Prolactin Receptor Gene Diversity: Structure and Regulation

Robbins J, ed: 1994a. Treatment of thyroid cancer in childhood. Proceedings of a Workshop. National Institutes of Health, Bethesda Maryland, 10–11 Sept., 1992. Publication No. DOE/EH-0406. Robbins J: 1994b. Characteristics of spontaneous and radiation induced thyroid cancers in children. In Nagataki S, ed. Nagasaki Symposium on Chernobyl: Update and Future. Amsterdam, Elsevier, pp 81–87. Robbins J, Adams W: 1989. Radiation effects in the Marshall Islands. In Nagataki S, ed. Radiation and the Thyroid. Amsterdam, Excerpta Medica, pp 11–14. Ron E, Lubin JH, Shore, RE, et al.: 1995. Thyroid cancer after exposure to external radiation: a pooled analysis of seven studies. Radiat Res 141:259–277. Santoro M, Chiapetta G, Cerrato A, et al.:1996. Development of thyroid papillary carcinomas secondary to tissue-specific expression of RET/PTC1 oncogene in transgenic mice. Oncogene 12:1821–1826.

Schneider AB, Fogelfeld L: 1997. Radiationinduced endocrine tumors. In Arnold A, ed. Endocrine Neoplasms. Boston, Kluwer Academic Publishers, p 141. Shore RE: 1992. Issues and epidemiological evidence regarding radiation-induced thyroid cancer. Radiat Res 131:98–111. Straume T, Marchetti AA, Anspaugh LR, et al.: 1996. The feasibility of using 129I to reconstruct 131I deposition from the Chernobyl reactor accident. Health Physics 71:733–740. Waldmann V, Rabes HM: 1997. Absence of Gs-alpha gene mutations in childhood thyroid tumors after Chernobyl in contrast to sporadic adult thyroid neoplasia. Cancer Res 57:2358–2361. Williams ED, Tronko ND, eds: 1996. Molecular, cellular biological characterization of childhood thyroid cancer. International Scientific Collaboration on Consequences of the Chernobyl Accident. Luxembourg, European Commission, EUR 16538 EN.

Prolactin Receptor Gene Diversity: Structure and Regulation Zhang-Zhi Hu, Li Zhuang and Maria L. Dufau

The diverse functionality of prolactin and the wide expression of the prolactin receptor suggest a complex system regulated by this polypeptide hormone. Different hormone and receptor forms, as well as differential signal transduction pathways, contribute to the functional diversity of prolactin’s actions. The heterogeneity of rat prolactin receptor gene transcripts in their 5⬘-untranslated region has led to the recognition of multiple and tissue-specific utilization of prolactin receptor gene promoters in gonadal and non-gonadal tissues. These findings have provided insights into the molecular basis for the diversity of prolactin’s actions. It is now clear that cellular responsiveness to prolactin can be regulated through differential promoter control of the expression of the surface receptors for prolactin in different target tissues.

Zhang-Zhi Hu, Li Zhuang and Maria L. Dufau are at the Section on Molecular Endocrinology, Endocrinology and Reproduction Research Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892, USA.

94

Williams ED, Cherstvoy E, Egloff B, et al.: 1996. Interaction of pathology and molecular characterization of thyroid cancers. In Karaglou A, Desmet G, Kelly GM, Menzel HG, eds. The Radiological Consequences of the Chernobyl Accident. Proceedings of the First International Conference, Minsk, Belarus, 18–22 March. Luxembourg, European Commission, EUR 16544 EN. P. 699. Wright PA, Williams ED, Lemoine NR, Wynford-Thomas D: 1991. Radiationassociated and spontaneous human thyroid carcinomas show a different pattern of ras oncogene mutation. Oncogene 6:471–473. Wynford-Thomas D: 1993. Molecular genetics of thyroid cancer. Trends Endocrinol Metab 4:224–232. Zimmerman D, Hay I, Bergstralh E: 1994. Papillary thyroid cancer in children. In Robbins J, ed. Treatment of Thyroid Cancer in Childhood. Proceedings of a workshop, National Institutes of Health, Bethesda Maryland, 10–11 Sept., 1992. Publication No. DOE/EH-0406, pp 3–10.

Prolactin (PRL) is a pituitary polypeptide hormone with highly diversified biological actions in numerous vertebrate species (Nicoll 1974, Doppler 1994). In addition to its well-known effects on reproduction, lactation and maternal behavior, PRL influences steroidogenesis, growth and metabolism, water–salt balance and immune regulation. These actions are exerted through specific prolactin receptors (PRLRs) that are expressed in a number of target tissues. PRLRs exist as a short form of 310 amino acids (aa) that was first cloned from the rat liver (Boutin et al. 1988), and a long form of 610 aa that was subsequently cloned from the rat ovary (Zhang et al. 1990) and human hepatoma and breast cancer cells (Boutin et al. 1989). In addition, an intermediate form of 412 aa, with a deletion of 198 aa within the cytoplasmic domain of the long form, was isolated from the rat Nb2 T lymphoma cell line (Nb2 form) (Ali et al. 1991), and a similar form was identified in human breast cancer cell lines (Clevenger et al. 1995). Also, a putative soluble PRLR lacking transmembrane and cytoplasmic domains has been isolated from the rat ovary (Zhang et al. 1990). PRLRs are

© 1998, Elsevier Science Ltd, 1043-2760/98/$19.00. PII: S1043-2760(98)00027-7

TEM Vol. 9, No. 3, 1998

single transmembrane proteins that belong to the superfamily of growth hormone/PRL/cytokine receptors. The long, short and intermediate forms of the PRLR possess common extracellular domains, but differ in their sequences and in the lengths of their cytoplasmic domains. The receptor proteins are expressed ubiquitously, with various proportions of the long and short forms in different tissues (Nagano and Kelly 1994). During hormonal stimulation, single PRL molecules bind to and induce dimerization of the PRLR (Rui et al. 1994). Although the PRLR is devoid of intrinsic tyrosine kinase activity, its dimerization leads to rapid tyrosine phosphorylation of the receptorassociated Jak2 kinase (Lebrun et al. 1995b), which in turn phosphorylates the receptor at a specific tyrosine residue in its C-terminal region (Tyr580 in the long form, and Tyr382 in the Nb2 form) (Lebrun et al. 1995a). This is followed by phosphorylation, dimerization and nuclear translocation of the transcription factor Stat5, also known as mammary gland factor (MGF) (Wakao et al. 1994). A proximal cytoplasmic domain of the receptor, termed box 1 (a proline-rich motif at aa 244–251), is necessary for association with and activation of Jak2 kinase (Lebrun et al. 1995b). Two additional cytoplasmic regions of the receptor, one between box 1 and box 2 (a second conserved proximal cytoplasmic motif at aa 280–295), and the other at the C-terminal region, are also required for full transcriptional induction by PRL through Stat5 (Lebrun et al. 1995b). Hence, the long but not the short form of the receptor is able to activate Stat5 to induce the transcription of milk protein genes (e.g. β-casein, β-lactoglobulin and whey acidic protein). Stat5 exists as two isoforms (5a and 5b), with ~96% aa similarity (Hennighausen et al. 1997), which form heterodimers that bind to the DNA consensus element γ−interferon activation site (GAS) to induce transcription of target genes. Activation of this pathway plays a critical role in the terminal differentiation of the mamTEM Vol. 9, No. 3, 1998

