Prolonged activation of NF-κB by human cytomegalovirus promotes efficient viral replication and late gene expression

Virology 346 (2006) 15 – 31 www.elsevier.com/locate/yviro

Prolonged activation of NF-nB by human cytomegalovirus promotes efficient viral replication and late gene expression Ian B. DeMeritt a, Jagat P. Podduturi a, A. Michael Tilley a, Maciej T. Nogalski a, Andrew D. Yurochko a,b,* a

b

Department of Microbiology and Immunology and Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, Louisiana 71130-3932, USA The Feist-Weiller Cancer Center, Louisiana State University Health Sciences Center, Shreveport, Louisiana 71130-3932, USA Received 18 March 2005; returned to author for revision 12 August 2005; accepted 23 September 2005 Available online 21 November 2005

Abstract Infection of fibroblasts by human cytomegalovirus (HCMV) rapidly activates the NF-nB signaling pathway, which we documented promotes efficient transactivation of the major immediate-early promoter (DeMeritt, I.B., Milford, L.E., Yurochko, A.D. (2004). Activation of the NF-nB pathway in human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediate-early promoter. J. Virol. 78, 4498 – 4507). Because a second, sustained increase in NF-nB activity following the initial phase of NF-nB activation was also observed, we investigated the role that this prolonged NF-nB activation played in viral replication and late gene expression. We first investigated HCMV replication in cells in which NF-nB activation was blocked by pretreatment with NF-nB inhibitors: HCMV replication was significantly decreased in these cultures. A decrease in replication was also observed when NF-nB was inhibited up to 48 h post-infection, suggesting a previously unidentified role for NF-nB in the regulation of the later class of viral genes. D 2005 Elsevier Inc. All rights reserved. Keywords: HCMV; NF-nB; MIEP; Replication; Late gene expression; Aspirin; MG-132; BAY11

Introduction Infection of immunocompromised individuals with human cytomegalovirus (HCMV) often leads to severe and/or fatal disease (Crumpacker, 2000). AIDS patients, transplant recipients, and congenitally infected neonates represent the primary groups at risk for developing severe complications related to HCMV infection (Pass, 2001). On the other hand, HCMV infection of immunocompetent individuals is generally asymptomatic, although it can cause infectious mononucleosis (Klemola and Kaariainen, 1965), and evidence now suggests that HCMV infection is associated with the development of cardiovascular disease including atherosclerosis and restenosis (Bruggeman, 1999; Degre, 2002; Epstein et al., 1999b; Streblow et al., 2001). Because HCMV pathogenesis is usually * Corresponding author. Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130-3932, USA. Fax: +1 318 675 5764. E-mail address: [email protected] (A.D. Yurochko). 0042-6822/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2005.09.065

accompanied by productive viremia (Britt and Alford, 1996), understanding the factors involved in viral replication and gene expression is critical for combating HCMV-related disease. A temporal cascade of viral gene expression occurs following infection in which immediate-early (IE), early, and late genes are transcribed in order (Mocarski and Courcelle, 2001). IE gene transcription is controlled by the major immediate-early promoter (MIEP) (Boshart et al., 1985; Stenberg et al., 1984, 1985; Stinski et al., 1983; Thomsen et al., 1984). Transactivation of the HCMV MIEP is essential for viral gene expression and replication (Bresnahan and Shenk, 2000; Isomura and Stinski, 2003; Isomura et al., 2004; Meier and Pruessner, 2000). Because numerous cellular transcription factor binding sites were found in the enhancer region of the MIEP, it was hypothesized that induced cellular factors played a predominant role in the transactivation of this promoter. Early work using deletion mutants of the MIEP supported this hypothesis (Cherrington and Mocarski, 1989; Sambucetti et al., 1989). In addition, because the region of the promoter containing four NF-nB binding sites was needed for maximal

16

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

reporter gene expression, the work suggested that the cellular transcription factor NF-nB could be an important regulatory factor driving viral gene expression. Classical NF-nB is a heterodimeric complex consisting of two subunits, p50 and p65, that is normally sequestered by its inhibitors, the InBs, in the cytosol (Karin and Ben-Neriah, 2000). Following activation of cellular signaling cascades, the InB kinase (IKK) complex is activated, resulting in the phosphorylation of the InB proteins which, in turn, leads to the ubiquitination and subsequent degradation of the InB proteins by the 26S proteosome complex (Chen et al., 1995; DiDonato et al., 1996). Once freed from its inhibitor, NF-nB translocates to the nucleus and transactivates NF-nB responsive genes (Chen and Greene, 2004). NF-nB activation takes place during two distinct phases following HCMV infection of fibroblasts (Johnson et al., 2001; Kowalik et al., 1993; Yurochko et al., 1995). The first phase of NF-nB activation occurs immediately following infection (as early as 5 min after viral binding) and was demonstrated to be the result of the release of preformed stores of NF-nB mediated by the binding of HCMV glycoproteins to their cellular receptors (Yurochko et al., 1995, 1997a). The second increase in NF-nB activation was observed 8 to 12 h post-infection (hpi) and was demonstrated to be the result of de novo synthesis of NF-nB proteins (Yurochko et al., 1995). We previously presented evidence that suggested that the initial phase of NF-nB activation promoted the efficient transactivation of the MIEP and the production of IE genes (DeMeritt et al., 2004). This study showed that transactivation of the HCMV MIEP was significantly reduced in fibroblasts in which NF-nB activation was inhibited. In addition, it was demonstrated that the IKK complex was activated in response to HCMV infection, providing a mechanism for the rapid dysregulation of NF-nB activity reported by us (Yurochko and Huang, 1999; Yurochko et al., 1995, 1997a, 1997b) and others (Johnson et al., 2001; Kowalik et al., 1993; Sambucetti et al., 1989). This work is supported by a recent report by Caposio et al. (2004) who observed that IKKh was required for HCMV-mediated NF-nB activation and for initiation of the viral life cycle. In contrast to the reports discussed above, other studies suggested that NF-nB activation was not required for the transactivation of the MIEP and HCMV replication (Benedict et al., 2004; Eickhoff and Cotten, 2005; Isomura et al., 2004). The reason for these differences is unknown but may represent

differences in the cell lines or in the systems used. Because a complete appreciation of the regulation of viral gene expression and replication is important for our understanding of HCMV pathogenesis, these discrepancies warrant further investigation into the role that NF-nB plays in the HCMV life cycle. During the second phase of NF-nB activation, nuclear NFnB levels remain elevated throughout the course of the infection (Yurochko et al., 1995). We propose that this prolonged activation of NF-nB is involved in viral pathogenesis through the efficient activation of required viral events following IE gene expression. A direct role for long-term activation of NF-nB in the viral life cycle has not been identified. Studies presented here support our previous findings regarding the role NF-nB plays at IE times of HCMV infection and now suggest a role for the late phase of NF-nB activation in viral replication and the production of late HCMV proteins. We demonstrated that inhibition of NF-nB (1) prevented efficient HCMV genomic replication, (2) blocked production of late proteins, and (3) significantly impaired progeny virus release from infected fibroblasts. We also documented that delayed inhibition of NF-nB, even as late as 48 hpi, still inhibited viral replication. Thus, we propose a direct role for NF-nB at late times of HCMV replication independent of MIEP transactivation. This study, coupled with our previously published report (DeMeritt et al., 2004), identifies the NF-nB pathway as an important factor in mediating multiple steps in the HCMV life cycle in fibroblasts and suggests that targeting the NF-nB pathway may provide an effective means to ameliorate HCMV-mediated disease. Results Inhibition of NF-jB activity blocked HCMV replication We reported that IE1-72 and IE2-86 gene and protein expression were significantly decreased and delayed in cells in which NF-nB activation was inhibited with aspirin and MG132 (DeMeritt et al., 2004). Because the IE proteins act as transcriptional transactivators and control the expression of early genes required for viral DNA synthesis, we hypothesized that HCMV replication would be impaired when NF-nB activation was blocked. To investigate the effects of NF-nB inhibition on HCMV replication, a Toledo strain of HCMV

Fig. 1. Inhibition of NF-nB activity blocked HCMV replication. (A) HEL fibroblasts were grown to confluency and pretreated with aspirin (3 mM), MG-132 (2.5 AM), or DMSO (drug solvent) for 1 h prior to infection with GFP-HCMV (MOI 3 – 5). GFP expression was monitored at 48, 72, and 96 hpi by fluorescence microscopy. Higher levels of GFP-expressing cells were present in fibroblast cultures treated with drug solvent alone compared to cultures pretreated with NF-nB inhibitory compounds. Mock-infected cells showed no GFP expression (data not shown). A representative experiment from multiple repeats is shown. (B) Quantification of the fluorescence intensity of confluent fibroblast cultures pretreated with aspirin (3 mM), MG-132 (2.5 AM), DMSO, or left untreated (no drug) for 1 h prior to infection with GFP-HCMV (MOI 3 – 5). Replicate cultures were mock infected for use as a negative control (Mock). Fluorescence intensity was measured using a FLUOstar OPTIMA fluorescence plate reader and was measured every 24 h after infection. Data are displayed as the fold-increase (Tstandard deviation) in fluorescence intensity relative to mock-infected cells. The data are the means of three independent experiments. P values were calculated using Student’s t test and demonstrate a significant increase ( P < 0.005) in DMSO-treated and untreated (no drug) cultures when compared to cultures treated with the NFnB inhibitory drugs. The aspirin solvent (1 M Tris) had no effect on GFP expression and is not shown in the figure. (C) Treatment of fibroblasts with aspirin and MG-132 prior to infection inhibits HCMV genomic replication. HEL fibroblasts were pretreated with aspirin (3 mM), MG-132 (2.5 AM), or DMSO for 1 h. Fibroblasts pretreated with the drugs, and untreated fibroblasts were infected with HCMV (MOI 3 – 5). Total cellular DNA was harvested at 72 hpi and dot blots performed using an HCMV-specific 32P-labeled DNA probe. Mock represents uninfected fibroblasts. The experiment was repeated with similar results; a representative experiment is shown.

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

expressing green fluorescent protein was used (Iwata et al., 1999). HEL fibroblasts were pretreated with aspirin or MG-132 for 1 h prior to infection with GFP-HCMV. Aspirin is a general inhibitor of NF-nB that targets the IKKh protein (Kopp and Ghosh, 1994; Pierce et al., 1996; Yin et al., 1998), while MG132 specifically inhibits the 26S proteosome complex thereby

17

preventing the degradation of the InB proteins (Palombella et al., 1994); both compounds prevent translocation of active NFnB to the nucleus. Fibroblasts expressing GFP were visualized by fluorescence microscopy at 48, 72, and 96 hpi to determine the level of replicating virus in infected fibroblasts (Fig. 1A). Cultures pretreated with either aspirin or MG-132 showed

18

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

decreased levels of GFP at all the time points examined when compared to cells pretreated with the drug solvents alone. Only the DMSO control is shown in Fig. 1A, however, no differences were observed by microscopy between the DMSO-treated infected cells and the untreated infected cells. The decrease in GFP expression from drug-treated cells was not due to toxic effects of the drugs, as greater than 95% of cells were viable at the latest time point tested, as determined by trypan blue exclusion dye staining (data not shown) and TUNEL staining (Supplemental Fig. 1). To quantify the difference in viral replication among the experimental groups, total fluorescent intensity of tissue culture plates containing GFP-HCMV-infected fibroblasts was determined using a fluorescence plate reader (Fig. 1B). Confluent HEL fibroblasts were pretreated with aspirin, MG-132, or drug solvent alone, and infected with GFP-HCMV or mock infected. Total fluorescence intensity of each sample was measured every 24 h. By 120 hpi, infected fibroblast cultures treated with DMSO alone exhibited an average 75-fold increase in fluorescence intensity over mock-infected cells. In comparison, infected cultures pretreated with aspirin or MG-132 showed significantly decreased levels of fluorescence intensity: only 2and 5-fold increases over mock-infected cells were observed, respectively. Samples treated with DMSO alone exhibited a slight but reproducible increase in fluorescence intensity over untreated cultures. It was previously demonstrated that GFP expression directly correlated with viral replication (Iwata et al., 1999). However, because GFP expression was under the control of the cellular elongation factor 1a promoter in the recombinant Toledo strain used (Iwata et al., 1999), we wanted to rule out the possibility that the NF-nB inhibitory compounds blocked transcription from this promoter instead of inhibiting viral replication. To confirm that fluorescence intensity was an accurate measurement of HCMV replication in our system, dot blot analyses were performed on untreated cells, or cells pretreated with aspirin, MG-132, or the drug solvent DMSO for 1 h prior to infection with GFP-HCMV. Total cellular DNA was harvested at 72 hpi, and dot blot analysis was performed using an HCMV-specific 32P-labeled probe (Fig. 1C). Compared to untreated cells or cells treated with DMSO alone, viral replication was inhibited in cells treated with aspirin or MG132 prior to infection, suggesting that HCMV genomic replication is regulated in a positive manner by NF-nB. Inhibition of NF-jB activity blocked the production of progeny virus We next investigated whether the inhibition of NF-nB activity blocked progeny virus production. Fibroblast cultures were grown to confluency in 6-well tissue culture dishes and pretreated with aspirin, MG-132, or drug solvents for 1 h prior to infection with GFP-HCMV. Media were changed every 24 h, and fresh drugs were added at these times. Supernatant was collected from infected cells at 96 hpi, and infectious unit assays were performed (Figs. 2A and B). Production of progeny virus was dramatically inhibited when cells were

pretreated with the NF-nB inhibitory drugs, as demonstrated by the increased number of GFP-positive cells observed in wells infected with supernatant from cells treated with DMSO alone compared to cells treated with aspirin or MG-132 (Fig. 2A). Fig. 2A represents an experiment where the supernatant from aspirin or MG-132 treated cells was diluted 1:10 (the lowest dilution performed). As seen in the figure, no GFP-positive cells were observed in wells treated with aspirin or MG-132, suggesting that these compounds completely inhibited viral replication for up to 8 days post-infection (the last time point tested). In contrast, cultures treated with drug solvent alone reached maximal titers of 4.0  105 infectious units per milliliter by seven days post-infection (Fig. 2B). No significant differences were seen in the production of progeny virus between DMSO-treated infected cells and untreated infected cells (data not shown). These results support the observation that NF-nB activity is needed for efficient viral DNA replication and progeny virus production. The residual levels of NF-nB-inhibitory drugs remaining in the experimental samples following serial dilution could have an effect on virus replication in our infectious unit assays. To control for this possibility, equal levels of NF-nB inhibitory compounds were added to the supernatants collected from the untreated, infected cultures prior to dilution. The addition of NF-nB inhibitory compounds to these samples had no effect on the number of GFP-expressing cells observed in our assays (data not shown). Inhibition of NF-jB activity at later times of infection blocked viral replication NF-nB activation is strongly induced in two phases following HCMV infection (Yurochko et al., 1995). We previously demonstrated that the rapid initial phase of NF-nB activation efficiently transactivated the MIEP and drove the production of the IE proteins (DeMeritt et al., 2004). The function of the second (later) phase of NF-nB activation in the HCMV life cycle remains unknown. Transcription from the MIEP can be inhibited by viral proteins early after infection (Cherrington et al., 1991; Hermiston et al., 1990; Liu et al., 1991; Pizzorno and Hayward, 1990; Pizzorno et al., 1988; Stenberg et al., 1990), and, although IE1-72 protein is very stable, new IE1-72 protein synthesis does not occur after 12 hpi (Poma et al., 1996). Therefore, it is unlikely that the prolonged activation of NF-nB induced by HCMV functions to transactivate this promoter at later times of infection. Thus, we hypothesized that the second phase of NF-nB activation plays a role in HCMV replication independently of MIEP transactivation. To test this hypothesis, we examined viral replication when NF-nB activity was blocked at early and late times of infection using the NF-nB inhibitors. To measure viral replication, fibroblasts were infected with GFP-HCMV, and drugs were applied at 24 or 48 hpi; control cultures were pretreated with NF-nB inhibitors for one hour prior to infection. For all experiments, media were changed, and fresh drugs added every 24 h. Total fluorescence intensity of each well was measured using a fluorescence plate reader.

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

19

Fig. 2. Inhibition of NF-nB activity blocked the production of progeny virus. HEL fibroblasts were grown to confluency in 6-well tissue culture dishes and pretreated with 2 ml of Eagle’s MEM containing aspirin (3 mM), MG-132 (2.5 AM) or DMSO and infected with GFP-HCMV (MOI 3 – 5), or mock infected. Media were changed every 24 h with MEM containing fresh drugs. Supernatant from the different culture conditions was collected at the times indicated following infection, and serial dilutions were performed. Aliquots from each of the serial dilutions were added to fresh HEL fibroblasts grown to confluency in 24-well tissue culture dishes and incubated overnight. Cultures were then washed with PBS and overlayed with methylcellulose. (A) Infected cells were visualized by fluorescence microscopy (10 1 dilution shown). (B) The total number of GFP-expressing cells at each dilution was counted at 96 hpi to determine the virus titer (displayed as infectious units (IU) of virus per milliliter). To control for the possibility that residual drugs in the supernatant collected from cultures treated with aspirin and MG-132 negatively affected the virus titers, drugs were added to untreated, but infected supernatants prior to performing serial dilutions. No decrease in viral titers was observed when drugs were added to untreated supernatants prior to dilution (data not shown). Mock represents uninfected fibroblasts treated identically to experimental samples. The experiment was repeated with similar results, and a representative experiment is shown.

Both aspirin (Fig. 3A) and MG-132 (Fig. 3B) significantly blocked HCMV replication even when the drugs were added as late as 48 hpi. In experiments examining the inhibition of NFnB by aspirin (Fig. 3A), solvent alone-treated infected cells

exhibited a 46-fold increase in fluorescence intensity over mock-infected cells when measured at 120 hpi; when aspirin was added at 24 or 48 hpi, only 19-fold (59% decrease) and 27fold (41% decrease) increases in fluorescence intensity over

20

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

Fig. 3. Inhibition of NF-nB activity at later times of infection blocked viral replication. HEL fibroblasts were treated with (A) aspirin (3 mM) or (B) MG-132 (2.5 AM) either 1 h prior to infection, 24 hpi, or 48 hpi with GFP-HCMV (MOI 3 – 5). Replicate cultures were either mock infected, treated with the solvent (DMSO or Tris), or left untreated. Fluorescence intensity of cultures was measured every 24 h following infection. Results are displayed as fold-increase (Tstandard deviation) in fluorescence intensity of GFP-HCMV-infected cells over mock-infected cells. The data are the means of three independent experiments. P values were calculated using Student’s t test and demonstrate a significant increase ( P < 0.005) in viral replication following infection when compared to cultures to which NF-nB inhibitory drugs were added 24 or 48 hpi. (C) Western blot analysis demonstrating that IE proteins were maximally produced at 24 hpi and 48 hpi. HEL fibroblasts were infected with GFP-HCMV, or mock infected, and total cell lysates were harvested at the times indicated. Western blot analyses were performed using monoclonal antibodies specific for IE1-72 and a-tubulin (as a loading control). Mock represents uninfected fibroblasts. All experiments were repeated with similar results. Representative experiments are shown.

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

mock-infected cells were observed, respectively. Tris-treated infected cells showed an identical pattern of replication when compared to untreated infected cells (data not shown). Similarly, when MG-132 was added to cells after 24 or 48 hpi (Fig. 3B), only respective 13-fold and 19-fold increases in fluorescence intensity (76% and 66% decreases, respectively) were observed at 96 hpi when compared to mock-infected cells; cells treated with drug solvent alone exhibited a 56-fold increase in fluorescence intensity over mock-infected cells at the same time points. Again, a slight increase in replication was observed in DMSO-treated infected cells when compared to untreated infected cells. Similar results were observed when cells were pretreated, treated at 24 hpi, or at 48 hpi with lactacystin, a proteasome inhibitor mechanistically similar to MG-132 (Supplemental Fig. 2). In aspirin, MG-132, and lactacystin-treated cultures, fluorescence intensity increased the later the drug was added but remained significantly lower than untreated cultures or cultures treated with drug solvents alone. IE proteins are normally synthesized within hours of infection (Blanton and Tevethia, 1981; Poma et al., 1996; Stenberg et al., 1989) and play a critical role in early gene production and viral replication (Gawn and Greaves, 2002; Greaves and Mocarski, 1998; Heider et al., 2002; Marchini et al., 2001; Mocarski et al., 1996; Sanchez et al., 2002; White et al., 2004). Because we previously demonstrated that NF-nB was important for efficient production of IE proteins (DeMeritt et al., 2004), a delay in the HCMV life cycle in our system could account for the decrease in viral replication observed upon addition of NF-nB inhibitors. To measure the kinetics of IE protein synthesis, Western blot analysis was performed on infected cell lysates harvested at various times post-infection using antibodies specific for IE1-72 (Fig. 3C). These data demonstrate that by 6 hpi, IE1-72 reached maximal levels, consistent with previous reports (Blanton and Tevethia, 1981; Bresnahan et al., 2000; Stenberg et al., 1989). The maximal presence of IE1-72 at 24 and 48 hpi suggests that addition of NF-nB inhibitors at late times of infection plays an important role in viral replication, independent of IE protein synthesis. To measure progeny virus release in the presence of NF-nB inhibitory drugs at early and late times of infection, supernatant was collected from infected cells, and infectious unit assays were performed to quantify virus released from untreated cells or cells treated with the NF-nB inhibitory drugs at (a) 1 h prior to infection, (b) 24 hpi, or (c) 48 hpi. Confluent fibroblast cultures were infected with serially diluted supernatants collected from experimental samples and, as demonstrated in Fig. 4A, GFP-expressing cells were examined by fluorescence microscopy (10 1 dilution is shown in Fig. 4A). Viral titers were also calculated (Fig. 4B). These experiments demonstrated a significant reduction in the amount of virus released from cells treated with compounds that inhibit NF-nB activation, even when these compounds were added as late as 48 hpi. Release of progeny virus from cultures treated with drugs beginning at 24 hpi exhibited a five-log decrease in virus titers when compared to DMSO-treated cultures; similar results were

21

observed when cultures were pretreated with the NF-nB inhibitory drugs. Cultures treated with aspirin and MG-132 at 48 hpi showed an approximate three-log decrease in virus titers when compared to cultures treated with drug solvent alone (Fig. 4B). As shown in Fig. 4B, no differences were seen in viral titers in untreated infected cells and DMSO-treated infected cells. The Tris solvent control also showed no effect (data not shown). These data suggested that inhibition of NFnB activation at late times of infection largely prevented progeny virus production from infected cells. HCMV late protein expression was decreased following NF-jB inhibition at later times of infection To expand our study into the role that NF-nB plays at late times of HCMV infection, we next investigated whether production of late proteins important for HCMV biology was affected by the addition of NF-nB inhibitory compounds at late times of infection. To investigate the effects of aspirin and MG-132 on synthesis of viral late proteins, we performed Western blot analysis using antibodies specific for gB and pp65. Assays were performed on total cell lysates harvested at 72 hpi from HEL fibroblasts infected with the HCMV Towne/ E strain (MOI 3 to 5) and treated with aspirin or MG-132 at various times post-infection (Fig. 4C). Infected, untreated cells exhibited high levels of both gB and pp65 protein, whereas no protein was detected in cells pretreated with aspirin or MG-132, or when the drugs were applied at 6 or 12 hpi. Inhibition of NF-nB activity at 24 hpi revealed only low levels of gB and pp65 production. When the drugs were applied at 48 hpi, both gB and pp65 were produced, although the production of gB was somewhat decreased in cultures treated with aspirin. The solvent alone controls had no effect on viral gene expression (data not shown). Western blot analysis using antibodies specific for IE2-86 revealed that IE proteins reached near-maximal levels by 24 hpi, demonstrating that the effects observed at this time point were not due to an inhibition of MIEP transactivation by the NF-nB inhibitory compounds. The near normal production of pp65 and gB, when NF-nB was inhibited at 48 hpi, despite the impairment of progeny virus production (Fig. 4B), suggests that other required viral genes are more sensitive to the inhibition of NF-nB activity. Treatment of HCMV-infected fibroblasts with BAY11 inhibited viral replication Aspirin and MG-132 are widely used to inhibit NF-nB activation, however, each of these compounds may also have additional effects on cellular function. To provide additional support for our observations using aspirin and MG-132, BAY11 was used to block NF-nB activation (Fig. 5). BAY11 was identified as a novel inhibitor of InBa phosphorylation, and thus, the release of active NF-nB (Pierce et al., 1997). The NF-nB inhibitory effects of BAY11 appear irreversible and specific for InBa (Cahir-McFarland et al., 2004; Pierce et al., 1997).

22

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

BAY11 treatment of fibroblasts for 1 h prior to infection significantly inhibited viral replication, as determined by fluorescence intensity (Fig. 5A). When fibroblast cultures were infected and treated with BAY11 at 24 or 48 hpi, a reduction in viral replication was observed. These results mirror those observed with cultures treated with aspirin or MG-132. Cultures pretreated with BAY11 exhibited a 9-fold increase (68% decrease compared to DMSO-treated cells) in fluorescence intensity when compared to mock-infected cultures at 96 hpi; cultures treated with DMSO alone, however, exhibited a 28-fold increase in fluorescence intensity over mock-infected cells at the same time point. Treatment of cultures with BAY11 at 24 hpi and 48 hpi resulted in respective 14-fold increases (a 50% decrease) in fluorescence intensity when compared to mock-infected cells at 96 hpi. These results provide evidence that NF-nB activity is required for efficient HCMV replication because the compounds we utilized to inhibit NF-nB activation function via different mechanisms, with non-overlapping side effects. To confirm our previous results indicating that late protein production was inhibited when drugs were applied prior to infection or after 24 hpi, but not after 48 hpi, we performed Western blot analyses using antibodies specific for gB on infected cell lysates treated with BAY11 (or DMSO control) at various times post-infection (Fig. 5B). Detection of gB revealed high levels of this protein at 72 hpi in untreated samples and samples to which BAY11 was applied 48 hpi; no gB was detected in cells pretreated with BAY11 or when the drug was applied 6 or 12 hpi. Very low levels of gB were detected after the addition of BAY11 at 24 hpi. These results mirror our observations on the expression of late protein production in the presence of aspirin and MG-132 (Fig. 4C). To confirm that IE proteins were produced despite the addition of BAY11 to infected cultures at 24 and 48 hpi, Western blot analysis was performed on replicate cell lysates harvested from cultures treated with BAY 11 at these times post-infection. Maximal levels of IE2-86 were detected in cultures treated with BAY11 at 24 and 48 hpi (Fig. 5C). It should be noted that the concentration of BAY11 used in our studies (2.5 AM) was less than the concentration used to inhibit NF-nB activation in other studies (5 –10 AM) (Benitah et al., 2003; