Proliferation and chondrogenic differentiation of human adipose-derived mesenchymal stem cells in porous hyaluronic acid scaffold

Journal of Bioscience and Bioengineering VOL. 112 No. 4, 402 – 408, 2011 www.elsevier.com/locate/jbiosc

Proliferation and chondrogenic differentiation of human adipose-derived mesenchymal stem cells in porous hyaluronic acid scaffold In-Soo Yoon, 1 Chung Wook Chung, 2 Jong-Hyuk Sung, 3 Hyun-Jong Cho, 1 Jung Sun Kim, 4 Won-Sik Shim, 1 Chang-Koo Shim, 1 Suk-Jae Chung, 1 and Dae-Duk Kim 1,⁎ College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742, South Korea, 1 Pusan National University Yangsan Hospital, Kyungnam 626-770, South Korea, 2 Department of Applied Bioscience, CHA University, Seoul 135-081, South Korea, 3 and Division of Health Science, Dongseo University, Busan 617-716, South Korea 4 Received 17 March 2011; accepted 30 June 2011 Available online 30 July 2011

Human adipose-derived mesenchymal stem cells (AD-MSCs) attracted much interest as a promising alternative to autologous chondrocytes and bone marrow-derived mesenchymal stem cells for cartilage regeneration. Developing a suitable culture technique to direct AD-MSCs into the chondrogenic lineage could be a crucial prerequisite for the cartilage defect repair application of AD-MSCs. Herein, we prepared the PEGDG-crosslinked porous three-dimensional (3D) hyaluronic acid (HA) scaffold and evaluated for its feasibility to induce proliferation and chondrogenic differentiation of the AD-MSCs. In addition, the effect of bone-morphogenetic protein-2 (BMP-2) and platelet-derived growth factor (PDGF) on chondrogenic differentiation was further investigated. Proliferation and chondrogenic differentiation were evaluated by cell morphology, DNA contents, s-GAG contents, and level of mRNA expression of relevant marker genes. When cultured with reference chondrogenic medium (RCM; serum-free DMEM-HG supplemented with 10 ng/mL of transforming growth factor-β1 (TGF-β1), 50 nM ascorbate, 100 nM dexamethasone, and 5 μg/mL of ITS), better proliferation and chondrogenic differentiation of ADMSCs were obtained in the 3D HA scaffold culture as compared to the micromass culture, a standard 3D culture system. Moreover, the level of chondrogenic differentiation of AD-MSCs in the HA scaffold–RCM culture system was further increased by BMP-2, and decreased by PDGF. These results suggested that the HA scaffold with RCM was a promising chondrogenic culture system of AD-MSCs, and that BMP-2 could potentially serve as a chondrogenic supplement for AD-MSCs. However, PDGF was determined to be an inappropriate supplement based on its inhibition of the chondrogenic differentiation of AD-MSCs. © 2011, The Society for Biotechnology, Japan. All rights reserved. [Key words: Human adipose-derived mesenchymal stem cells; Hyaluronic acid; Scaffold; Chondrogenic differentiation; Bone-morphogenetic protein-2; Platelet-derived growth factor]

Cell-based therapy has been widely known as a promising means to overcome the poor self-repair capacity of the cartilage (1–3). In 1997, the first cell-therapy product using autologous chondrocytes (Carticel™; Genzyme, Cambridge, MA, USA) was approved for the repair of symptomatic cartilage defects of the femoral condyle (4). However, poor in vitro proliferation and donor site damage have limited its clinical application (5). Thus, instead of autologous chondrocytes, studies have been focused on mesenchymal stem ⁎ Corresponding author. Tel.: + 82 2 880 7870; fax: + 82 2 873 9177. E-mail address: [email protected] (D.-D. Kim). Abbreviations: AD-MSCs, adipose-derived mesenchymal stem cells; BCM, RCM supplemented with 50 ng/mL of BMP-2; BM-MSCs, bone marrow-derived mesenchymal stem cells; BMP-2, bone-morphogenetic protein-2; DMEM-HG, Dulbecco's modified Eagle's mediumhigh glucose; EM, expansion medium (DMEM-HG supplemented with 10% fetal bovine serum); ITS, insulin–transferrin–selenium; MSCs, mesenchymal stem cells; PCM, RCM supplemented with 50 ng/mL of PDGF; PDGF, platelet-derived growth factor; PEGDG, poly (ethylene glycol) diglycidyl ether; RCM, reference chondrogenic medium (serum-free DMEM-HG supplemented with 10 ng/mL of TGF-β1, 50 nM ascorbate, 100 nM dexamethasone, and 5 μg/mL of ITS).

cells (MSCs) due to their self-renewal capacity and chondrogenic potential (6–8). The bone marrow has been generally considered as the primary source of MSCs (9,10). Yet, even though the bone marrow-derived MSCs (BM-MSCs) exhibit better in vitro proliferation than autologous chondrocytes, the donor site damage with severe pain due to the highly invasive donating procedure of BM-MSCs still remains to be solved (10). Recently, adipose-derived MSCs (AD-MSCs) have attracted much interest as an alternative to BM-MSCs (11–13). AD-MSCs are isolated from the human adipose tissue and purified through several processes for selecting multi-potent MSCs-like cells. A simple liposuction procedure from subcutaneous adipose tissue can be used for obtaining the AD-MSCs, and its donor site damage and pain are almost negligible compared with the donating procedure of BM-MSCs. It has been reported that AD-MSCs are comparable to BM-MSCs with respect to the multi-lineage potential, growth kinetics, and cells senescence (14). However, under conventional culture conditions including the two-dimensional (2D) plate culture system and serum-supplemented