mary secretory epithelium. In mice, disruption of the Stat5a gene leads to loss of lactation, owing to failure of the mammary gland to develop and differentiate during pregnancy (Liu et al. 1997). Prolactin action has also been shown to be associated with the binding and activation of Stat1 through the GAS-like sequence of the interferon regulatory factor (IRF-1). In the hematopoietic cells (Yue-Lee 1997). In addition to the Jak–Stat pathway, the activated PRLR becomes associated with other signaling molecules, including mitogen-activated protein (MAP), Raf, Fyn and c-src kinases (Clevenger et al. 1994, Piccoletti et al. 1994, Berlanga et al. 1995, Das and Vonderhaar 1995). Although the short form of the receptor cannot activate Stat5 or induce milk protein gene transcription, PRL binding to the long or short form of the receptor promotes the growth of transfected NIH-3T3 cells, with transient activation of MAP kinase (Das and Vonderhaar 1995). The functional diversity of PRL’s actions has been well documented over the past few decades, but most of those actions remain poorly understood or incompletely characterized. However, recently, the mechanisms underlying the diversity of PRL’s actions have begun to be identified. In principle, the diverse actions of PRL could be manifested through the expression of receptor isotypes that bind lactogenic hormones, by activation of different signal transduction pathways, and by altering the responsiveness to PRL through differential control of PRLR gene expression in individual target tissues. The functional diversity of this hormone, and the wide distribution of its receptors, have suggested that a complex form of regulation determines the levels of PRLR expression in individual PRL target tissues. This has been revealed by the recent demonstration of multiple and tissuespecific promoter control of the PRLR gene in rat gonadal and non-gonadal tissues (Hu et al. 1996). •

Functional Diversity of PRL Action

In the mammary gland, PRL induces growth and differentiation of the

ductal and lobuloalveolar epithelium, acting in conjunction with estrogen, progesterone, growth hormone and several growth factors during pregnancy. It also initiates and maintains lactation during the postpartum period. Circulating PRL levels are elevated during pregnancy, but lactation is not initiated until after delivery, owing to the inhibitory effects of high levels of estrogen and progesterone on lactogenesis. PRL levels show a further increase immediately postpartum, followed by a gradual fall with episodic increases during each period of suckling. The PRL secretory pool is composed mainly of the bioactive form (little PRL, MW 23 000), and hormone release maintains lactogenesis and ensures an adequate milk supply for the next feeding (Yen 1991). PRL receptors are increased significantly in the rat mammary gland at the end of pregnancy and continue to increase during lactation. Ovariectomy during midpregnancy in the mouse, or treatment of the 19-day pregnant rat with the antiprogestin, RU486, increased PRLR mRNA in the mammary gland. However, both estrogen and progestins can increase PRLR mRNA levels in breast cancer cells. PRL is a mitogen that promotes the growth of mammary tumors in rodents (Meites 1988) and possibly also promotes the growth of human breast cancers (Hobbs and Salih 1973). PRLRs are expressed in most human breast cancer cell lines (Ormandy and Sutherland 1993). In addition, PRL is secreted from some breast cancer cells (Clevenger et al. 1995, Ginsburg and Vonderhaar 1995), suggesting an autocrine or paracrine role for PRL in the development of breast cancer. Furthermore, PRLR antagonists have been shown to inhibit the growth of certain breast cancer cell lines (Fuh and Wells 1995). PRL also plays important regulatory roles in the control of gonadal function. In the rat ovary, PRL promotes the formation and maintenance of functional corpora lutea by acting in concert with gonadotropins (Bonifacino and Dufau 1984). In the rat testis, PRL modulates Leydig cell function by 95

potentiation of luteinizing hormone (LH)-stimulated responses, partly through the control of LH receptor expression (Zipf and Wukie 1983). The importance of the PRLR in the reproductive system was illustrated further by the effects of null mutation of the PRLR gene in mice (Ormandy et al. 1997). The homozygous female mutant mice were sterile owing to a complete failure of embryonic implantation, and about 50% of the homozygous males were sterile or showed reduced fertility. Other impaired reproductive functions included irregular cycles, reduced fertilization rates and defective preimplantation embryonic development. In some of the heterozygous knock-out mice, maternal behaviors such as nest building and pup retrieval were also deficient. In humans, hyperprolactinemia interferes with normal ovarian function (Yen 1991). In cultured human granulosa cells, progesterone secretion can be inhibited by PRL at concentrations five- to sixfold higher than the normal serum level. The high PRL concentrations found in the follicular fluid of small follicles might inhibit progesterone secretion. In contrast, the lower levels of PRL found in mature follicles might be associated with enhanced progesterone secretion. In women, hyperprolactinemia can cause impaired follicle maturation and luteal function. On the other hand, suppression of PRL secretion from pituitary tumors with dopaminergic agonists does not prevent pregnancy (Molitch 1985). These results suggest that PRL may not be necessary for the formation and maintenance of the corpus luteum.

