- Email: [email protected]
Prokaryotic manganese superoxide dismutases
80
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
General Comments It should be possible to demonstrate and quantify EC-SOD in samples from most mammalian species, using the procedures outlined here. Secreted coppercontaining SODs have been found in several other phyla. Whether some or all of these are on the same evolutionary branch as the mammalian EC-SODs or represent separate branches has not yet been comprehensively analyzed. Even less is known about specific properties such as heparin binding, glycosylation, and tetrameric versus dimeric state. The present procedures might help in probing for such properties.
[8]
Prokaryotic Manganese Superoxide Dismutases B y JAMES W. WHITTAKER
Introduction Manganese superoxide dismutases (MnSODs) 1-3 are the front-line antioxidant defense in many prokaryotes, protecting against oxidative challenges resulting from environmental or biological interactions. The enzymes are typically multimers of small subunits (,~23-kDa molecular mass), and are usually localized in the cytoplasm, 4 where they may be associated with DNA. 5'6 Enzymes from mesophilic organisms are generally homodimeric proteins, whereas thermophilic and hyperthermophilic enzymes are often tetramers. 2 Each subunit contains a mononuclear manganese complex (Fig. 1) that forms the catalytic active site. The metal ion is redox active, shuttling between Mn(II) and Mn(III) oxidation states during turnover. Superoxide dismutases are widespread among bacterial and archaeal life, occurring in both prokaryotic domains of the phylogenetic tree. 2 Even some organisms normally identified as strict anaerobes have been found to contain a superoxide dismutase, and the exceptional aerobes that lack the enzyme (i.e., the lactic acid bacteria) generally have a fermentative metabolism and may contain manganese salts that mimic SOD activity.7 The following sections provide a basic guide to the properties of the prokaryotic MnSODs. 1j. M. McCord, New Horiz. 1, 70 (1993). 2 I. Fridovich,J. Biol. Chem. 272, 18515 (1997). 3 j. W. Whittaker, Metals Biol. Syst. 37, 587 (2000). 4 H. M. Steinman, L. Weinstein, and M. Brenowitz,J. Biol. Chem. 269, 28629 (1994). 5 K. A. Hopkin, M. A. Papazian, and H. M. Steinman, J. Biol. Chem. 267, 24253 (1992). 6 R. A. Edwards, H. M. Baker, M. M. Whittaker, J. W. Whittaker, G. B. Jameson, and E. N. Baker, J. Biol. Inorg. Chem. 3, 161 (1998).
METHODS IN ENZYMOLOGY, VOL. 349
Copyright 2002, Elsevier Science (USA). All rights reserved. 0076-6879/02 $35.00
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
81
(Gin,His)77or14s (HiOH"-] / ASP167
HiSal
.~His2 s
FIG. 1. Consensus metal-binding site of prokaryotic Mn- and FeSODs. M, metal (manganese or iron); E. coli MnSOD sequence numbering.
Genomic Analysis The explosion in genomics that has occurred has generated a wealth of information about the genetic contents of a broad spectrum of organisms. Identifying structural genes and assigning functions are two of the principal goals of this bioinformatics revolution, and superoxide dismutases have proved to be particularly easy to identify because many structural elements are highly conserved, s-l° SOD gene studies have an additional significance in the context of clinical research, where superoxide dismutases are potentially important as virulence factors for pathogens. This conservation of SOD structure have made it possible to design oligonucleotide probes that may be used to detect and amplify unique SOD sequences in genomic DNA isolates from a wide variety of organisms. The approach has been used to identify SOD genes in a range of gram-positive bacteria, including Clostridiun, Enterococcux, Lactococcus, Staphylococcus, and Streptococcus.t l For these organisms, degenerate polymerase chain reaction (PCR) primers (forward primer, 5'-CCITAYICITAYGAYGCIYTIGARCC-3'; reverse primer, 5'-ARRTARTAIGC RTGYTCCCAIACRTC-3') incorporating ambiguous nucleotides have been designed by back-translation of two highly conserved protein sequence motifs, one occurring near the amino terminal of the protein [PY(PAT)YDALEP] and the other occurring near the carboxyl terminus (DVWEHAYYL) (Fig. 2). SOD gene sequences have been successfully amplified with 2 units of Taq DNA polymerase in a reaction containing 50 ng of genomic DNA, a 0.1 tiM concentration of each primer, a 200 #M concentration of each dNTP. The PCR mixture is subjected
7 E S. Archibald, Crit. Rev. Microbiol. 13, 63 (1986). 8 M. W. Parker and C. C. F. Blake, FEBSLett. 229, 377 (1988). 9 M. W. Parker, C. C. F. Blake, D. Barra, F. Bossa, M. E. Schinina, W. H. Bannister, and J. V. Bannister, Protein Eng. 1, 393 (1987). l0 T. Hunter, K. Ikeburkuro, W. H. Bannister, J. V. Bannister, and G. J. Hunter, Biochemistry 36, 4925 (1997). 11 C. Poyart, P. Berche, and P. Trieu-Cuot, FEMS Microbiol. Lett. 131, 41 (1995).
82
SUPEROXIDE REACTIONS AND MECHANISMS
:t ---MV~X 1
........ ......
........
ss s8
C~L~IIU~IKrII¢II
l PYP s
1
~
~
m
e
.
E
~iil:t
--
l~el~
"°"'"
Ii~DLQilKI ~YLIIGVI qpPl,~lz, P
l~+hqt+Yv n U a s l e : l .
v
d
4+ ~--~I q m ~ ~ _ ~ , , P o ~ :
lnHellfw
--
~
ql
pgggg
L ~B ~ I I~~ Q I ~ v 'II I ~IN N Fi q ~ U~
10,.
NTFo PXHn IBHn TTilIa ~CNn
h
...............
100 100 131
.
AOXnZR~VL---~4USrlU. . . . . . . . . . . . . . .