1389-1723/$ - see front matter © 2011, The Society for Biotechnology, Japan. All rights reserved. doi:10.1016/j.jbiosc.2011.06.018

VOL. 112, 2011

CHONDROGENESIS OF HUMAN AD-MSCs IN HA SCAFFOLD

medium, AD-MSCs tend to be committed into the adipogenic or osteogenic lineage rather than the chondrogenic lineage (3). Therefore, developing a suitable culture technique to direct ADMSCs into the chondrogenic lineage is a crucial prerequisite for the cartilage defect repair application of AD-MSCs. Fortunately, it has been well known that three-dimensional (3D) culture system and chondrogenic medium are required for chondrogenic culture of ADMSCs (2,3). High density cell cultures (i.e., micromass culture and pellet culture) are the standard 3D culture systems to allow cell–cell interactions similar to those observed in pre-cartilage condensation process during embryonic cartilage development (6,15). However, their small sizes (1–2 mm) and weak mechanical properties limit the clinical application of these systems for the repair of cartilage lesions (6). On the other hand, biomaterial scaffolds can provide a structural template for cartilage development, and also serve as an extracellular matrix (ECM) substratum to facilitate cell attachment, proliferation, differentiation, and integration to the adjacent cartilage (3,6,16,17). Thus, we developed a 3D porous scaffold using hyaluronic acid (HA), which was fabricated by freeze-drying the poly (ethylene glycol) diglycidyl ether (PEGDG)-crosslinked HA hydrogel (18). HA is a biocompatible and biodegradable natural polymer with a linear backbone of aggrecan which is the predominant proteoglycan in the cartilage. In clinical practice, intra-articular HA injection has been used to relieve arthritic pain (19). Our previous studies showed that the 3D culture in the HA scaffold was able to induce chondrogenic differentiation of rabbit articular chondrocytes (18). To date, it has been widely reported that growth factors play an important role in regulating the chondrogenesis of AD-MSCs (1–3). Thus, investigating the effects of reported growth factors on chondrogenesis of AD-MSCs cultured in the HA scaffold could provide a good basis for the optimization of chondrogenic culture conditions for AD-MSCs as well as the improved understanding of chondrogenesis of AD-MSCs. Herein, we report on how the porous 3D HA scaffold system has been applied for the proliferation and chondrogenic differentiation of AD-MSCs in comparison with the micromass culture. Additionally, the effects of growth factors, including the human bonemorphogenetic protein-2 (BMP-2) and human platelet-derived growth factor (PDGF), on the proliferation and chondrogenic differentiation were further investigated. MATERIALS AND METHODS Materials Hyaluronic acid (HA) was purchased from Shandong Freda Biochem Co., Ltd. (1040 kDa; Jinan, China). The cross-linker, PEGDG (CH2OCH-(CH2CH2O)n– CHOCH2; n = 200), was purchased from Polysciences (8886 Da; Warrington, PA, USA). Trypsin/EDTA, type I collagenase (250 U/mg), Alcian blue 8GX, dexamethasone, and ascorbate were purchased from Sigma-Aldrich (St. Louis, MO, USA). DMEM-HG was purchased from BioWhittaker (Wakersville, MD, USA). Recombinant human TGF-β1, BMP-2, and PDGF were purchased from Strathmann Biotec (Hamburg, Germany). All other chemicals were from standard laboratory suppliers and were of the highest purity available. Isolation and expansion of AD-MSCs Isolation and expansion of AD-MSCs were performed as previously described (20). Briefly, human subcutaneous adipose tissue samples were obtained from elective liposuction of 23 healthy females with informed consents as approved by the institutional review boards. The liposuction waste tissue was digested with 250 U/mL of type I collagenase for 90 min at 37°C, and centrifuged at 300 ×g for 10 min to obtain the stromal cell fraction. The cell suspension was layered onto histopaque-1077 (Sigma-Aldrich), and centrifuged at 840 ×g for 10 min. The supernatant was discarded, and the cell band buoyant over histopaque was collected. Retrieved cell fraction was cultured overnight at 37°C/5% CO2 in expansion medium (EM; DMEM-HG supplemented with 10% fetal bovine serum, 100 U/mL of penicillin and 100 mg/mL of streptomycin). The resulting cell population (AD-MSCs) was maintained over 3–5 days until 80–90% confluence, which were represented as passage 1. AD-MSCs were sub-cultured after 85% confluence, and used for experiment at passages 3–4. Culture medium was changed every 48 h. Characterization of AD-MSCs Flow cytometric characterization of AD-MSCs was performed as previously described (20). Briefly, AD-MSCs cultured in EM for 48 h were washed with PBS, and incubated with FITC-conjugated antibodies for human CD 34, 73, 90, and 105 for 30 min at room temperature. As a control, cells were stained with isotype control IgG. AD-MSCs were washed with PBS, fixed with 4% paraformal-