PRLRs are abundant in the liver, especially in the female, and are regulated by estrogen. PRL can activate MAP kinase and c-src in the liver (Piccoletti et al. 1994, Berlanga et al. 1995). It also regulates the sodiumdependent transport of taurocholate through the long form of the receptor by activating the Na+-taurocholate cotransporter gene promoter to induce its expression in the liver (Ganguly et al. 1997). PRLRs are also expressed by cells of the immune system. The wellknown action of PRL on lymphocytes is exemplified by the dependence of cell proliferation of the rat lymphoma Nb2 cell line on PRL. This cell line has been used to develop a highly sensitive assay for bioactive PRL in the circulation (Friesen et al. 1982), and has also been a valuable model in studies on the PRLR signaling pathway (Lebrun et al. 1994). Some subpopulations of lymphocytes synthesize and secrete PRL, suggesting an autocrine and/ or paracrine role for PRL in the regulation of immune function. PRL influences the proliferation, differentiation and/or apoptosis of immune cells, in part by regulating the expression of interferon regulatory factor 1 (Yu-Lee et al. 1990). This multifunctional transcription factor is important for the development of CD8+ T lymphocytes, and for the function of macrophages (Yu-Lee 1997). In the brain, PRL exerts regulatory roles that are relevant to the mediation of maternal and sexual behavior, lactation and feeding (Bakowska and Morrell 1997). The expression level of the PRLR gene changes in specific brain regions during pregnancy, stress and aging in rats

(Sugiyama et al. 1994, Fujikawa et al. 1995, Shamgochian et al. 1995, Chiu and Wise 1996). The expression of PRLRs also undergoes changes in the developing embryos of the rat, mouse and human (Royster et al. 1995, Freemark et al. 1997, Tzeng and Linzer 1997), suggesting that lactogenic hormones are important during development and differentiation of embryonic tissues throughout gestation. •

Multiple Forms of PRLR Transcripts and their Regulation

PRLR mRNA exhibits extensive heterogeneity in transcript sizes on northern blots, ranging from ~1.4 kb to ~10.5 kb, and varying from tissue to tissue and species to species. In the rat ovary, three major mRNA species of 9.7, 2.1 and 1.8 kb and two minor species of 4.6 and 2.6 kb are present (Hu and Dufau 1991). However, in the rat Leydig cell, only two major species of 9.7 and 1.8 kb, and a minor 2.4-kb form are present (Hu et al. 1996). The major 9.7 kb species encodes the long form of the receptor and the 2.1- and 1.8-kb species both encode the short form of the receptor (Hu and Dufau 1991, Hu et al. 1996). The differences between the long and short mRNA species (9.7 versus 2.1/1.8 kb) are listed in Table 1. In the rat liver, the 1.8-kb species, which corresponds to the short form of the receptor, is predominant. Larger transcripts (2.8, 3.5, 8.0 and 9.7 kb) are also present in the liver, but in much lower abundance. In the rat mammary gland, the 1.8-kb short receptor mRNA transcript is the predominant species observed by Northern blot analysis (Jahn et al.

Table 1. Characteristics of the major rat PRLR mRNA transcripts Receptor forms

Transcript size

5′-UTR

Coding region

3′-UTR

Tissue/cell types

Long form

9.7 kb

Short form

2.1 kb 1.8 kb

E11 (442 nt) E13 (236 nt) E11 (442 nt) E12 (233 nt) E13 (236 nt)

610 aa 610 aa 310 aa 310 aa 310 aa

>7 kb >7 kb ~0.35 kb ~0.35 kb ~0.35 kb

Ovary, Leydig cells Ovary, Leydig cells Ovary Liver Ovary, Leydig cells, liver, mammary gland

aa, amino acids; kb, kilobases; nt, nucleotides; UTR, untranslated region.

96

TEM Vol. 9, No. 3, 1998

1991, Hu et al. 1996). This contrasts with results obtained from reverse transcription–polymerase chain reaction (RT–PCR) analysis, which indicated that transcripts of the long receptor form are more abundant than those of the short form (Nagano and Kelly 1994). A complex pattern of mRNA heterogeneity of the PRLR gene is also present in the mouse (Clarke and Linzer 1993), which expresses seven mRNA species ranging from 1.4 kb to 10.5 kb, corresponding to both the long and short forms of the receptor. Multiple PRLR mRNA species are also present in the human, cow and rabbit and, presumably, correspond to the long and short forms of the receptor. However, the complete sequence of the cDNA encoding the short receptor isoform has not been reported in these species. Although the complete genomic sequence of the rat PRLR has not been reported, presumably alternative splicing of the primary transcripts from a single PRLR gene is a mechanism for generating multiple species of PRLR mRNA (9.7 kb versus 2.1/1.8 kb). The utilization of multiple promoters is another mechanism that contributes to the mRNA heterogeneity observed in many cell types (see below and Table 1). PRLRs are subject to multiple forms of hormonal regulation and, in general, are upregulated by the cognate hormone in PRL target tissues. Ovarian PRLRs undergo upregulation and downregulation at various stages of the rat and mouse estrous cycles (Solano et al. 1980, Mizoguchi et al. 1997). In gonadotropin [follicle-stimulating hormone (FSH)/human chorionic gonadotropin (hCG)]-induced pseudopregnant rat ovaries, PRLRs and their mRNAs are upregulated and downregulated by sequential gonadotropin administration at different stages of ovarian development (Hu and Dufau 1991). The 9.7-kb species is the only detectable species in the immature rat ovary. The 1.8-kb species was detected one to two days after treatment of immature rats with PMSG (pregnant mare serum gonadotropin, a preparation rich in FSH that induces follicular development), TEM Vol. 9, No. 3, 1998

while the 2.1-kb species was detected only after ovulation and was induced by hCG treatment. Heterologous downregulation of the PRLR and its multiple transcripts is observed within 24 h of hCG-induced ovulation and in luteinized ovaries after treatment with hCG. The 9.7-kb mRNA transcript encoding the long form of the receptor is of major functional importance, in that it is the predominant form present throughout ovarian development and most closely follows the pattern of lactogen receptor binding. Similarly, PRLRs are downregulated in Leydig cells of adult but not of immature rats treated with high doses of hCG (Davies et al. 1980, Huhtaniemi et al. 1983). Downregulation of PRLR mRNAs was also observed in the Leydig cell, in which the absence of a change in the half-life of the mRNA suggested that heterologous downregulation is associated with inhibition of transcription of the PRLR gene. Furthermore, it is conceivable that during such regulation, redistribution of receptors available for PRL binding at the cell surface to the large intracellular pool (which is unavailable to interact with hormone in the intact cell, but revealed after solubilization) may contribute to downregulation. In the rat ovary and mammary gland (Koppelman and Dufau 1982), the bound receptor is seven to eight times more abundant than the exposed receptor population. However, it is not known whether this pool is dynamically regulated, and whether it can be bypassed by newly synthesized receptors. In the mouse mammary gland, the level of long-form PRLR mRNA changed cyclically, being highest at estrus and lowest at diestrus II (Mizoguchi et al. 1997). In the midpregnant mouse, ovariectomy caused a 3.5-fold increase in long-form PRLR in the mammary gland, while the short form of the receptor remained unchanged (Mizoguchi et al. 1996). Sex steroids are the major regulators of PRLR expression in the rat liver (Jolicoeur et al. 1989). In this tissue, all transcripts were increased on day 19 of pregnancy, and underwent an abrupt decline at the onset of lactation