41 •
•
.,,+x.-+,+---x~,,~
93 106
[8]
p
Oe
V
L"
• lseaz
k
~G~fek
k~ ee~t
155 160 158
at
I:I~GIGWIvLv
d
°kL
~v~
~"'tpll
g
iiii ii
1S1 156 181 t
*
FIG.2. Sequencecorrelationswithinthe Mn, Fe familyof bacterialand archaeal superoxidedismutases. Residuesthat serveas metalligandsare markedwith an asterisk (*). Boxedresiduescorrelatewith metal specificity.Key: ECFe, Escherichia coli FeSOD (GenBankaccession number 147842); PGFe, Porphyromonas gingivalis FeSOD (GenBank accession number 97324); SAFe, Sulfolobus acidocaldarius FeSOD (GenBankaccessionnumber396203); MTFe, Mycobacterium tuberculosis FeSOD (GenBank accession number 98822); PAMn, Pyrobaculum aerophilum MnSOD (GenBank accession number 7290015); BSMn, Bacillus stearothermophilus MnSOD (GenBankaccession number 143552); TTMn, Thermus thermophilus MnSOD (GenBank accession number 494880); ECMn, Escherichia coliMnSOD (GenBankaccessionnumber147594).Sequenceswere alignedby the BLAST local sequencesimilaritysearchprogram [Altschulet al., Nucleic Acids Res. 25, 3389 (1997);Tatusova et al., FEMS MicrobioL Lett. 174, 247 (1999)] and the alignmentwas displayed by using CLUSTAL W with Boxshade [Thompsonet al., Nucleic Acids Res. 22, 4673 (1994)]. to denaturation (3 min at 95°), followed by 35 cycles of amplification (30 sec of denaturation at 95 °, 2 min of annealing at 37 °, and 90 sec of elongation at 72°). The PCR product (comprising approximately 480 bp, nearly 85% of a typical SOD structural gene) is then available for cloning and subsequent sequence analysis, i I The PCR product may also be tagged (end-labeled by kinase reaction or condensation with a biotin or streptavidin tag, or internally labeled by an additional stage of PCR using radiolabled or biotinylated nucleotides) and used as a probe in
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
83
Southern hybridization to select DNA fragments containing the intact SOD gene from a genomic library. PCR amplification of SOD gene fragments can also be used for clinical analysis of pathogenic bacteria, and has been successfully used to detect as few as l0 cells of the obligate intracellular parasite Coxiella burnetii (the causative agent of Q fever) in clinical samples. 12 Identification of Superoxide Dismutase Type from Genomic Data As indicated above, the availability of extensive sequence information from both genomic databases and fragment analysis has allowed the rapid and relatively easy identification of genes encoding the Mn, FeSOD family of enzymes in a wide range of organisms. Distinguishing between manganese and iron homologs tends to be more difficult, because the two subfamilies share extensive structural and sequence similarity. However, the correlation of a large number of SOD protein sequences for biochemically well-characterized enzymes has revealed subtle differences between the Fe- and MnSODs that may be useful for predicting metal specificity.S-10 An alignment of amino acid sequences for eight SOD enzymes representing three distinct subgroups (iron only, cambialistic, and manganese only) is shown in Fig. 213-15 to illustrate this point. The shaded areas correspond to strictly conserved regions of the amino acid sequence, including metal ligands (identified by an asterisk in Fig. 2). The metal-binding sites are identical for both manganese and iron enzymes, with three histidine residues and an aspartate comprising the inner coordination sphere, and X-ray crystallographic studies have shown that the structural similarities extend even to the outer sphere of the metal complexes. 6'16-18 In spite of the remarkable similarity of the Mn- and FeSOD structures, empirical correlations permit metal specificity to be confidently predicted for certain sequences. The crucial factor is the identification of a conserved outer sphere residue in the polypeptide sequence, s-1° This residue forms an essential hydrogen bond to the coordinated solvent molecule in the active site, and is either glutamine or histidine in all known SOD structures (Fig. l). For MnSODs, the residue is a glntamine arising from the C-terminal end of the 1~2 sheet in domain II (residue 146), whereas for most FeSODs, the corresponding residue arises from helix ct2 in domain I (residue 77 in Escherichia coli MnSOD sequence numbering). The 12 A. Stein and D. Raoult, J. Clin. Microbiol. 30, 2462 (1992). 13 S. E Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman, Nucleic Acids Res. 25, 3389 (1997). 14 T. A. Tatusova and T. L. Madden, FEMS Microbiol. Lett. 174, 247 (1999). 15 j. D. Thompson, D. G. Higgins, and T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994). 16 M. S. tall, M. M. Dixon, K. A. Partridge, W. C. Stallings, J. A. Fee, and M. L. Ludwig, Biochemistry 34, 1646 (1995). 17 W. C. Stallings, K. A. Pattridge, R. K. Strong, and M. L. Ludwig, J. Biol. Chem. 259, 10695 (1984). 18 B. L. Stoddard, D. Ringe, and G. A. Petsko, Protein Eng. 4, 113 (1990).
84
SUPEROXIDE REACTIONS AND MECHANISMS
[8]
side chains of residues 77 and 146 lie close together in the conserved packing of the protein interior, imposing a mutual steric constraint on residues occupying these two positions in the sequence. Thus, the presence of glutamine (or histidine) at one position requires that the second position be occupied by a residue with a more compact side chain (e.g., glycine or alanine). The two regions are enclosed in boxes in Fig. 2. Simple inspection of a given sequence can usually determine which of these limiting cases applies. Most iron-only SODs (like E. coli FeSOD) have glutamine near position 77 in the primary structure. The presence of a glutamine in this position does not demand iron specificity, however, because Porphyromonas gingivalis SOD has this feature and exhibits relatively low metal specificity, functioning nearly equally well with either iron or manganese bound to the protein, characteristic of cambialistic SODs. 19-22 Off the other hand, a subgroup of iron-only SODs (including Sulfolobus acidocaldarius and Mycobacterium tuberculosis enzymes) has been found experimentally to be iron specific but to have a histidine residue at position 146 (E. coli MnSOD numbering) substituting for glutamine in the outer sphere. Complicating matters further, cambialistic enzymes may show a slight preference for one metal or the other, leading to further distinction of iron- or manganese-preferential subgroups. In general, cambialistic SODs have an outer sphere histidine at residue 146, whereas manganese-only SODs (including enzymes from Bacillus stearothermophilus, Thermus thermophilus, and E. coli) appear to strictly require glutamine in the second position. Thus the presence of glutamine at position 146 implies manganese specificity, glutamine at position 77 suggests iron specificity, and histidine at position 146 may be associated with either iron, manganese, or cambialistic behavior, and isolation and further characterization of the enzyme are then required. C l o n i n g M n S O D s for R e c o m b i n a n t E x p r e s s i o n Some of the organisms in which SOD genes have been identified (anaerobes, pathogens, hyperthermophiles) may be difficult to cultivate on a preparative scale, complicating the biochemical characterization of the endogenous SOD. Fortunately, isolation of the complete coding sequence for an SOD allows recombinant expression in a convenient host (e.g., E. coli) for detailed functional or structural analysis. We have found that an oxygen-inducible expression vector (pGB 1) 19 M. E. Martin, B. R. Byers, M. O. Olson, M. L. Salin, J. E. Arceneaux, and C. Tolbert, J. BioL Chem. 261, 9361 (1986). 20 R. Gabbianelli, A. Battistoni, F. Polizio, M. T. Carri, A. De Martino, B. Meier, A. Desideri, and G. Rotilio, Biochem. Biophys. Res. Commun. 216, 841 (1995). 21 S. Yamano, Y. Sako, N. Nomura, and T. Maruyama, J. Biochem. 126, 218 (1999). 22 E Yamakura, K. Kobayashi, S. Tagawa, A. Morita, T. Imai, D. Ohmori, and T. Matsumoto, Mol. BioL Int. 36, 233 (1995).
