induced by tumor necrosis factor in cells chronically infected with feline immunodeficiency virus. Journal of Virology, 67, 2429– 2433.

302

F.J. Salguero et al.

Olson, N. C., Hellyer, W. and Dodam, J. R. (1995). Mediators and vascular effects in response to endotoxin. British Veterinary Journal, 151, 489–522. Oura, C. A. L., Powell, P. and Parkhouse, R. M. E. (1998). African swine fever: a disease characterised by apoptosis. Journal of General Virology, 79, 1427–1438. Pe´rez, J., Rodrı´guez, F., Ferna´ndez, A., Martı´n de las Mulas, J., Go´mez-Villamandos, J. C. and Sierra, M. A. (1994). Detection of African swine fever virus protein VP73 in tissues of experimentally and naturally infected pigs. Journal of Veterinary Diagnostic Investigation, 6, 360–365. Plowright, W., Parker, J. and Peirce, M. A. (1969). African swine fever in ticks (Ornithodoros moubata Murray) collected from animal burrows in Tanzania. Nature, 221, 1071–1073. Ramiro-Iban ˜ ez, F., Ortega, A., Brun, A., Escribano, J. M. and Alonso, C. (1996). Apoptosis: a mechanism of cell killing and lymphoid organ impairment during acute African swine fever infection. Journal of General Virology, 77, 2209–2219. Razvi, E. S. and Welsh, R. M. (1993). Programmed celldeath of T-lymphocytes during acute viral infection. A mechanism for virus induced immune deficiency. Journal of Virology, 67, 5754–5765. Ruiz-Villamor, E., Quezada, M., Bautista, M. J., Romanini, S., Carrasco, L., Salguero, F. J. and Go´mezVillamandos, J. C. (2001). Classical swine fever: pathogenesis of glomerular damage and immunocharacterization of immunocomplex deposits. Journal of Comparative Pathology, 124, 246–254. Saldeen, J. (2000). Cytokines induce both necrosis and apoptosis via a common Bcl-2-inhibitable pathway in rat insulin-producing cells. Endocrinology, 141, 2003– 2010. Salguero, F. J., Mekonnen, T., Ruiz-Villamor, E., Sa´nchezCordo´n, P. J. and Go´mez-Villamandos, J. C. (2001). Detection of monokines in paraffin-embedded tissues of pigs using polyclonal antibodies. Veterinary Research, 32, 601–610. Salguero, F. J., Ruiz-Villamor, E., Bautista, M. J., Sa´nchezCordo´n, P. J., Carrasco, L. and Go´mez-Villamandos,

J. C. (2002). Changes in macrophages in spleen and lymph nodes during acute African swine fever: expression of cytokines. Veterinary Immunology and Immunopathology, 90, 11–22. Sa´nchez-Vizcaı´no, J. M., Slauson, D. O., Ruiz-Gonzalvo, F. and Valero, F. (1981). Lymphocyte function and cellmediated immunity in pigs with experimentally induced African swine fever. American Journal of Veterinary Research, 42, 1335–1341. Schwaeble, W., Schafer, M. K., Petry, F., Fink, T., Knebel, D., Weihe, E. and Loos, M. (1995). Follicular dendritic cells, interdigitant cells, and cells of the monocyte-macrophage lineage are the C1q-producing sources in the spleen. Identification of specific cell types by in situ hybridization and immunohistochemical analysis. Journal of Immunology, 155, 4971– 4978. Sierra, M. A., Quezada, M., Ferna´ndez, A., Carrasco, L., Go´mez-Villamandos, J. C., Martı´n de las Mulas, J. and Sa´nchez-Vizcaı´no, J. M. (1989). Experimental African swine fever: evidence of the virus in interstitial tissues of the kidney. Veterinary Pathology, 26, 173–176. Tracey, K. J. and Cerami, A. (1994). Tumor necrosis factor: a pleiotropic cytokine and therapeutic target. Annual Reviews of Medicine, 45, 491–503. Wardley, R. C., Andrade, C. M., Black, D. N., Castrp, F. L., Enjuanes, L., Hess, W. R., Mebus, C., Orda´s, A., Rutili, D., Sa´nchez-Vizcaı´no, J. M., Vigario, J. D., Wilkinson, P. J., Moura Nunes, J. F. and Thomson, G. (1983). African swine fever virus. Archives of Virology, 76, 73–90. Wilkinson, P. J., Wardley, R. C. and Williams, S. M. (1981). African swine fever (Malta/78) in pigs. Journal of Comparative Pathology, 91, 277–285. Ya´nez, F. J., Rodrı´guez, J. M., Nogal, M. L., Yuste, L., Enriquez, C., Rodrı´guez, J. F. and Vin ˜ uela, E. (1995). Analysis of the complete nucleotide sequence of African swine fever virus. Virology, 208, 249–278. 

Received; June 24th; 2004 Accepted; November 16th; 2004