to levels lower than those of virgin rats (Jahn et al. 1991). In contrast, the levels of mammary gland PRLR mRNA were low in virgin and pregnant rats, increased significantly at day 21 of pregnancy, and continued to rise throughout lactation. The mRNA levels for the PRLR long form and β-casein increased approximately sixand 15-fold in the mouse from pregnancy to the lactating period, respectively (Nishikawa et al. 1994). In cultured mouse mammary epithelium, the PRLR long-form and β-casein mRNAs increased in response to insulin, cortisol and PRL, but were inhibited by progesterone or epithelial growth factor (EGF), which

A Ovarian form (9.7, 2.1 kb) –92 –557 –115 –55 +1(ATG)

B Liver form (1.8 kb) –348

–92 –115 –55 +1(ATG)

C Common form (ovary: 9.7, 1.8 kb; Leydig cell: 9.7, 2.4, 1.8 kb; liver and mammary gland: 1.8 kb) –92 –351 –115 –55 +1(ATG)

Figure 1. Multiple forms of the 5⬘-untranslated regions (UTRs) of rat prolactin receptor (PRLR) mRNA. The several identified forms of 5⬘-UTRs and the adjacent coding regions of PRLR mRNA transcripts are shown. Ovarian form (A), found predominantly in the ovary, much less in Leydig cells; liver form (B), specific to the liver; common form (C), present in gonadal and non-gonadal cells. Exon 2 is partially or entirely deleted in all three forms (see Fig. 2). Positions −115 and −55 are exon–intron junctions and position −92 is an alternative splicing site of this exon.

97

A Exon 1 Exon 2 E11

E13 PIII

PI

5′

3′

Exon 3

E12 PII

ATG

B −116

E11 ...AAAG gtaa... E12 ...CAAG gtat... E13 ...AGAA gtga...

5′

−115

3′

−93

...tttcag CTAAAGGACACTTCTCTGTGAAG −55 +1 +54 −92 GGAGC...ATG... GTGAGCACTGCAGATGTT −56 −74 TTGCACATGAGCCCTGAAG gtaa...

Exon 1

Exon 2

5′

3′

Exon 3

Figure 2. Genomic organization and exon–intron boundaries of the rat prolactin receptor (PRLR) 5⬘-untranslated region (UTR). A shows the genomic region corresponding to the 5⬘UTR of PRLR mRNA. E11 E12 and E13 are three alternative first exons transcribed from promoters PI, PII and PIII, respectively. The alternative splicing patterns are illustrated by lines and arrows connecting the different exons. Thick lines indicate the major splicing pathway and thin lines represent the alternative splicing pathways. Gaps marked // between exons indicate no overlapping genomic clones to cover adjacent exons. B shows sequences of the exon– intron boundaries and of the common exon 2. Underlined TGAAGs at −93 and −56 are the two alternative 5⬘-donor recognition sites responsible for partial deletion of exon 2 in the 5⬘-UTR of PRLR mRNA.

act as negative regulators of lactogenesis (Nishikawa et al. 1994). Pituitaryisografted mice showed substantially increased expression of PRLR mRNA in the epithelial cells of mammary ducts and alveoli (Bera et al. 1994). Lactogenic hormones are likely to be growth-stimulatory in human breast cancer cells. Coexpression and coregulation of the PRLR and the estrogen receptor are observed in many human breast cancer cell lines (Ormandy and Sutherland 1993). 17β-estradiol was shown to increase PRLR mRNA levels in MCF-7 cells (Lu et al. 1996). The expression of the PRLR can also be induced by progestin in MCF-7 and T-47D cells and by androgen in MCF-7 and MDA-MB-453 cells (Ormandy et al. 1992a and c). The expression of the PRLR gene is reduced by phorbol ester or sodium butyrate in both MCF-7 and T-47D cells, through inhibition of gene transcription (Ormandy et al. 1992b and 1993).

98

The long form of the PRLR is expressed widely in the brain (DiCarlo et al. 1992, Bakowska and Morrell 1997). PRLR mRNA is present mainly in the anteroventral periventricular nucleus, the medial preoptic area, specific subdivisions of the paraventricular and supraoptic nuclei, the arcuate and ventromedial nuclei of the hypothalamus and in the limbic system and choroid plexus (Bakowska and Morrell 1997). mRNA levels are significantly higher in the medial preoptic area and the bed nucleus of the stria terminalis and the choroid plexus at day 21 than day 2 of pregnancy in rats (Bakowska and Morrell 1997). Restraint stress in rats caused a rapid increase in serum PRL and induced expression of the PRLR long form in the choroid plexus, suggesting stress-induced, choroid plexus PRLR-mediated transport of serum PRL into cerebrospinal fluid (Fujikawa et al. 1995). PRLR gene expression in specific hypothalamic

nuclei increases with age. The levels of PRLR mRNA in the choroid plexus, periventricular area of the preoptic nucleus and arcuate nucleus were increased significantly in old animals (16–19 months of age) (Chiu and Wise 1996). Increasing PRL levels, or responsiveness to PRL, may contribute to reproductive aging by influencing the secretory patterns of hypothalamic gonadotropin-releasing hormone, pituitary gonadotropins, and/or ovarian steroids. In general, transcripts for the long form of the PRLR are more subject to regulation than those of the short form, consistent with the notion that the long form of the receptor is of major functional importance in regulatory processes. •