[8]
PROKARYOTIC MANGANESESUPEROXIDEDISMUTASES
85
RBS Nco I Barn/./I pQGB2 ACTGGAGATGACCATGGATTTCGGGATCCAT RBS Nde I BamH I pQGB1 ACTGGAGATGCATATGCATTTCGGGATCCAT RBS Nsi I Sac I pGB1 IACTGGAGATGAATATGCATTTCGAGCTCCATj
pGB1 3.1 kb
FIG. 3. Physical map of pGB1 oxygen-inducibleexpression vector, bla, fl-Lactamase;ori, pUC19 ori; PsodA, E. coli sod A promoter; sodTT, E. coli sodA transcriptional terminator; ML, synthetic multilinker. [Based on Gao et al., Gene (Amst.) 176, 269 (1996).] constructed by Bao et al. 23 (Fig. 3) is particularly well suited to expression of recombinant SODs in E. coli, permitting isolation of gram quantities of pure enzyme from a single 10-liter fermentation run. The vector backbone of pGB l, derived from pUC 19, confers ampicillin resistance to transformants and gives rise to a high vector copy number, contributing to a high expression level for the recombinant protein through a gene dosage effect. The heterologous gene can be inserted in the vector between a copy of the oxygeninducible E. coli sodA promoter (PsodA) for the endogenous MnSOD gene and the rho-independent sodA transcriptional terminator (sodTF), making use of a variety of restriction sites (NsiI and SacI, NdeI and B a m H I , or N c o I and B a m H I ) available in several variants 23-25 (Fig. 3). Transformants grown in Luria-Bertani (LB) medium with ampicillin selection and oxygen purging (for a dissolved oxygen level approaching 100%) efficiently express the heterologous protein. The highest levels of 23B. Gao, S. C. Flores, S. K. Bose, and J. M. McCord, Gene (Amst.) 176, 269 (1996). 24M. M. Whittaker and J. W. Whittaker, J. Biol. lnorg. Chem. 5, 402 (2000). 25M. M. Whittaker and J. W. Whittaker, J. Biol. Chem. 274, 34751 (1999).
86
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
expression are achieved with an expression host providing a s o d A background 26'27 (lacking the endogenous MnSOD, e.g., E. coli QC781,26 available from the E. coli Genetics Stock Center, New Haven, CT) in which the induction by oxidative stress is most effective. Metallation of the recombinant protein can be controlled in vivo by supplementing the culture medium with high levels of manganese or iron salts (metal ion at 1-5 mM) 28 The s o d A knockout strain is also useful for isolation of MnSOD genes by functional complementation, 27 and for the physiological characterization of heterologous MnSODs. 29
Purification of MnSOD Both endogenous MnSOD and recombinant enzyme produced under control of the PsodA promoter is highly expressed under conditions of oxidative stress, making oxidatively challenged cells a favorable source for isolating the enzyme. Purification of MnSOD is in general straightforward, because the enzyme is relatively robust and enzymes from a wide range of sources have fairly uniform properties, making a standardized purification protocol possible, using any convenient SOD assay to detect the enzyme and monitor the purification (e.g., xanthine oxidase/cytochrome c inhibition assay3°). The enzyme is typically thermostable, permitting use of an initial heat denaturation step to remove a significant fraction of contaminating proteins. This step would seem to be particularly attractive for preparation of recombinant thermophilic or hyperthermophilic SODs, but may actually be a disadvantage as those enzymes are normally expressed as metal-free apoenzymes in the mesophilic expression host. 24,25 In that case, heat treatment tends to complicate the isolation of pure metalloforms. We have found that the apoenzymes undergo a thermally triggered metallation process at elevated temperatures, resulting in relatively indiscriminate incorporation of any available metal ion. 24,25 In a crude cell extract this will lead to uptake primarily of iron and to a lesser extent of manganese and other metal ions. Careful purification of the intact metal-free apoenzyme (restricting the temperature to a moderate range during all purification steps) permits relatively controlled incorporation of specific metals in a subsequent step in which the apoenzyme (0.5 mM active sites) is incubated with metal salts [e.g., 10 mM MnC12, or 10 m M Fe(NH4)2(SO4)2 plus 5 mM sodium ascorbate] in 20 mM morpholineethanesulfonic acid (MOPS) buffer, pH 7 at 65-120 ° (e.g., in a thermal cycler or autoclave, depending on protein stability). 24,25 26A. Carlioz and D. Touati,EMBO J. 5, 623 (1986). 27H. M. Steinman,Mol. Gen. Gener 232, 427 (1992). 28M. M. Whittakerand J. W. Whittaker, Biochemistry 36, 8923 (1997). 29W.Inaoka,Y. Matsumura,and T. Tsuchido,J. BacterioL 180, 3697 (1999). 30j. M. McCord and I. Fridovich,J. BioL Chem. 244, 6049 (1969).
[8]
PROKARYOTIC MANGANESESUPEROXIDEDISMUTASES
87
High-performance ion-exchange chromatography has proved particularly useful for purification of MnSOD from cell extracts. 31 Under suitable conditions, anion-exchange chromatography is capable even of resolving proteins in distinct metallation states, presumably because of slight differences in protein charge. Alternatively, chromatofocusing chromatography may be used to resolve different metalloforms24 (Mn2-, Fe2-, Mn,Fe-, Mn-half apo-, Fe-half apo-, and metal-free apo-MnSOD), permitting each of these species to be isolated and characterized. Spectroscopic Characterization Optical absorption spectroscopy permits simple, routine characterization of the metal center in MnSOD. 32'33 However, optical absorption is associated only with the red, oxidized Mn(III) form of the enzyme, the Mn(II) form being essentially colorless and lacking any significant visible absorption. To ensure that spectroscopic results are quantitatively significant, the purified enzyme may be converted to the oxidized Mn(III) form by treatment with strong inorganic oxidants. In practice, we have found that Mo(V) [molybdicyanide,33 K3Mo(CN)8] and I(VII) (periodate, 34 NalO4) are particularly effective oxidants, producting only minimal side reactions. The reaction with molybdicyanide requires addition of an excess (> 2 equivalents) of oxidant, and is relatively slow, but the extent of reaction may be monitored by the increase in Mn(III) absorption at 475 nm. 33 The reaction with periodate is rapid and slightly more than 1 equivalent of oxidant is generally sufficient.34 Optical spectra recorded for the oxidized enzyme after desalting (by dialysis or gel filtration) yield the most reliable Mn(III) extinction coefficient. A typical Mn(III)SOD absorption spectrum is shown (Fig. 4, ABS). The spectrum is a broad absorption envelope, spanning the entire visible spectrum, and including all four spin-allowed ligand field (d--->d) electronic transitions arising from the high-spin ground state for the Mn(III) d 4 metal center in the protein. 33 The individual transitions are partly resolved in the first derivative of the absorption envelope (Fig. 4, DER), which contains turning points near 400, 450, 540, and 650 nm, together with multiplet fine structure features between 450 and 600 nm that rise from relatively weak spin-forbidden electronic transitions to spin-triplet excited states arising from the 3G and 3H free ion multiplets. The underlying structure of the absorption spectrum is more fully dissected in the circular dichroism spectrum (Fig. 4, CD), which resolves four components (dichroic extrema at 400, 435,550, and 625 nm). Magnetic circular dichroism (MCD) spectroscopy (not shown) can provide further 31W. F. Beyer,Jr., and I. Fridovich,J. Biol. Chem. 266, 303 (1991). 32j. A. Fee, E. R. Shapiro,and Z. H. Moss,J. Biol. Chem. 251, 6157 (1976). 33M. M. Whittakerand J. W. Whittaker,J. Am. Chem. Soc. 113, 5528 (1991). 34R. A. Edwards,M. M. Whittaker,J. W. Whittaker,E. N. Baker,and G. B. Jameson, Biochemistry 40, 15 (2001).