403

dehyde, and analyzed by FACScan flow cytometer (Beckton Dickson; San Jose, CA, USA) using CELLQuest Pro software. Preparation of porous HA scaffold The porous HA scaffold was prepared as reported in our previous study with slight modifications (18). Briefly, 1 g of HA was dissolved in 1 mL of 0.3 N-NaOH solution. After adding 2 mL of PEGDE, the mixture was homogenized using mechanical stirrer. The resulting gel-like mixture was injected into Teflon tube with 5 mm of inner diameter using 10-mL syringe. After 3-h incubation at 60°C, the Teflon tube containing HA hydrogel was cut into small pieces with a length of approximately 5 mm, transferred into double distilled water, and swelled for 24 h. During the swelling process, HA hydrogels were spontaneously pulled out from the Teflon tube. The swollen HA hydrogels were frozen in a deep freezer (− 80°C) for 24 h, and then freeze-dried under vacuum for 48 h. The resulting sponge-like HA matrix was used as the porous HA scaffold in this study. The HA scaffold was in the shape of small cylinders with a radius of approximately 3 mm and a height of approximately 5 mm. 3D chondrogenic culture of AD-MSCs The three chondrogenic medium (CM) used in this study were as follows: (i) reference chondrogenic medium (RCM; serumfree DMEM-HG supplemented with 10 ng/mL of TGF-β1, 50 nM ascorbate, 100 nM dexamethasone, and 5 μg/mL of ITS); (ii) BCM (RCM supplemented with 50 ng/mL of BMP-2); (iii) PCM (RCM supplemented with 50 ng/mL of PDGF). Culture media were changed every 48 h. For 3D culture, the micromass and HA scaffold culture were conducted. Micromass culture was performed as previously described (8). Briefly, cell suspension containing 3 × 105 AD-MSCs was transferred into a 15-mL conical tube, and centrifuged at 600 ×g for 5 min. The supernatant was discarded and culture media were added carefully so as not to re-suspend the cell pellet. Within 24-h incubation at 37°C in a humidified atmosphere of 5% CO2, the cell pellet coalesced and became spherical. Then, the spherical cell aggregate (micromass) was carefully transferred into 48-well plates, and 1 mL of culture media was added to each well. For HA scaffold culture, the HA scaffold was transferred into 48-well plates, and sterilized with ultraviolet light for 48 h. The sterilized HA scaffold was pre-wetted with culture media by 2-h incubation at 37°C in a humidified atmosphere of 5% CO2. After removing the culture media, 5 μL of cell suspension containing 3 × 105 AD-MSCs was seeded onto the HA scaffold. The AD-MSCs/scaffold construct was left undisturbed during 4-h incubation at 37°C in a humidified atmosphere of 5% CO2 to allow cell attachment to the scaffold, and then 1 mL of culture media was added to each well. Viability of AD-MSCs The viability of AD-MSCs cultured in the 3D culture system (micromass or HA scaffold with RCM) for 14 days was evaluated by MTT staining (18). After 14 days of 3D chondrogenic culture, the 3D AD-MSCs construct (micromass or HA-RCM) was transferred to new 48-well plates. Then, 900 μL of culture media and 100 μL of MTT solution were added to the construct. After 4-h incubation at 37°C in 5% CO2, the culture media and MTT solution were discarded. Then, the stained construct was washed twice with PBS and observed with the naked eye for micromass construct and under light microscopy (×100) for HA scaffold construct. Proliferation of AD-MSCs Proliferation of AD-MSCs in 3D chondrogenic culture systems (micromass-RCM, HA-RCM, HA-BCM, or HA-PCM) was evaluated by the quantification of genomic DNA. After 4, 7, 10, and 14 days of 3D chondrogenic culture, the genomic DNA was isolated from each 3D AD-MSCs construct. The isolation of genomic DNA was performed using DNeasy tissue kit (Qiagen; Chatsworth, CA, USA) according to the manufacturer's protocol. After 10-fold dilution of the isolated genomic DNA, the absorbance at 260 nm was measured by a microplate reader. Chondrogenic differentiation of AD-MSCs Chondrogenic differentiation of AD-MSCs in the 3D chondrogenic culture systems (micromass–RCM, HA–RCM, HA– BCM, and HA–PCM) was evaluated by sulfated glycosaminoglycans (s-GAG) content and marker gene expression. The s-GAG content was determined by the reported dimethylmethylene blue (DMMB) method (21). After 4, 7, 10, and 14 days of 3D chondrogenic culture, each 3D AD-MSCs construct was digested with papain for 48 h at 60°C in 20 mM sodium phosphate buffer (pH 6.8) containing 1 mM ethylenediaminetetraacetic acid (EDTA) and 2 mM dithiothreitol (DTT). Then, 2.5 mL of DMMB dye solution was added to 100 μL of digested sample, and the absorbance at 525 nm was measured by a microplate reader. Bovine chondroitin sulfate was used to prepare standard solution for calibration. The DMMB dye solution was prepared by dissolving 16 mg of DMMB in 1 L of distilled water containing 3.04 g of glycine, 2.37 g of NaCl and 95 mL of 0.1 M HCl. The mRNA expression of relevant marker genes was evaluated by reverse transcription-polymerase chain reaction (RT-PCR) analysis. After 4, 7, 10, and 14 days of 3D chondrogenic culture, the total RNA was isolated from each 3D AD-MSCs construct. The isolation of total RNA from AD-MSCs was performed using RNeasy plus Kit (Qiagen) according to the manufacturer's protocol. The reverse transcription (RT) and polymerase chain reaction (PCR) was performed using AccuPower® RT Premix and Takara® taq polymerase, respectively, according to the manufacturer's protocol. After gel electrophoresis, the intensities of the resulting bands were measured using image analysis software program (Image J). The specific primer pairs and PCR conditions of each gene are summarized in Table 1. The parallel amplification of cDNA for the housekeeping enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Statistical analysis A p-value less than 0.05 was considered to be statistically significant using a t-test between two means or a Duncan's multiple range test posteriori analysis of variance (ANOVA) among more than three means. Data were expressed as mean ± standard deviation.