Heterogeneity and Genomic Organization of the PRLR mRNA 5ⴕ-untranslated Region

PRLR mRNAs display highly heterogeneous 5⬘-end sequences, irrespective of their coding regions and the lengths of their 3⬘-untranslated regions (UTRs). Analyses of the 5⬘-UTR of PRLR mRNA from rat gonads (Hu et al. 1996), liver (Hu et al. 1996, Rubtsov and Lonina 1996) and mammary glands (Hu et al. 1997) by 5⬘ RACE (rapid amplification of cDNA ends) revealed three distinct 5⬘-end mRNA sequences, together with variant forms with deletions between nucleotide positions −55 and −92 or −115 (Fig. 1). The three unique 5⬘-end sequences are designated as E11 [442 nucleotides (nt)], E12 (233 nt) and E13 (236 nt), and each is followed by common 5⬘UTRs and identical coding regions (Fig. 1). Genomic analysis of the 5⬘UTR and the N-terminal coding regions has demonstrated that three alternative first exons (E11, E12 and E13), and a second non-coding exon are present in the 5⬘-non-coding region (Fig. 2) (Hu et al. 1996). The three first exons are alternatively spliced on to the common non-coding exon 2, followed by exon 3 containing the ATG translation initiation codon. The alternative donor site in the middle of exon 2 accounts for the 55 bp deletion variant forms of the 5⬘-UTR. Therefore, alternative splicing of partial or entire TEM Vol. 9, No. 3, 1998

Figure 3. Chromosomal colocalization of the three rat promoter regions by fluorescence in situ hybridization. Metaphase chromosomes of the rat fibroblast were hybridized with a spectrum orange-labeled genomic probe (~12 kb) (red signal in panel B) corresponding to exons 4 and 5 (coding region) of the PRLR by fluorescence in situ hybridization. Panel A is a G-banding stain of the same chromosomes shown in panel B, indicating that the rat PRLR gene is located on chromosome 2 long arm region 16 (2q16, marked with an arrow). The inset highlights that the same chromosome locus is hybridized by probes either containing PI and PII genomic regions (PI/PII) labeled with biotin (green signal) or the PIII genomic region (PIII) labeled with spectrum orange. This finding indicates that the three promoters of the PRLR are colocalized to 2q16 with the common coding region.

exon 2, along with three distinct first exons in the 5⬘-UTR, account for all 5⬘UTR forms of PRLR mRNAs (Figs 1 and 2). Tissue-specific expression of these unique 5⬘-end sequences in rat tissues has been demonstrated by 5⬘ RACE, as well as by Northern blot analysis. E11 is expressed predominantly in the ovary, is much less abundant in Leydig cells (~15% of the total PRLR mRNA species), and is termed the ovarian form; E12 is expressed specifically in the liver (liver form); while E13 is a common form expressed in all tissues examined, including the rat ovary, Leydig cells, liver and mammary gland (Hu et al. 1996 and 1997). The expression of the ovarian (E11) and the liver forms (E12) of the 5⬘-end sequences predominates over that of the common form (E13) in the rat ovary and the liver, respectively. However, in rat Leydig cells, E13 is the predominant species and in the mammary gland E13 is the sole form of the 5⬘-end sequence of PRLR mRNA. 5⬘end sequence diversity is also responsible for some of the PRLR mRNA TEM Vol. 9, No. 3, 1998

species observed on Northern blots (Table 1). In the rat ovary, the size difference between the 2.1-kb and 1.8-kb species that encode the short form of the PRLR reflects the presence of E11 (442 nt) and E13 (236 nt) at their 5⬘ends, respectively. In contrast, in the rat liver the 1.8-kb species contains either E12 (233 nt) or E13 at the 5⬘-end, with no apparent difference in their sizes. However, the size differences between E11 and E12 or E13 cannot be resolved for the 9.7-kb species on Northern blots owing to limited resolution of this separation technique for transcripts of large sizes. The 9.7-kb transcript contains a much longer stretch of 3⬘-UTR (>7 kb) than the 2.1/1.8-kb forms. The unique 5⬘-end sequences are indicative of transcription initiation from specific regions of the PRLR gene, i.e. specific promoters of the PRLR gene (Hu et al. 1996). As the alternative first exons are associated with messages for both the long-form (9.7 kb) and the short-form receptors (2.1/1.8 kb), which are generally present in various tissues, it is deduced that different receptor forms are not dependent on utilization of the specific promoters. However, promoter utilization is highly dependent on the tissue type. •

Multiple and Tissue-specific Promoter Control of Rat PRLR Gene Transcription

Three PRLR gene promoters, promoter I (PI), promoter II (PII) and promoter III (PIII), which initiate the transcription of exons E11, E12 and E13 of the PRLR transcripts, respectively, have been identified and isolated from the rat genome. Using fluorescence in situ hybridization with genomic probes containing the coding (exon 4/5), PI/PII or PIII regions, the three promoter regions have been mapped to the same chromosomal locus (2q16) as the PRLR coding sequence (Fig. 3). The order of the three promoter regions, which span over 20 kb of the genome, is 5⬘-PIII-PI-PII-3⬘ (Fig. 2). The human PRLR gene has been localized to chromosome 5 at a locus close to the growth hormone receptor gene (Arden et al. 1990) but, to

date, its gene and promoter domain(s) have not been characterized. The three rat promoters direct transcription from three alternative sites in a single PRLR gene. A single major transcription start site (TSS) for the PI promoter is located at −549 (relative to the translation start codon ATG +1); multiple TSSs at −405, −461 and −506 were determined for PII; and two major sites at −340 and −351 are directed from promoter III. The flanking regions for all three promoters do not contain a consensus TATA-box sequence within the expected distance (10–30 bp) from their TSS, or consensus initiator sequences close to or at TSS, but contain consensus DNA sequences for some of the known transcription factors. Thus, in general, the PRLR promoters belong to a TATA-less/non-initiator class. The PRLR gene promoters are utilized in a tissue-specific manner. Promoter I is used specifically in rat gonadal cells, more actively in ovarian cells than in Leydig cells. Such gonadspecific utilization of PI is also evident in transfection studies, in which a 1.4-kb genomic fragment containing PI can direct active and faithful transcription of the reporter gene from a mouse Leydig tumor cell line (MLTC), but exhibits little activity in liverderived HepG2 cells (Hu et al. 1997) (Fig. 4A). The minimal promoter domain of PI is located within a 5⬘ flanking region of 152 bp (−700 to −549). A consensus steroidogenic factor 1 (SF1) binding site is located at −668 (CCAAGGTCA), and binds to SF-1 protein in nuclear extracts of MLTC, rat granulosa cells and Leydig cells (Fig. 5A). SF-1 is an essential transcriptional activator of the PI promoter in gonadal cells, because mutation of the SF-1 element greatly reduces basal promoter activity in these cells (Hu et al. 1997). In cultured rat granulosa cells, treatment with hCG increases PI activity to ~250% of the basal level (Fig. 4B). While the SF1 mutant shows reduced basal activity, it is still inducible by hCG (Fig. 4B) and also by 8-bromo-cAMP (not shown). These results indicate that SF-1 is not required specifically for 99