88
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
+1o "1o tO "lO
-10
1000 ABS
o
500
+2
tO
+1
0k
0"
r-
CD
-1
,,.-,
-2
"~ O
-a 3 v
-4 ~
-
400
5
500
600
700
Wavelength (nm) FI~. 4. Opticalspectrafor E. coli Mn(III)superoxidedismutase. ABS,Absorption;DER,absorption derivative;CD, circulardichroism. (Activesites are I mMin 50 mMpotassiumphosphate buffer,pH 7.) information about assignment of the electronic transitions in the native and ligand complexes of the Mn(III) enzyme. 33 For manganese-only MnSODs, the absorption maximum typically occurs near 478 nm, associated with a molar extinction E478 of ,~850 M -1 c m - 1 (per manganese atom). The manganese-preferential cambialistic MnSODs are spectroscopically distinct, characteristically exhibiting a relatively blue-shifted absorption maximum (imax = 450 nm) and slightly lower extinction e450 = 660 M -1 cm -1 (per manganese atom). 24 The CD spectrum also appears to be distinct for the manganese-preferential cambialistic enzyme, with a lower rotational strength for the strongest CD band (AeL-R = - - 2 . 3 M -1 cm -1 for the manganese-preferred cambialistic SOD from the archaeon Pyrobaculum aerophilum 24 compared with - 4 M - t cm - t for the manganese-only SOD from E. coli).
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
89
5.6
I~ a~ln=95G "10"r" 8"7"~ A
o
i
~
3
,i
s
Magnetic Field (kG) FIG. 5. EPR spectrum for E. coli Mn(II) superoxide dismutase. (Active sites are 1 mM in 50 mM potassium phosphate buffer, pH 7.) Instrumental parameters: temperature, 5 K; microwave frequency, 9.46 GHz; microwave power, 1 roW; modulation amplitude, 10 G.
Substituting iron for manganese in MnSODs 24,25,35 results in protein exhibiting optical absorption spectra nearly indistinguishable from those of authentic FeSODs, 36 with a near-UV absorption band near 350 nm at low pH (pH < 6). The enzyme also typically exhibits significant SOD activity over this lower pH range. However, the iron-substituted enzyme is relatively sensitive to pH, the UV absorption bleaches, and SOD activity is rapidly lost as the pH is increased above pH 7, as a result of inhibitory binding by hydroxide ion to Fe(III) in the enzyme. 37 This "rusting" of iron in iron-substituted MnSOD appears to be an important aspect of metal specificity in this class of enzymes. Electron paramagnetic resonance (EPR) spectroscopy provides a complementary probe of the reduced Mn(II) mental center in MnSOD. 32'33 Although both oxidized [Mn(III), d 4, S = 2] and reduced [Mn(II), d 5, S = 5/2] forms have paramagnetic ground states and are in principle EPR active, only the reduced enzyme has an odd-electron (Kramers) ground state permitting routine EPR measurements. MnSOD is reduced by its product, hydrogen peroxide,38 and native MnSOD (which is generally a mixture of oxidation states) may be quantitatively converted to the homogeneous Mn(II) form by treatment with a small stoichiometric excess of hydrogen peroxide to ensure the maximum sensitivity of EPR measurements.24 A typical X-band EPR spectrum for Mn(II)SOD is shown in Fig. 5. The characteristic 35 F. Yamakura, K. Kobayashi, H. Ue, and M. Konno, Eur. J. Biochem. 227, 700 (1995). 36 T. O. Slykehouse and J. A. Fee, J. Biol. Chem. 251, 5472 (1976). 37 R. A. Edwards, M. M. Whittaker, J. W. Whittaker, G. B. Jameson, and E. N. Baker, J. Am. Chem. Soc. 120, 9684 (1998). 38 C. Bull, E. C. Niederhoffer, T. Yoshida, and J. A. Fee, J. Am. Chem. Soc. 113, 4069 (1991).
90
SUPEROXIDE REACTIONS AND MECHANISMS
[9]
features of the spectrum include strong absorption near 1,500 G (g = "-~6),exhibiting well-resolved nuclear hyperfine splittings (aMn ----95 G) arising from electronnuclear hyperfine coupling with the 55Mn nucleus (•=5/2, 100% n.a.). These spectral features reflect the nearly axial environment of the metal ion in the trigonal bipyramidal active site. The even-electron quintet Mn(III) ground state of native MnSOD has also been detected by polarization EPR methods. 39
Acknowledgment Support for this work from the National Institutes of Health (GM 42680) is gratefully acknowledged.
39 K. A. Campbell, E. Yikilmaz, C. V. Grant, G. Wolfgang, A.-E Miller, and R. D. Britt, J. Am. Chem. Soc. 121, 4714 (1999).
[9] Nickel-Containing Superoxide Dismutase B y J I N - W O N LEE, J U N G - H Y E ROE, a n d S A - O U K K A N G
Introduction Superoxide dismutases (SOD, EC 1.15.1.1) are metalloenzymes that catalyze the disproportionation of superoxide radical anion to hydrogen peroxide and molecular oxygen. The dismutation reaction catalyzed by SODs requires a metal center that is first reduced and then reoxidized by superoxide radical anion. SODs have been classified into three groups according to their metal centers: manganese (MnSOD), iron (FeSOD), and copper and zinc (Cu,ZnSOD). l These SODs may be derived from two evolutionary families. 2 The active site structures of these SODs show that the redox-active metal centers are ligated by a combination of histidine imidazoles, aspartate carboxylates, and water, with five-coordinate metal c e n t e r s . 3-6
I I. Fridovich, Annu. Rev. Biochem. 64, 97 (1995). 2 I. Fridovich, J. Biol. Chem. 264, 7761 (1989). 3 j. A. Tainer, E. D. Getzoff, J. S. Richardson, and D. C. Richardson, Nature (London) 306, 284 (1983). 4 W. C. Stallings, T. B. Powers, K. A. Pattridge, J. A. Fee, and M. L. Ludwig, Proc. Natl. Acad. Sci. U.S.A. 80, 3384 (1983). 5 M. W. Parker and C. C. E Blake, J. Mol. Biol. 199, 649 (1988). 6 W. C. Stallings, K. A. Pattfidge, R. K. Strong, and M. L. Ludwig, J. Biol. Chem. 259, 10695 (1984).