404

YOON ET AL.

J. BIOSCI. BIOENG.,

TABLE 1. Sequences of primer pairs, annealing temperatures, sizes of PCR products, and cycle numbers used for PCR analysis. Gene

Primer sequences (5′→3′)

Type I collagen Sox9

GGTGGTTATGACTTTGGTTAC CAGGCGTGATGGCTTATTTGT GAACGCACATCAAGACGGAG TCTCGTTGATTTCGCTGCTC Aggrecan TGAGGAGGGCTGGAACAAGTACC GGAGGTGGTAATTGCAGGGAACA Type II TTCAGCTATGGAGATGACAATC collagen AGAGTCCTAGAGTGACTGAG Type X GCCCAAGAGGTGCCCCTGGAATAC collagen CCTGAGAAAGAGGAGTGGACATAC GAPDH TGGTATCGTGGAAGGACTCATGAC ATGCCAGTGAGCTTCCCGTTCAGC

Annealing Product Cycle temperature (°C) size (bp) number 62

702

30

60

631

38

62

350

38

55

472

38

65

703

38

62

190

30

RESULTS Characterization of AD-MSCs AD-MSCs were characterized with respect to the expression of surface antigens. As shown in Fig. 1, AD-MSCs expressed CD73 (ecto-5-nucleoditase), CD90 (Thy-1), and CD105 (endoglin), but exhibited negligible expression of CD34 (sialomucin/haematopoietic progenitors). Viability of AD-MSCs The viability of AD-MSCs cultured in the 3D culture system (micromass or HA scaffold with RCM) for 14 days was evaluated by MTT staining (Fig. 2). AD-MSCs are known to show a spindle-like fibroblastic morphology in 2D culture systems (culture dish or flask) (20,22). Stained AD-MSCs constructs were observed in both micromass and HA scaffold culture, indicating that the two culture systems provided an appropriate 3D culture condition for cell survival. One macroscopic aggregate (1–2 mm) was observed in micromass culture, whereas a number of microscopic aggregates (less than 100 μm) were dispersed in the HA scaffold.

Proliferation of AD-MSCs The proliferation of AD-MSCs in 3D chondrogenic culture systems was evaluated by genomic DNA content (Fig. 3). In the micromass–RCM culture system, DNA contents of the 14th day sample were significantly lower than those of the 4th day (p = 0.0220), while in the HA scaffold–RCM culture system, there was no significant change in DNA contents throughout the 14 day cultivation period (Fig. 3A). Consequently, on the 14th day, DNA contents in the HA scaffold–RCM culture system were significantly higher than those in the micromass–RCM culture system (p = 0.0204). However, throughout 14 days, there was no significant difference in DNA contents among the HA scaffold–RCM, BCM and PCM culture systems (Fig. 3B). Therefore, the proliferation of ADMSCs in the 3D chondrogenic culture systems was of the following order: the micromass–RCM b the HA scaffold–RCM (Fig. 3A); no significant difference among HA scaffold–RCM, BCM and PCM (Fig. 3B). Chondrogenic differentiation of AD-MSCs Chondrogenic differentiation of AD-MSCs in the 3D chondrogenic culture systems was evaluated by sulfated glycosaminoglycans (s-GAG) content and marker gene expression. The s-GAG, a main matrix element of the cartilage, has been considered as a marker for chondrogenic differentiation (3,9,18). The normalized s-GAG contents with respect to DNA contents (s-GAG/ DNA) of the HA scaffold–RCM culture system on the 10th and 14th days were significantly higher than those of the micromass–RCM culture system (p = 0.0410 and 0.0189, respectively; Fig. 4A). The s-GAG/DNA values of the HA scaffold–BCM culture system on the 10th and 14th days were significantly higher than those of the HA scaffold– RCM culture system (p = 0.0104 and 0.0285, respectively; Fig. 4B), while the s-GAG/DNA values of the HA scaffold–PCM culture system on the 14th day were significantly lower than those of the HA scaffold–RCM culture system (p = 0.0147; Fig. 4B). Therefore, results of the chondrogenic differentiation of AD-MSCs in the 3D chondrogenic culture systems were of the following order: the micromass–

FIG. 1. Flow cytometric histograms of human AD-MSCs. The black line represents the control, and the colored bold line represents the specific antibodies indicated.

VOL. 112, 2011

CHONDROGENESIS OF HUMAN AD-MSCs IN HA SCAFFOLD

405

FIG. 2. MTT staining of the 3D AD-MSCs constructs after 14 days of cultivation in the micromass–RCM and HA scaffold–RCM systems. Bars: 1 cm for micromass; 100 μm for HA scaffold.

RCM b the HA scaffold–RCM (Fig. 4A); the HA scaffold–PCM b the HA scaffold-RCM b the HA scaffold–BCM (Fig. 4B). The mRNA expression level of various marker genes relevant to the differentiation of AD-MSCs was evaluated by RT-PCR analysis (Figs. 5 and 6). Type I collagen is the primary collagen in the skin, bone, and

A6

adipose tissue, but not cartilage. In all four kinds of culture systems, the band densities of type I collagen decreased constantly over the culture period, suggesting the differentiation of AD-MSCs into the lineage other than fibrogenic, osteogenic, or adipogenic lineage. Also, with respect to the mRNA expression level (band density) of type I collagen, the micromass–RCM and the HA scaffold–PCM culture systems were higher than the HA scaffold–RCM culture system, while

Micromass-RCM HA scaffold-RCM

5

Micromass-RCM HA scaffold-RCM

*

*

4

* 3

#

s-GAG / DNA

DNA content (µg/scaffold)

A4

3 2 1

2

1

0 4

7

10

14

0

Cultivation time (day)

4

7

10

14

Cultivation time (day)

B

B6

5

5

4

4

HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

* *

s-GAG / DNA

DNA content (µg/scaffold)

6

HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

3 2 1

*

3

* 2 1

0

0 4

7

10

14

Cultivation time (day) FIG. 3. DNA contents of the 3D AD-MSCs constructs after 4, 7, 10, and 14 days of cultivation (A) in the micromass–RCM and HA scaffold–RCM system, and (B) in the HA scaffold–RCM, BCM and PCM system (n = 3). *, significantly different from the other group(s); #, significantly different from the corresponding ‘4 days’ group (p b 0.05).

4

7

10

14

Cultivation time (day) FIG. 4. Normalized s-GAG contents with respect to DNA contents of the 3D AD-MSCs constructs after 4, 7, 10, and 14 days of cultivation (A) in the micromass–RCM and HA scaffold–RCM system, and (B) in the HA scaffold–RCM, BCM and PCM system (n = 3). *, significantly different from the other group(s) (p b 0.05).

406

YOON ET AL.

J. BIOSCI. BIOENG.,

FIG. 5. RT-PCR analysis of the 3D AD-MSCs constructs after 4, 7, 10, and 14 days of cultivation in the micromass–RCM, HA scaffold–RCM, HA scaffold–BCM, and HA scaffold–PCM system. Lane 1, ladder marker; lane 2, the 4th day; lane 3, the 7th day; lane 4, the 10th day; lane 5, the 14th day.

the HA scaffold–BCM culture system was lower than the HA scaffold– RCM culture system. These results suggest that the non-chondrogenic lineage commitment of AD-MSCs is of the following order: the HA scaffold–BCM b the HA scaffold–RCM b the micromass–RCM and HA scaffold–PCM. In the cartilage, chondrocytes and proteoglycan are entrapped in collagen fibrillar network. Type II collagen and aggrecan are the predominant collagen fiber and proteoglycan, respectively, of the cartilage. Thus, the mRNA expression levels of type II collagen and aggrecan has been generally considered as the primary marker for chondrogenic differentiation (12,13). Sox9 protein is the transcription factor of type II collagen gene, and functions as an important transcriptional regulator of early chondrogenic differentiation (23– 25). Thus, the mRNA expression level of sox9 can also be a marker for chondrogenic differentiation. With respect to the mRNA expression level (band density) of sox9, aggrecan, and type II collagen, the HA scaffold–RCM culture system was higher than the micromass–RCM culture system, and the HA scaffold–BCM culture system was higher than the HA scaffold–RCM culture system, while the HA scaffold–PCM culture system was lower than the HA scaffold–RCM culture system. Overall, the results of the chondrogenic differentiation of AD-MSCs in the 3D chondrogenic culture systems were of the following order, which was consistent with results of the s-GAG contents: the micromass–RCM b the HA scaffold–RCM; the HA scaffold–PCM b the HA scaffold–RCM b the HA scaffold–BCM. In endochondral ossification, mature chondrocytes differentiate into hypertrophic chondrocytes followed by cartilage extracellular matrix (ECM) calcification, apoptosis, vascular invasion, and final replacement of cartilage with bone (26,27). Type X collagen is known to be a marker for hypertrophic chondrocytes (28,29). The increase in the mRNA expression level of type X collagen is observed uniquely in the differentiation of mature chondrocytes into hypertrophic chondrocytes. The mRNA expression level of type X collagen of the HA scaffold–BCM culture system was higher than the other culture systems and gradually increased with cultivation time, indicating that the addition of BMP-2 to the HA scaffold–RCM culture system induced the differentiation of AD-MSCs to hypertrophic chondrocytes. DISCUSSION AD-MSCs refer to multi-potent MSCs-like cells which reside probably in the stromal region of the adipose tissue (9). The criteria for the identification of multi-potent MSCs include positive expressions of CD73, 90, and 105, and negative expressions of CD34 (10,21,30,31). The flow cytometric histograms presented in Fig. 1 suggest that the predominant populations of AD-MSCs used in this study are multi-potent MSCs-like cells.