A

B 250 Luciferase activity (% of wild type) in rat granulosa cells

Luciferase activity (fold-induction)

80 70 60 50 40 30 20 10 0

200

150

100 50

0 PI

PII

PIII

SV40

PI PI Wild-type SF1-mutant

Figure 4. Cell-type-specific activation of the prolactin receptor (PRLR) promoters in gonadal and non-gonadal cells (A). Luciferase reporter constructs of PI (−1566/−124), PII (−1264/−181) and PIII (−1427/−179) containing the 5′-flanking regions and partial first exons were expressed transiently in MLTC (shaded bars) and HepG2 cells (open bars). Luciferase activities are expressed as fold-induction over that of the basic vector (pGL2) lacking a PRLR gene insert. The SV40 promoter activates the reporter gene equally well in both cell types, while PI and PII activate the reporter differentially in each cell type. Promoter III exerts strong activity in both cell types. SF1 is essential for basal but not for hCG-induced promoter activity of the PI promoter in rat ovarian granulosa cells (B). Luciferase constructs of the wild-type (PI −700/−549) promoter and its SF-1 mutant were transfected transiently into primary rat granulosa cell cultures. Luciferase activities are expressed as percentage of wild-type activity in the absence of hCG (open bars). Granulosa cells were cultured in the presence of 15 ng ml−1 ovine FSH and 10 ng ml−1 testosterone for three days before transfection. hCG at a final concentration of 20 ng ml −1 (closed bars) or media alone (control, open bars) was added 6 h before the termination of cell culture. FSH, follicle-stimulating hormone; hCG, human chorionic gonadotropin; MLTC, mouse Leydig tumor cell line; SF-1, steroidogenic factor 1.

A −700

B −607

(−668) SF-1

(−623) CCAAT

−506

(−559) TATA-like −549

−461

−405

AP-1 HNF4 (−255) (−240)

AP-1 (−515, −502) C −437

(−398) C/EBP

−181

−351−340

(−273, −262) SP1 −179

Figure 5. Functional domains of the rat prolactin receptor (PRLR) promoters PI (A), PII (B) and PIII (C). The minimal functional domains of the three promoters are represented in the three diagrams. All three promoter domains contain sufficient regulatory elements for full or near-full promoter activity in transiently transfected cells. The identified nuclear protein-binding sites are SF-1 (PI), HNF4 (PII), C/EBP and Sp1 (PIII). CCAAT and TATA-like sequences in PI do not show nuclearbinding activities, but decrease or increase PI promoter activity, respectively, when mutated. The AP1 sites in PIII are consensus sequences that are potential sites for AP1 protein binding. HNF4, hepatic nuclear factor 4; SF-1, steroidogenic factor 1; C/EBP, CCAAT box/enhancer-binding protein.

100

hCG/cAMP induction of PI promoter activity in these cells. SF-1, also known as Ad4BP, is a zinc-finger DNAbinding protein that is essential for transcription of steroidogenic enzymes, and for gonadal development (Luo et al. 1994). In addition to the SF1-binding site, a CCAAT box consensus sequence makes a minor contribution to the activity of PI. Because SF-1 is expressed specifically in steroidogenic tissues, it is a major determinant of the gonad-specific utilization of promoter I (Hu et al. 1997). However, it remains to be determined whether other non-gonadal SF-1-expressing tissues, such as adrenal and pituitary glands, which express the PRLR, also utilize the PI promoter. Promoter II is used specifically in the rat liver (Hu et al. 1996). This specificity of PII can also be shown in transfection studies, in which a PII reporter gene is well activated in HepG2 but not in MLTC cells (Fig. 4A). The full promoter activity of PII resides at −664 to −181 (Moldrup et al. 1996). A liver-enriched transcription factor, hepatic nuclear factor 4 (HNF4) was found to bind the sequence GGGCAAGTCA (−250/−240) downstream of the TSS. When cotransfected into CHO cells, HNF4 significantly activated the proximal domain (−343/−177) (approximately tenfold) but barely affected the upstream domains (−722/−177 or −1259/−177) of PII (Moldrup et al. 1996). It appears that more upstream elements are necessary for full activity of this promoter, and that HNF4 may be required for the liver-specific utilization of the PII promoter. Apart from HNF4, several consensus AP1 sites are present within the promoter domain (Fig. 5B). Promoter III is used commonly in the gonads and liver, and is the sole promoter in the rat mammary gland. In contrast to PI and PII, the PIII promoter is well activated in both HepG2 and MLTC cell cultures in transfection studies (Fig. 4A). The minimal promoter domain of PIII has been localized to a region of 258 bp (−179 to −437) containing partial E13 sequences. Binding sites for transcription factors C/EBP (CCAAT TEM Vol. 9, No. 3, 1998

box/enhancer-binding protein) and Sp1 are present within this minimal promoter region (Fig. 5C). It is conceivable that the wide expression of C/EBP, and the ubiquitous presence of Sp1 proteins, may account for the activation of PIII as a common promoter utilized in all PRLR-expressing tissues examined so far. These findings may provide insights into the molecular basis of the diverse functions of PRL through differential control of PRLR gene expression. •

Conclusions and Perspectives

The structural diversity of the PRLR gene transcriptional regulatory regions is consistent with the complexity of the PRL-regulated system. The configuration of the PRLR gene promoters allows this gene to be regulated differentially at the transcriptional level in a tissue-specific and possibly a developmentally specific manner. The significance of dual promoter control of the PRLR gene in some tissues is not clear. It may be redundant or compensatory, or may serve to maintain a minimal level of expression. While one promoter is temporarily nonoperative, the other may be maintained to ensure a threshold level of response. Because species differences have been observed for the actions of PRL, the configuration of the PRLR gene promoters may also be expected to differ among different species. The level of expression of PRLRs in various tissues may be a key factor in determining the cell’s ability to respond to and coordinate PRL’s signaling activity in various physiological and pathological conditions. References Ali S, Pellegrini I, Kelly PA: 1991. A prolactindependent immune cell line (Nb2) expresses a mutant form of prolactin receptor. J Biol Chem 266:20110–20117. Arden KC, Boutin JM, Djiane J, Kelly PA, Cavenee WK: 1990. The receptors for prolactin and growth hormone are localized in the same region of human chromosome 5. Cytogenet Cell Genet 53:161–165. Bakowska JC, Morrell JI: 1997. Atlas of the neurons that express mRNA for the long form of the prolactin receptor in the forebrain of the female rat. J Comp Neurol 386:161–177.