METHODSIN ENZYMOLOGY,VOL.349
Copyright2002.ElsevierScience(USA). All rights~eserved. 0076-6879102$35.00
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
General Comments It should be possible to demonstrate and quantify EC-SOD in samples from most mammalian species, using the procedures outlined here. Secreted coppercontaining SODs have been found in several other phyla. Whether some or all of these are on the same evolutionary branch as the mammalian EC-SODs or represent separate branches has not yet been comprehensively analyzed. Even less is known about specific properties such as heparin binding, glycosylation, and tetrameric versus dimeric state. The present procedures might help in probing for such properties.
[8]
Prokaryotic Manganese Superoxide Dismutases B y JAMES W. WHITTAKER
Introduction Manganese superoxide dismutases (MnSODs) 1-3 are the front-line antioxidant defense in many prokaryotes, protecting against oxidative challenges resulting from environmental or biological interactions. The enzymes are typically multimers of small subunits (,~23-kDa molecular mass), and are usually localized in the cytoplasm, 4 where they may be associated with DNA. 5'6 Enzymes from mesophilic organisms are generally homodimeric proteins, whereas thermophilic and hyperthermophilic enzymes are often tetramers. 2 Each subunit contains a mononuclear manganese complex (Fig. 1) that forms the catalytic active site. The metal ion is redox active, shuttling between Mn(II) and Mn(III) oxidation states during turnover. Superoxide dismutases are widespread among bacterial and archaeal life, occurring in both prokaryotic domains of the phylogenetic tree. 2 Even some organisms normally identified as strict anaerobes have been found to contain a superoxide dismutase, and the exceptional aerobes that lack the enzyme (i.e., the lactic acid bacteria) generally have a fermentative metabolism and may contain manganese salts that mimic SOD activity.7 The following sections provide a basic guide to the properties of the prokaryotic MnSODs. 1j. M. McCord, New Horiz. 1, 70 (1993). 2 I. Fridovich,J. Biol. Chem. 272, 18515 (1997). 3 j. W. Whittaker, Metals Biol. Syst. 37, 587 (2000). 4 H. M. Steinman, L. Weinstein, and M. Brenowitz,J. Biol. Chem. 269, 28629 (1994). 5 K. A. Hopkin, M. A. Papazian, and H. M. Steinman, J. Biol. Chem. 267, 24253 (1992). 6 R. A. Edwards, H. M. Baker, M. M. Whittaker, J. W. Whittaker, G. B. Jameson, and E. N. Baker, J. Biol. Inorg. Chem. 3, 161 (1998).
METHODS IN ENZYMOLOGY, VOL. 349
Copyright 2002, Elsevier Science (USA). All rights reserved. 0076-6879/02 $35.00
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
81
(Gin,His)77or14s (HiOH"-] / ASP167
HiSal
.~His2 s
FIG. 1. Consensus metal-binding site of prokaryotic Mn- and FeSODs. M, metal (manganese or iron); E. coli MnSOD sequence numbering.
Genomic Analysis The explosion in genomics that has occurred has generated a wealth of information about the genetic contents of a broad spectrum of organisms. Identifying structural genes and assigning functions are two of the principal goals of this bioinformatics revolution, and superoxide dismutases have proved to be particularly easy to identify because many structural elements are highly conserved, s-l° SOD gene studies have an additional significance in the context of clinical research, where superoxide dismutases are potentially important as virulence factors for pathogens. This conservation of SOD structure have made it possible to design oligonucleotide probes that may be used to detect and amplify unique SOD sequences in genomic DNA isolates from a wide variety of organisms. The approach has been used to identify SOD genes in a range of gram-positive bacteria, including Clostridiun, Enterococcux, Lactococcus, Staphylococcus, and Streptococcus.t l For these organisms, degenerate polymerase chain reaction (PCR) primers (forward primer, 5'-CCITAYICITAYGAYGCIYTIGARCC-3'; reverse primer, 5'-ARRTARTAIGC RTGYTCCCAIACRTC-3') incorporating ambiguous nucleotides have been designed by back-translation of two highly conserved protein sequence motifs, one occurring near the amino terminal of the protein [PY(PAT)YDALEP] and the other occurring near the carboxyl terminus (DVWEHAYYL) (Fig. 2). SOD gene sequences have been successfully amplified with 2 units of Taq DNA polymerase in a reaction containing 50 ng of genomic DNA, a 0.1 tiM concentration of each primer, a 200 #M concentration of each dNTP. The PCR mixture is subjected
7 E S. Archibald, Crit. Rev. Microbiol. 13, 63 (1986). 8 M. W. Parker and C. C. F. Blake, FEBSLett. 229, 377 (1988). 9 M. W. Parker, C. C. F. Blake, D. Barra, F. Bossa, M. E. Schinina, W. H. Bannister, and J. V. Bannister, Protein Eng. 1, 393 (1987). l0 T. Hunter, K. Ikeburkuro, W. H. Bannister, J. V. Bannister, and G. J. Hunter, Biochemistry 36, 4925 (1997). 11 C. Poyart, P. Berche, and P. Trieu-Cuot, FEMS Microbiol. Lett. 131, 41 (1995).
82
SUPEROXIDE REACTIONS AND MECHANISMS
:t ---MV~X 1
........ ......
........
ss s8
C~L~IIU~IKrII¢II
l PYP s
1
~
~
m
e
.
E
~iil:t
--
l~el~
"°"'"
Ii~DLQilKI ~YLIIGVI qpPl,~lz, P
l~+hqt+Yv n U a s l e : l .
v
d
4+ ~--~I q m ~ ~ _ ~ , , P o ~ :
lnHellfw
--
~
ql
pgggg
L ~B ~ I I~~ Q I ~ v 'II I ~IN N Fi q ~ U~
10,.
NTFo PXHn IBHn TTilIa ~CNn
h
...............
100 100 131
.
AOXnZR~VL---~4USrlU. . . . . . . . . . . . . . .
41 •
•
.,,+x.-+,+---x~,,~
93 106
[8]
p
Oe
V
L"
• lseaz
k
~G~fek
k~ ee~t
155 160 158
at
I:I~GIGWIvLv
d
°kL
~v~
~"'tpll
g
iiii ii
1S1 156 181 t
*
FIG.2. Sequencecorrelationswithinthe Mn, Fe familyof bacterialand archaeal superoxidedismutases. Residuesthat serveas metalligandsare markedwith an asterisk (*). Boxedresiduescorrelatewith metal specificity.Key: ECFe, Escherichia coli FeSOD (GenBankaccession number 147842); PGFe, Porphyromonas gingivalis FeSOD (GenBank accession number 97324); SAFe, Sulfolobus acidocaldarius FeSOD (GenBankaccessionnumber396203); MTFe, Mycobacterium tuberculosis FeSOD (GenBank accession number 98822); PAMn, Pyrobaculum aerophilum MnSOD (GenBank accession number 7290015); BSMn, Bacillus stearothermophilus MnSOD (GenBankaccession number 143552); TTMn, Thermus thermophilus MnSOD (GenBank accession number 494880); ECMn, Escherichia coliMnSOD (GenBankaccessionnumber147594).Sequenceswere alignedby the BLAST local sequencesimilaritysearchprogram [Altschulet al., Nucleic Acids Res. 25, 3389 (1997);Tatusova et al., FEMS MicrobioL Lett. 174, 247 (1999)] and the alignmentwas displayed by using CLUSTAL W with Boxshade [Thompsonet al., Nucleic Acids Res. 22, 4673 (1994)]. to denaturation (3 min at 95°), followed by 35 cycles of amplification (30 sec of denaturation at 95 °, 2 min of annealing at 37 °, and 90 sec of elongation at 72°). The PCR product (comprising approximately 480 bp, nearly 85% of a typical SOD structural gene) is then available for cloning and subsequent sequence analysis, i I The PCR product may also be tagged (end-labeled by kinase reaction or condensation with a biotin or streptavidin tag, or internally labeled by an additional stage of PCR using radiolabled or biotinylated nucleotides) and used as a probe in
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
83
Southern hybridization to select DNA fragments containing the intact SOD gene from a genomic library. PCR amplification of SOD gene fragments can also be used for clinical analysis of pathogenic bacteria, and has been successfully used to detect as few as l0 cells of the obligate intracellular parasite Coxiella burnetii (the causative agent of Q fever) in clinical samples. 12 Identification of Superoxide Dismutase Type from Genomic Data As indicated above, the availability of extensive sequence information from both genomic databases and fragment analysis has allowed the rapid and relatively easy identification of genes encoding the Mn, FeSOD family of enzymes in a wide range of organisms. Distinguishing between manganese and iron homologs tends to be more difficult, because the two subfamilies share extensive structural and sequence similarity. However, the correlation of a large number of SOD protein sequences for biochemically well-characterized enzymes has revealed subtle differences between the Fe- and MnSODs that may be useful for predicting metal specificity.S-10 An alignment of amino acid sequences for eight SOD enzymes representing three distinct subgroups (iron only, cambialistic, and manganese only) is shown in Fig. 213-15 to illustrate this point. The shaded areas correspond to strictly conserved regions of the amino acid sequence, including metal ligands (identified by an asterisk in Fig. 2). The metal-binding sites are identical for both manganese and iron enzymes, with three histidine residues and an aspartate comprising the inner coordination sphere, and X-ray crystallographic studies have shown that the structural similarities extend even to the outer sphere of the metal complexes. 6'16-18 In spite of the remarkable similarity of the Mn- and FeSOD structures, empirical correlations permit metal specificity to be confidently predicted for certain sequences. The crucial factor is the identification of a conserved outer sphere residue in the polypeptide sequence, s-1° This residue forms an essential hydrogen bond to the coordinated solvent molecule in the active site, and is either glutamine or histidine in all known SOD structures (Fig. l). For MnSODs, the residue is a glntamine arising from the C-terminal end of the 1~2 sheet in domain II (residue 146), whereas for most FeSODs, the corresponding residue arises from helix ct2 in domain I (residue 77 in Escherichia coli MnSOD sequence numbering). The 12 A. Stein and D. Raoult, J. Clin. Microbiol. 30, 2462 (1992). 13 S. E Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman, Nucleic Acids Res. 25, 3389 (1997). 14 T. A. Tatusova and T. L. Madden, FEMS Microbiol. Lett. 174, 247 (1999). 15 j. D. Thompson, D. G. Higgins, and T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994). 16 M. S. tall, M. M. Dixon, K. A. Partridge, W. C. Stallings, J. A. Fee, and M. L. Ludwig, Biochemistry 34, 1646 (1995). 17 W. C. Stallings, K. A. Pattridge, R. K. Strong, and M. L. Ludwig, J. Biol. Chem. 259, 10695 (1984). 18 B. L. Stoddard, D. Ringe, and G. A. Petsko, Protein Eng. 4, 113 (1990).
84
SUPEROXIDE REACTIONS AND MECHANISMS
[8]
side chains of residues 77 and 146 lie close together in the conserved packing of the protein interior, imposing a mutual steric constraint on residues occupying these two positions in the sequence. Thus, the presence of glutamine (or histidine) at one position requires that the second position be occupied by a residue with a more compact side chain (e.g., glycine or alanine). The two regions are enclosed in boxes in Fig. 2. Simple inspection of a given sequence can usually determine which of these limiting cases applies. Most iron-only SODs (like E. coli FeSOD) have glutamine near position 77 in the primary structure. The presence of a glutamine in this position does not demand iron specificity, however, because Porphyromonas gingivalis SOD has this feature and exhibits relatively low metal specificity, functioning nearly equally well with either iron or manganese bound to the protein, characteristic of cambialistic SODs. 19-22 Off the other hand, a subgroup of iron-only SODs (including Sulfolobus acidocaldarius and Mycobacterium tuberculosis enzymes) has been found experimentally to be iron specific but to have a histidine residue at position 146 (E. coli MnSOD numbering) substituting for glutamine in the outer sphere. Complicating matters further, cambialistic enzymes may show a slight preference for one metal or the other, leading to further distinction of iron- or manganese-preferential subgroups. In general, cambialistic SODs have an outer sphere histidine at residue 146, whereas manganese-only SODs (including enzymes from Bacillus stearothermophilus, Thermus thermophilus, and E. coli) appear to strictly require glutamine in the second position. Thus the presence of glutamine at position 146 implies manganese specificity, glutamine at position 77 suggests iron specificity, and histidine at position 146 may be associated with either iron, manganese, or cambialistic behavior, and isolation and further characterization of the enzyme are then required. C l o n i n g M n S O D s for R e c o m b i n a n t E x p r e s s i o n Some of the organisms in which SOD genes have been identified (anaerobes, pathogens, hyperthermophiles) may be difficult to cultivate on a preparative scale, complicating the biochemical characterization of the endogenous SOD. Fortunately, isolation of the complete coding sequence for an SOD allows recombinant expression in a convenient host (e.g., E. coli) for detailed functional or structural analysis. We have found that an oxygen-inducible expression vector (pGB 1) 19 M. E. Martin, B. R. Byers, M. O. Olson, M. L. Salin, J. E. Arceneaux, and C. Tolbert, J. BioL Chem. 261, 9361 (1986). 20 R. Gabbianelli, A. Battistoni, F. Polizio, M. T. Carri, A. De Martino, B. Meier, A. Desideri, and G. Rotilio, Biochem. Biophys. Res. Commun. 216, 841 (1995). 21 S. Yamano, Y. Sako, N. Nomura, and T. Maruyama, J. Biochem. 126, 218 (1999). 22 E Yamakura, K. Kobayashi, S. Tagawa, A. Morita, T. Imai, D. Ohmori, and T. Matsumoto, Mol. BioL Int. 36, 233 (1995).
[8]
PROKARYOTIC MANGANESESUPEROXIDEDISMUTASES
85
RBS Nco I Barn/./I pQGB2 ACTGGAGATGACCATGGATTTCGGGATCCAT RBS Nde I BamH I pQGB1 ACTGGAGATGCATATGCATTTCGGGATCCAT RBS Nsi I Sac I pGB1 IACTGGAGATGAATATGCATTTCGAGCTCCATj
pGB1 3.1 kb
FIG. 3. Physical map of pGB1 oxygen-inducibleexpression vector, bla, fl-Lactamase;ori, pUC19 ori; PsodA, E. coli sod A promoter; sodTT, E. coli sodA transcriptional terminator; ML, synthetic multilinker. [Based on Gao et al., Gene (Amst.) 176, 269 (1996).] constructed by Bao et al. 23 (Fig. 3) is particularly well suited to expression of recombinant SODs in E. coli, permitting isolation of gram quantities of pure enzyme from a single 10-liter fermentation run. The vector backbone of pGB l, derived from pUC 19, confers ampicillin resistance to transformants and gives rise to a high vector copy number, contributing to a high expression level for the recombinant protein through a gene dosage effect. The heterologous gene can be inserted in the vector between a copy of the oxygeninducible E. coli sodA promoter (PsodA) for the endogenous MnSOD gene and the rho-independent sodA transcriptional terminator (sodTF), making use of a variety of restriction sites (NsiI and SacI, NdeI and B a m H I , or N c o I and B a m H I ) available in several variants 23-25 (Fig. 3). Transformants grown in Luria-Bertani (LB) medium with ampicillin selection and oxygen purging (for a dissolved oxygen level approaching 100%) efficiently express the heterologous protein. The highest levels of 23B. Gao, S. C. Flores, S. K. Bose, and J. M. McCord, Gene (Amst.) 176, 269 (1996). 24M. M. Whittaker and J. W. Whittaker, J. Biol. lnorg. Chem. 5, 402 (2000). 25M. M. Whittaker and J. W. Whittaker, J. Biol. Chem. 274, 34751 (1999).
86
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
expression are achieved with an expression host providing a s o d A background 26'27 (lacking the endogenous MnSOD, e.g., E. coli QC781,26 available from the E. coli Genetics Stock Center, New Haven, CT) in which the induction by oxidative stress is most effective. Metallation of the recombinant protein can be controlled in vivo by supplementing the culture medium with high levels of manganese or iron salts (metal ion at 1-5 mM) 28 The s o d A knockout strain is also useful for isolation of MnSOD genes by functional complementation, 27 and for the physiological characterization of heterologous MnSODs. 29
Purification of MnSOD Both endogenous MnSOD and recombinant enzyme produced under control of the PsodA promoter is highly expressed under conditions of oxidative stress, making oxidatively challenged cells a favorable source for isolating the enzyme. Purification of MnSOD is in general straightforward, because the enzyme is relatively robust and enzymes from a wide range of sources have fairly uniform properties, making a standardized purification protocol possible, using any convenient SOD assay to detect the enzyme and monitor the purification (e.g., xanthine oxidase/cytochrome c inhibition assay3°). The enzyme is typically thermostable, permitting use of an initial heat denaturation step to remove a significant fraction of contaminating proteins. This step would seem to be particularly attractive for preparation of recombinant thermophilic or hyperthermophilic SODs, but may actually be a disadvantage as those enzymes are normally expressed as metal-free apoenzymes in the mesophilic expression host. 24,25 In that case, heat treatment tends to complicate the isolation of pure metalloforms. We have found that the apoenzymes undergo a thermally triggered metallation process at elevated temperatures, resulting in relatively indiscriminate incorporation of any available metal ion. 24,25 In a crude cell extract this will lead to uptake primarily of iron and to a lesser extent of manganese and other metal ions. Careful purification of the intact metal-free apoenzyme (restricting the temperature to a moderate range during all purification steps) permits relatively controlled incorporation of specific metals in a subsequent step in which the apoenzyme (0.5 mM active sites) is incubated with metal salts [e.g., 10 mM MnC12, or 10 m M Fe(NH4)2(SO4)2 plus 5 mM sodium ascorbate] in 20 mM morpholineethanesulfonic acid (MOPS) buffer, pH 7 at 65-120 ° (e.g., in a thermal cycler or autoclave, depending on protein stability). 24,25 26A. Carlioz and D. Touati,EMBO J. 5, 623 (1986). 27H. M. Steinman,Mol. Gen. Gener 232, 427 (1992). 28M. M. Whittakerand J. W. Whittaker, Biochemistry 36, 8923 (1997). 29W.Inaoka,Y. Matsumura,and T. Tsuchido,J. BacterioL 180, 3697 (1999). 30j. M. McCord and I. Fridovich,J. BioL Chem. 244, 6049 (1969).
[8]
PROKARYOTIC MANGANESESUPEROXIDEDISMUTASES
87
High-performance ion-exchange chromatography has proved particularly useful for purification of MnSOD from cell extracts. 31 Under suitable conditions, anion-exchange chromatography is capable even of resolving proteins in distinct metallation states, presumably because of slight differences in protein charge. Alternatively, chromatofocusing chromatography may be used to resolve different metalloforms24 (Mn2-, Fe2-, Mn,Fe-, Mn-half apo-, Fe-half apo-, and metal-free apo-MnSOD), permitting each of these species to be isolated and characterized. Spectroscopic Characterization Optical absorption spectroscopy permits simple, routine characterization of the metal center in MnSOD. 32'33 However, optical absorption is associated only with the red, oxidized Mn(III) form of the enzyme, the Mn(II) form being essentially colorless and lacking any significant visible absorption. To ensure that spectroscopic results are quantitatively significant, the purified enzyme may be converted to the oxidized Mn(III) form by treatment with strong inorganic oxidants. In practice, we have found that Mo(V) [molybdicyanide,33 K3Mo(CN)8] and I(VII) (periodate, 34 NalO4) are particularly effective oxidants, producting only minimal side reactions. The reaction with molybdicyanide requires addition of an excess (> 2 equivalents) of oxidant, and is relatively slow, but the extent of reaction may be monitored by the increase in Mn(III) absorption at 475 nm. 33 The reaction with periodate is rapid and slightly more than 1 equivalent of oxidant is generally sufficient.34 Optical spectra recorded for the oxidized enzyme after desalting (by dialysis or gel filtration) yield the most reliable Mn(III) extinction coefficient. A typical Mn(III)SOD absorption spectrum is shown (Fig. 4, ABS). The spectrum is a broad absorption envelope, spanning the entire visible spectrum, and including all four spin-allowed ligand field (d--->d) electronic transitions arising from the high-spin ground state for the Mn(III) d 4 metal center in the protein. 33 The individual transitions are partly resolved in the first derivative of the absorption envelope (Fig. 4, DER), which contains turning points near 400, 450, 540, and 650 nm, together with multiplet fine structure features between 450 and 600 nm that rise from relatively weak spin-forbidden electronic transitions to spin-triplet excited states arising from the 3G and 3H free ion multiplets. The underlying structure of the absorption spectrum is more fully dissected in the circular dichroism spectrum (Fig. 4, CD), which resolves four components (dichroic extrema at 400, 435,550, and 625 nm). Magnetic circular dichroism (MCD) spectroscopy (not shown) can provide further 31W. F. Beyer,Jr., and I. Fridovich,J. Biol. Chem. 266, 303 (1991). 32j. A. Fee, E. R. Shapiro,and Z. H. Moss,J. Biol. Chem. 251, 6157 (1976). 33M. M. Whittakerand J. W. Whittaker,J. Am. Chem. Soc. 113, 5528 (1991). 34R. A. Edwards,M. M. Whittaker,J. W. Whittaker,E. N. Baker,and G. B. Jameson, Biochemistry 40, 15 (2001).