The proliferation of AD-MSCs in the HA scaffold culture is significantly higher than that in the micromass culture (Fig. 3A). In the HA scaffold culture, AD-MSCs exist in the form of small dispersed aggregates (Fig. 2). Decrease in the size of cell aggregation can increase the surface area of cells and facilitate the exchanges of substances between cells and medium. Moreover, porous structure of scaffold is generally considered a preferable culture milieu for the proliferation of cells (18,32). Thus, the enhanced proliferation of ADMSCs by the HA scaffold culture may be probably due to the decrease in the size of cell aggregation and/or porous structure of the HA scaffold. Our previous study reported that the MTT optical density values of rabbit chondrocytes were increased by approximately 2-fold during 14-day cultivation in the HA scaffold with DMEM/F12 containing 10% of FCS (18). In the present study, however, the DNA contents of AD-MSCs were not significantly changed during the same period cultivation in the HA scaffold–RCM system (Fig. 3B). The discrepancy between the two studies may probably be due to the differences in the cell type and/or media composition, which needs further systematic investigation. The chondrogenic differentiation of AD-MSCs in the HA scaffold culture was significantly higher than that in the micromass culture (Figs. 4A, 5, and 6). It has been reported that HA enhances cell–cell contact by modulating the pericellular matrix in the cell condensation process, which is the initial stage of chondrogenesis (33). Moreover, interactions between HA and various cell-surface receptors including CD44 are known to play an important role in maintaining differentiated characteristics of chondrocytes (33,34). Thus, the culture of AD-MSCs in HA scaffold seems to be better for both proliferation and chondrogenic differentiation compared to the micromass culture system. Additionally, the changes in the proliferation and chondrogenic differentiation of AD-MSCs by the addition of BMP-2 or PDGF were evaluated. When 50 ng/mL of BMP-2 was added to the HA scaffold–RCM system, AD-MSCs showed no significant change in the proliferation (Fig. 3B), but significant increase in the chondrogenic differentiation (Figs. 4B, 5, and 6). Also, the differentiation of AD-MSCs into hypertrophic chondrocytes was observed (Figs. 5 and 6; the elevation in the mRNA expression level of type X collagen). These results are consistent with the previous study which reported the inducing effects of BMP-2 on the chondrogenic differentiation of AD-MSCs cultured in alginate bead (30). In endochondral ossification, hypertrophic chondrocytes are known to be a kind of transitional phase from cartilage to bone, which is usually considered undesirable for cartilage tissue engineering (16). However, despite the up-regulated mRNA expression of type X collagen in the presence of BMP-2, the mRNA expression of type I collagen, a marker for the bone, was constantly declining without any significant change in proliferation (Figs. 3B, 5, 6A, and 6E). These results suggest that further commitments beyond hypertrophic

VOL. 112, 2011

CHONDROGENESIS OF HUMAN AD-MSCs IN HA SCAFFOLD

A 1.0

B

Micromass-RCM HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

3.5

Micromass-RCM HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

407

*

*

0.8

Relative band intensity

Relative band intensity

3.0

* 0.6

*

0.4

*

*

0.2

*

*

2.5

* 2.0

* 1.5

0.0 4

7

10

14

4

Cultivation time (day)

D 1.6 1.4

* *

1.0

*

*

0.8 0.6

*

0.4

14

Micromass-RCM HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

*

1.2

*

1.0

*

0.8

*

*

0.6 0.4

* *

0.0

0.0 4

7

10

14

Cultivation time (day)

Relative band intensity

10

0.2

0.2

E 0.5

Relative band intensity

Relative band intensity

Micromass-RCM HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

7

Cultivation time (day)

C 1.2

*

*

1.0 0.5

*

0.0

1.4

*

4

7

10

14

Cultivation time (day)

Micromass-RCM HA scaffold-RCM HA scaffold-BCM HA scaffold-PCM

*

0.4

* 0.3

* 0.2

*

0.1 0.0 4

7

10

14

Cultivation time (day) FIG. 6. Relative band intensity (normalized band intensity with respect to GAPDH band intensity) of (A) type I collagen, (B) sox9, (C) aggrecan, (D) type II collagen, and (E) type X collagen in RT-PCR analysis (n = 3). Asterisk: significantly different from the other groups (p b 0.05).

chondrocytes into osteogenic lineage did not occur, which could be considered as a positive aspect of BMP-2. Moreover, several previous studies imply that the expression of type X collagen does not necessarily indicate a serious deficiency in the tissue-engineered cartilage if its expression level is relatively low compared to chondrogenesis markers such as type II collagen, aggrecan, and sox9 (12,13,30,35). Thus, taking into account that BMP-2 has the merit of further being able to enhance the chondrogenesis of AD-MSCs cultured with a basic chondrogenic medium containing TGF-β1 (RCM), it is still debatable whether the merit and even the feasibility of BMP-2 as a chondrogenic supplement

can be completely excluded. Therefore, based on the current results, it is deemed necessary to further investigate the possible utility of BMP-2. PDGF, the cytokine secreted from the platelet, is known to induce proliferation of several mesenchymal cells (36). However, little information is available regarding the effect of PDGF on the proliferation and differentiation of AD-MSCs. When 50 ng/mL of PDGF was added to the HA scaffold–RCM system, AD-MSCs showed no significant change in the proliferation (Fig. 3B), but significant decrease in the chondrogenic differentiation (Figs. 4B, 5, and 6). It has been reported that 37.5 and 150 ng/mL of PDGF stimulate the

408

YOON ET AL.

J. BIOSCI. BIOENG.,

proliferation and prevents the endochondral maturation of rat chondrocytes (37), which are consistent with those on AD-MSCs in this study. Based on these results, PDGF seems to be inappropriate for in vitro chondrogenic culture of AD-MSCs. However, it should be noted that concentrations of growth factors used in this study were assigned based on similar studies that have been previously reported (6,12,13,30,36). Since the actions of growth factors may depend on their concentrations, the current results could be changed at different concentrations of growth factors. In summary, the chondrogenic differentiation of AD-MSCs was induced successfully in the porous 3D HA scaffold. When cultured with RCM, better proliferation and chondrogenic differentiation of AD-MSCs were obtained in the 3D HA scaffold culture as compared to the micromass culture, a standard 3D culture system. This suggests that the HA scaffold with RCM is a promising chondrogenic culture system of AD-MSCs. In the HA scaffold–RCM culture system, the level of chondrogenic differentiation of AD-MSCs was markedly increased by BMP-2, which shows the feasibility of BMP-2 as a chondrogenic supplement for AD-MSCs. However, PDGF was determined to be an inappropriate supplement based on its inhibition of the chondrogenic differentiation of AD-MSCs. ACKNOWLEDGMENTS This research was supported by the Converging Research Center Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (20090081879).

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

References 25. 1. Erickson, G. R., Gimble, J. M., Franklin, D. M., Rice, H. E., Awad, H., and Guilak, F.: Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo, Biochem. Biophys. Res. Commun., 290, 763–769 (2002). 2. Guilak, F., Awad, H. A., Fermor, B., Leddy, H. A., and Gimble, J. M.: Adiposederived adult stem cells for cartilage tissue engineering, Biorheology, 41, 389–399 (2004). 3. Heng, B. C., Cao, T., and Lee, E. H.: Directing stem cell differentiation into the chondrogenic lineage in vitro, Stem Cells, 22, 1152–1167 (2004). 4. De Bie, C.: Genzyme: 15 years of cell and gene therapy research, Regen. Med., 2, 95–97 (2007). 5. Ochi, M., Uchio, Y., Tobita, M., and Kuriwaka, M.: Current concepts in tissue engineering technique for repair of cartilage defect, Artif. Organs, 25, 172–179 (2001). 6. Li, W. J., Tuli, R., Okafor, C., Derfoul, A., Danielson, K. G., Hall, D. J., and Tuan, R. S.: A three-dimensional nanofibrous scaffold for cartilage tissue engineering using human mesenchymal stem cells, Biomaterials, 26, 599–609 (2005). 7. Bai, X., Xiao, Z., Pan, Y., Hu, J., Pohl, J., Wen, J., and Li, L.: Cartilage-derived morphogenetic protein-1 promotes the differentiation of mesenchymal stem cells into chondrocytes, Biochem. Biophys. Res. Commun., 325, 453–460 (2004). 8. Johnstone, B., Hering, T. M., Caplan, A. I., Goldberg, V. M., and Yoo, J. U.: In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells, Exp. Cell Res., 238, 265–272 (1998). 9. Tuan, R. S., Boland, G., and Tuli, R.: Adult mesenchymal stem cells and cell-based tissue engineering, Arthritis Res. Ther., 5, 32–45 (2003). 10. Kern, S., Eichler, H., Stoeve, J., Klüter, H., and Bieback, K.: Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue, Stem Cells, 24, 1294–1301 (2006). 11. Zuk, P. A., Zhu, M., Mizuno, H., Huang, J. W., Futrell, J., Katz, A. J., Benhaim, P., Lorenz, H. P., and Hedrick, M. H.: Multilineage cells from human adipose tissue: implications for cell-based therapies, Tissue Eng., 7, 211–228 (2001). 12. Zuk, P. A., Zhu, M., Ashjian, P., de Ugarte, D. A., Huang, J. I., Mizuno, H., Alfonso, Z. C., Fraser, J. K., Benhaim, P., and Hedrick, M. H.: Human adipose tissue is a source of multipotent stem cells, Mol. Biol. Cell, 13, 4279–4295 (2002). 13. Lin, Y., Luo, E., Chen, X., Liu, L., Qiao, J., Yan, Z., Li, Z., Tang, W., Zheng, X., and Tian, W.: Molecular and cellular characterization during chondrogenic differen-

26. 27.

28. 29. 30.

31.

32. 33.

34. 35.

36. 37.

tiation of adipose tissue-derived stromal cells in vitro and cartilage formation in vivo, J. Cell. Mol. Med., 9, 929–939 (2005). de Ugarte, D. A., Morizono, K., Elbarbary, A., Alfonso, Z. C., Zuk, P. A., Zhu, M., Dragoo, J. L., Ashjian, P., Thomas, B., Benhaim, P., Chen, I., Fraser, J., and Hedrick, M. H.: Comparison of multi-lineage cells from human adipose tissue and bone marrow, Cells Tissues Organs, 174, 101–109 (2003). Zhang, L., Su, P., Xu, C., Yang, J., Yu, W., and Huang, D.: Chondrogenic differentiation of human mesenchymal stem cells: a comparison between micromass and pellet culture systems, Biotechnol. Lett., 32, 1339–1346 (2010). Vunjak-Novakovic, G.: The fundamentals of tissue engineering: scaffolds and bioreactors, p. 34–46, in: Bock, G. and Goode, J. (Eds.), Tissue engineering of cartilage and bone. John Wiley & Sons, Chichester (2003). Freed, L. E., Hollander, A. P., Martin, I., Barry, J. R., Langer, R., and VunjakNovakovic, G.: Chondrogenesis in a cell-polymer-bioreactor system, Exp. Cell Res., 240, 58–65 (1998). Kang, J. Y., Chung, C. W., Sung, J. H., Park, B. S., Choi, J. Y., Lee, S. J., Choi, B. C., Shim, C. K., Chung, S. J., and Kim, D. D.: Novel porous matrix of hyaluronic acid for the three-dimensional culture of chondrocytes, Int. J. Pharm., 369, 114–120 (2009). Chou, C. L., Li, H. W., Lee, S. H., Tsai, K. L., and Ling, H. Y.: Effect of intra-articular injection of hyaluronic acid in rheumatoid arthritis patients with knee osteoarthritis, J. Chin. Med. Assoc., 71, 411–415 (2008). Kim, W. S., Park, B. S., Sung, J. H., Yang, J. M., Park, S. B., Kwak, S. J., and Park, J. S.: Wound healing effect of adipose-derived stem cells: a critical role of secretory factors on human dermal fibroblasts, J. Dermatol. Sci., 48, 15–24 (2007). Farndale, R. W., Buttle, D. J., and Barrett, A. J.: Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue, Biochim. Biophys. Acta, 883, 173–177 (1986). Ko, K. S., Lee, I. W., Joo, W. I., Lee, K. J., Park, H. K., and Rha, H. K.: Differentiation of human adult adipose derived stem cell in vitro and immunohistochemical study of adipose derived stem cell after intracerebral transplantation in rats, J. Korean Neurosurg. Soc., 42, 118–124 (2007). Lefebvre, V., Li, P., and de Crombrugghe, B.: A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene, EMBO J., 17, 5718–5733 (1998). Ikeda, T., Kamekura, S., Mabuchi, A., Kou, I., Seki, S., Takato, T., Nakamura, K., Kawaguchi, H., Ikegawa, S., and Chung, U. I.: The combination of SOX5, SOX6, and SOX9 (the SOX trio) provides signals sufficient for induction of permanent cartilage, Arthritis Rheum., 50, 3561–3573 (2004). Akiyama, H., Chaboissier, M. C., Martin, J. F., Schedl, A., and de Crombrugghe, B.: The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6, Genes Dev., 16, 2813–2828 (2002). Goldring, M. B., Tsuchimochi, K., and Ijiri, K.: The control of chondrogenesis, J. Cell. Biochem., 97, 33–44 (2006). Ferguson, C. M., Miclau, T., Hu, D., Alpern, E., and Helms, J. A.: Common molecular pathways in skeletal morphogenesis and repair, Ann. NY Acad. Sci., 857, 33–42 (1998). Ballock, R. T. and O'Keefe, R. J.: The biology of the growth plate, J. Bone Joint Surg. Am., 85-A, 715–726 (2003). Provot, S. and Schipani, E.: Molecular mechanisms of endochondral bone development, Biochem. Biophys. Res. Commun., 328, 658–665 (2005). Mehlhorn, A. T., Niemeyer, P., Kaschte, K., Muller, L., Finkenzeller, G., Hartl, D., Sudkamp, N. P., and Schmal, H.: Differential effects of BMP-2 and TGF-beta1 on chondrogenic differentiation of adipose derived stem cells, Cell Prolif., 40, 809–823 (2007). Dominici, M., le Blanc, K., Mueller, I., Slaper-Cortenbach, I., Marini, F., Krause, D., Deans, R., Keating, A., Prockop, D. J., and Horwitz, E.: Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement, Cytotherapy, 8, 315–317 (2006). Khang, G., Kim, M. S., and Lee, H. B. (Eds.): A manual for biomaterials scaffold fabrication technology. World Scientific Publishing, Hachensack, NJ (2007). Knudson, C. B.: Hyaluronan and CD44: strategic players for cell–matrix interactions during chondrogenesis and matrix assembly, Birth Defects Res. C Embryo Today, 69, 174–196 (2003). Ponta, H., Sherman, L., and Herrlich, P. A.: CD44: from adhesion molecules to signalling regulators, Nat. Rev. Mol. Cell Biol., 4, 33–45 (2003). Toh, W. S., Yang, Z., Liu, H., Heng, B. C., Lee, E. H., and Cao, T.: Effects of culture conditions and bone morphogenetic protein 2 on extent of chondrogenesis from human embryonic stem cells, Stem Cells, 25, 950–960 (2007). Antoniades, H. N. and Owen, A. J.: Growth factors and regulation of cell growth, Annu. Rev. Med., 33, 445–463 (1982). Kieswetter, K., Schwartz, Z., Alderete, M., Dean, D. D., and Boyan, B. D.: Platelet derived growth factor stimulates chondrocyte proliferation but prevents endochondral maturation, Endocrine, 6, 257–264 (1997).