TEM Vol. 9, No. 3, 1998

Bera TK, Hwang SI, Swanson SM, Guzman RC, Edery M, Nandi S: 1994. In situ localization of prolactin receptor message in the mammary glands of pituitary-isografted mice. Mol Cell Biochem 132:145–149. Berlanga JJ, Fresno Vara JA, Martin-Perez J, Garcia-Ruiz JP: 1995. Prolactin receptor is associated with c-src kinase in rat liver. Mol Endocrinol 9:1461–1467. Bonifacino JS, Dufau ML: 1984. Prolactin receptor in the ovary. In Saxena BB, ed. Hormone Receptors in Growth and Reproduction. New York, Raven Press, pp 149–163. Boutin JM, Jolicoeur C, Okamura H, et al.: 1988. Cloning and expression of the rat prolactin receptor, a member of the growth hormone/prolactin receptor gene family. Cell 53:69–77. Boutin JM, Edery M, Shirota M, et al.: 1989. Identification of a cDNA encoding a long form of prolactin receptor in human hepatoma and breast cancer cells. Mol Endocrinol 3:1455–1461. Chiu S, Wise PM: 1996. Prolactin receptor gene expression in specific hypothalamic nuclei increases with age. J Gerontol A Biol Sci Med Sci 51:B220–B224. Clarke DL, Linzer DI: 1993. Changes in prolactin receptor expression during pregnancy in the mouse ovary. Endocrinology 133:224–232. Clevenger CV, Torigoe T, Reed JC: 1994. Prolactin induces rapid phosphorylation and activation of prolactin receptor-associated RAF-1 kinase in a T-cell line. J Biol Chem 269:5559–5565. Clevenger CV, Chang WP, Ngo W, Pasha TL, Montone KT, Tomaszewski JE: 1995. Expression of prolactin and prolactin receptor in human breast carcinoma. Evidence for an autocrine/paracrine loop. Am J Pathol 146:695–705. Das R, Vonderhaar BK: 1995. Transduction of prolactin’s (PRL) growth signal through both long and short forms of the PRL receptor. Mol Endocrinol 9:1750–1759. Davies TF, Katikineni M, Chan V, Harwood JF, Dufau ML, Catt KJ: 1980. Lactogenic receptor regulation in hormone-stimulated steroidogenic cells. Nature 283:863–865. DiCarlo R, Muccioli G, Papotti M, Bussolati G: 1992. Characterization of prolactin receptor in human brain and choroid plexus. Brain Res 570:341–346. Doppler W: 1994. Regulation of gene expression by prolactin. Rev Physiol Biochem Pharmacol 124:93–130. Freemark M, Driscoll P, Maaskant R, Petryk A, Kelly PA: 1997. Ontogenesis of prolactin receptors in the human fetus in early gestation. Implications for tissue differen-

tiation and development. J Clin Invest 99: 1107–1117. Friesen HG, Shiu RPC, Robertson MC, et al.: 1982. Studies of prolactin and prolactin receptors using the Nb2 node lymphoma cells. In Motta M, Zanisi M, Piva F, eds. Pituitary Hormones and Related Peptides. London, Academic Press, pp 101–115. Fuh G, Wells JA: 1995. Prolactin receptor antagonists that inhibit the growth of breast cancer cell lines. J Biol Chem 270:13133–13137. Fujikawa T, Soya H, Yoshizato H, et al.: 1995. Restraint stress enhances the gene expression of prolactin receptor long form at the choroid plexus. Endocrinology 136:5608–5613. Ganguly TC, O’Brien ML, Karpen SJ, Hyde JF, Suchy FJ, Vore M: 1997. Regulation of the rat liver sodium-dependent bile acid cotransporter gene by prolactin. Mediation of transcriptional activation by Stat5. J Clin Invest 99:2906–2914. Ginsburg E, Vonderhaar BK: 1995. Prolactin synthesis and secretion by human breast cancer cells. Cancer Res 55:2591–2595. Hennighausen L, Robinson GW, Wagner KU, Liu W: 1997. Prolactin signaling in mammary gland development. J Biol Chem 272:7567–7569. Hobbs JR, Salih H: 1973. Prolactin dependence in human breast cancer. Proc R Soc Med 66:866. Hu Z-Z, Dufau ML: 1991. Multiple and differential regulation of ovarian prolactin receptor messenger RNAs and their expression. Biochem Biophys Res Commun 181: 219–225. Hu Z-Z, Zhuang L, Dufau ML: 1996. Multiple and tissue-specific promoter control of gonadal and non-gonadal prolactin receptor gene expression. J Biol Chem 271: 10242–10246. Hu Z-Z, Zhuang L, Guan X, Meng J, Dufau ML: 1997. Steroidogenic factor-1 is an essential transcriptional activator for gonad-specific expression of promoter I of the rat prolactin receptor gene. J Biol Chem 272:14263–14271. Huhtaniemi IT, Warren DW, Catt KJ: 1983. Development of heterologous downregulation of lactogen receptors in the rat testis. Mol Cell Endocrinol 29:287–294. Jahn GA, Edery M, Belair L, Kelly PA, Djiane J: 1991. Prolactin receptor gene expression in rat mammary gland and liver during pregnancy and lactation. Endocrinology 128:2976–2984. Jolicoeur C, Boutin JM, Okamura H, Raguet S, Djiane J, Kelly PA: 1989. Multiple regulation of prolactin receptor gene expression in rat liver. Mol Endocrinol 3:895–900.

101

Koppelman MC, Dufau ML: 1982. Prolactin receptors in luteinized rat ovaries: unmasking of specific binding sites with detergent treatment. Endocrinology 111:1350–1357. Lebrun JJ, Ali S, Sofer L, Ullrich A, Kelly PA: 1994. Prolactin-induced proliferation of Nb2 cells involves tyrosine phosphorylation of the prolactin receptor and its associated tyrosine kinase JAK2. J Biol Chem 269:14021–14026. Lebrun JJ, Ali S, Goffin V, Ullrich A, Kelly PA: 1995a. A single phosphotyrosine residue of the prolactin receptor is responsible for activation of gene transcription. Proc Natl Acad Sci USA 92:4031–4035. Lebrun JJ, Ali S, Ullrich A, Kelly PA: 1995b. Proline-rich sequence-mediated Jak2 association to the prolactin receptor is required but not sufficient for signal transduction. J Biol Chem 270:10664–10670. Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L: 1997. Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 11:179–186. Lu YF, Sun G, Wang X, Safe S: 1996. Inhibition of prolactin receptor gene expression by 2,3,7,8-tetrachlorodibenzop-dioxin in MCF-7 human breast cancer cells. Arch Biochem Biophys 332:35–40. Luo X, Ikeda Y, Parker KL: 1994. A cellspecific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490. Meites J: 1988. Biological functions of prolactin in mammals. Prolactin gene family and its receptors: molecular biology to clinical problems. In Hoshino K, ed. Proceedings of the Fifth International Congress on Prolactin, Kyoto, Japan, 13–16 July 1988. New York, Elsevier Science Publishers, pp 123–130.

gene expression. Quantitative analysis by polymerase chain reaction. J Biol Chem 269:13337–13345. Nicoll CS: 1974. Physiological actions of prolactin. In Knobil E, Sawyer WH, eds. Handbook of Physiology. Washington, American Physiological Society, pp 253–292. Nishikawa S, Moore RC, Nonomura N, Oka T: 1994. Progesterone and EGF inhibit mouse mammary gland prolactin receptor and beta-casein gene expression. Am J Physiol 267:C1467–C1472. Ormandy CJ, Sutherland RL: 1993. Mechanisms of prolactin receptor regulation in mammary gland. Mol Cell Endocrinol 91:C1–C6. Ormandy CJ, Clarke CL, Kelly PA, Sutherland RL: 1992a. Androgen regulation of prolactin-receptor gene expression in MCF-7 and MDA-MB-453 human breast cancer cells. Int J Cancer 50:777–782. Ormandy CJ, de Fazio A, Kelly PA, Sutherland RL: 1992b. Transcriptional regulation of prolactin receptor gene expression by sodium butyrate in MCF-7 human breast cancer cells. Endocrinology 131:982–984. Ormandy CJ, Graham J, Kelly PA, Clarke CL, Sutherland RL: 1992c. The effect of progestins on prolactin receptor gene transcription in human breast cancer cells. DNA Cell Biol 11:721–726. Ormandy CJ, Lee CS, Kelly PA, Sutherland RL: 1993. Regulation of prolactin receptor expression by the tumour promoting phorbol ester 12-O-tetradecanoylphorbol13-acetate in human breast cancer cells. J Cell Biochem 52:47–56. Ormandy CJ, Camus A, Barra J, et al.: 1997. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 11:167–178.

Mizoguchi Y, Kim JY, Sasaki T, et al.: 1996. Acute expression of the PRL receptor gene after ovariectomy in midpregnant mouse mammary gland. Endocr J 43:537–544.

Piccoletti R, Maroni P, Bendinelli P, BernelliZazzera A: 1994. Rapid stimulation of mitogen-activated protein kinase of rat liver by prolactin. Biochem J 303:429–433.

Mizoguchi Y, Kim JY, Enami J, Sakai S: 1997. The regulation of the prolactin receptor gene expression in the mammary gland of early pregnant mouse. Endocr J 44:53–58.

Royster M, Driscoll P, Kelly PA, Freemark M: 1995. The prolactin receptor in the fetal rat: cellular localization of messenger ribonucleic acid, immunoreactive protein, and ligand-binding activity and induction of expression in late gestation. Endocrinology 136:3892–3900.

Moldrup A, Ormandy C, Nagano M, et al.: 1996. Differential promoter usage in prolactin receptor gene expression: hepatocyte nuclear factor 4 binds to and activates the promoter preferentially active in the liver. Mol Endocrinol 10:661–671. Molitch ME: 1985. Pregnancy and the hyperprolactinemic woman. New Engl J Med 312:1364–1370. Nagano M, Kelly PA: 1994. Tissue distribution and regulation of rat prolactin receptor

102

Rubtsov PM, Lonina DA: 1996. Heterogeneity of prolactin receptor mRNA 5′-untranslated region in rat liver. Mol Biol (Moscow) 30:193–198. Rui H, Lebrun JJ, Kirken RA, Kelly PA, Farrar WL: 1994. JAK2 activation and cell proliferation induced by antibody-mediated prolactin receptor dimerization. Endocrinology 135:1299–1306.

Shamgochian MD, Avakian C, Truong NH, Stone S, Tang KT, DeVito WJ: 1995. Regulation of prolactin receptor expression by estradiol in the female rat brain. NeuroReport 6:2537–2541. Solano AR, Vela AG, Catt KJ, Dufau ML: 1980. Regulation of ovarian gonadotropin receptors and LH bioactivity during the estrous cycle. FEBS Lett 122:184–188. Sugiyama T, Minoura H, Kawabe N, Tanaka M, Nakashima K: 1994. Preferential expression of long form prolactin receptor mRNA in the rat brain during the oestrous cycle, pregnancy and lactation: hormones involved in its gene expression. J Endocrinol 141:325–333. Tzeng SJ, Linzer DI: 1997. Prolactin receptor expression in the developing mouse embryo. Mol Reprod Dev 48:45–52. Wakao H, Gouilleux F, Groner B: 1994. Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J 13:2182–2191. Yen SSC: 1991. Prolactin in human reproduction. In Yen SSC, Jaffe RB, eds. Reproductive Endocrinology: Physiology, Pathophysiology, and Clinical Management. Philadelphia, Saunders, pp 357–388. Yu-Lee LY: 1997. Molecular actions of prolactin in the immune system. Proc Soc Exp Biol Med 215:35–52. Yu-Lee LY, Hrachovy JA, Stevens AM, Schwarz LA: 1990. Interferon-regulatory factor 1 is an immediate–early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol Cell Biol 10:3087–3094. Zhang R, Buczko E, Tsai-Morris CH, Hu ZZ, Dufau ML: 1990. Isolation and characterization of two novel rat ovarian lactogen receptor cDNA species. Biochem Biophys Res Commun 168:415–422. Zipf WB, Wukie JJ: 1983. Role of prolactin and growth hormone in the maintenance of normal Leydig cell function. In Negro-Vilar A, ed. Male Reproduction and Fertility. New York, Raven Press, pp 65–73.

Correspondence TEM encourages comment on all published articles. Letters to the editor should be addressed to Helen Carroll, Editorial Assistant, Elsevier Trends Journals, 68 Hills Road, Cambridge, UK CB2 1LA. Tel: +44 1223 315961 Fax: +44 1223 464430 E-mail: [email protected]

TEM Vol. 9, No. 3, 1998