88
SUPEROXIDEREACTIONSAND MECHANISMS
[8]
+1o "1o tO "lO
-10
1000 ABS
o
500
+2
tO
+1
0k
0"
r-
CD
-1
,,.-,
-2
"~ O
-a 3 v
-4 ~
-
400
5
500
600
700
Wavelength (nm) FI~. 4. Opticalspectrafor E. coli Mn(III)superoxidedismutase. ABS,Absorption;DER,absorption derivative;CD, circulardichroism. (Activesites are I mMin 50 mMpotassiumphosphate buffer,pH 7.) information about assignment of the electronic transitions in the native and ligand complexes of the Mn(III) enzyme. 33 For manganese-only MnSODs, the absorption maximum typically occurs near 478 nm, associated with a molar extinction E478 of ,~850 M -1 c m - 1 (per manganese atom). The manganese-preferential cambialistic MnSODs are spectroscopically distinct, characteristically exhibiting a relatively blue-shifted absorption maximum (imax = 450 nm) and slightly lower extinction e450 = 660 M -1 cm -1 (per manganese atom). 24 The CD spectrum also appears to be distinct for the manganese-preferential cambialistic enzyme, with a lower rotational strength for the strongest CD band (AeL-R = - - 2 . 3 M -1 cm -1 for the manganese-preferred cambialistic SOD from the archaeon Pyrobaculum aerophilum 24 compared with - 4 M - t cm - t for the manganese-only SOD from E. coli).
[8]
PROKARYOTIC MANGANESE SUPEROXIDE DISMUTASES
89
5.6
I~ a~ln=95G "10"r" 8"7"~ A
o
i
~
3
,i
s
Magnetic Field (kG) FIG. 5. EPR spectrum for E. coli Mn(II) superoxide dismutase. (Active sites are 1 mM in 50 mM potassium phosphate buffer, pH 7.) Instrumental parameters: temperature, 5 K; microwave frequency, 9.46 GHz; microwave power, 1 roW; modulation amplitude, 10 G.
Substituting iron for manganese in MnSODs 24,25,35 results in protein exhibiting optical absorption spectra nearly indistinguishable from those of authentic FeSODs, 36 with a near-UV absorption band near 350 nm at low pH (pH < 6). The enzyme also typically exhibits significant SOD activity over this lower pH range. However, the iron-substituted enzyme is relatively sensitive to pH, the UV absorption bleaches, and SOD activity is rapidly lost as the pH is increased above pH 7, as a result of inhibitory binding by hydroxide ion to Fe(III) in the enzyme. 37 This "rusting" of iron in iron-substituted MnSOD appears to be an important aspect of metal specificity in this class of enzymes. Electron paramagnetic resonance (EPR) spectroscopy provides a complementary probe of the reduced Mn(II) mental center in MnSOD. 32'33 Although both oxidized [Mn(III), d 4, S = 2] and reduced [Mn(II), d 5, S = 5/2] forms have paramagnetic ground states and are in principle EPR active, only the reduced enzyme has an odd-electron (Kramers) ground state permitting routine EPR measurements. MnSOD is reduced by its product, hydrogen peroxide,38 and native MnSOD (which is generally a mixture of oxidation states) may be quantitatively converted to the homogeneous Mn(II) form by treatment with a small stoichiometric excess of hydrogen peroxide to ensure the maximum sensitivity of EPR measurements.24 A typical X-band EPR spectrum for Mn(II)SOD is shown in Fig. 5. The characteristic 35 F. Yamakura, K. Kobayashi, H. Ue, and M. Konno, Eur. J. Biochem. 227, 700 (1995). 36 T. O. Slykehouse and J. A. Fee, J. Biol. Chem. 251, 5472 (1976). 37 R. A. Edwards, M. M. Whittaker, J. W. Whittaker, G. B. Jameson, and E. N. Baker, J. Am. Chem. Soc. 120, 9684 (1998). 38 C. Bull, E. C. Niederhoffer, T. Yoshida, and J. A. Fee, J. Am. Chem. Soc. 113, 4069 (1991).
90
SUPEROXIDE REACTIONS AND MECHANISMS
[9]
features of the spectrum include strong absorption near 1,500 G (g = "-~6),exhibiting well-resolved nuclear hyperfine splittings (aMn ----95 G) arising from electronnuclear hyperfine coupling with the 55Mn nucleus (•=5/2, 100% n.a.). These spectral features reflect the nearly axial environment of the metal ion in the trigonal bipyramidal active site. The even-electron quintet Mn(III) ground state of native MnSOD has also been detected by polarization EPR methods. 39
Acknowledgment Support for this work from the National Institutes of Health (GM 42680) is gratefully acknowledged.
39 K. A. Campbell, E. Yikilmaz, C. V. Grant, G. Wolfgang, A.-E Miller, and R. D. Britt, J. Am. Chem. Soc. 121, 4714 (1999).
[9] Nickel-Containing Superoxide Dismutase B y J I N - W O N LEE, J U N G - H Y E ROE, a n d S A - O U K K A N G
Introduction Superoxide dismutases (SOD, EC 1.15.1.1) are metalloenzymes that catalyze the disproportionation of superoxide radical anion to hydrogen peroxide and molecular oxygen. The dismutation reaction catalyzed by SODs requires a metal center that is first reduced and then reoxidized by superoxide radical anion. SODs have been classified into three groups according to their metal centers: manganese (MnSOD), iron (FeSOD), and copper and zinc (Cu,ZnSOD). l These SODs may be derived from two evolutionary families. 2 The active site structures of these SODs show that the redox-active metal centers are ligated by a combination of histidine imidazoles, aspartate carboxylates, and water, with five-coordinate metal c e n t e r s . 3-6
I I. Fridovich, Annu. Rev. Biochem. 64, 97 (1995). 2 I. Fridovich, J. Biol. Chem. 264, 7761 (1989). 3 j. A. Tainer, E. D. Getzoff, J. S. Richardson, and D. C. Richardson, Nature (London) 306, 284 (1983). 4 W. C. Stallings, T. B. Powers, K. A. Pattridge, J. A. Fee, and M. L. Ludwig, Proc. Natl. Acad. Sci. U.S.A. 80, 3384 (1983). 5 M. W. Parker and C. C. E Blake, J. Mol. Biol. 199, 649 (1988). 6 W. C. Stallings, K. A. Pattfidge, R. K. Strong, and M. L. Ludwig, J. Biol. Chem. 259, 10695 (1984).
METHODSIN ENZYMOLOGY,VOL.349
Copyright2002.ElsevierScience(USA). All rights~eserved. 0076-6879102$35.00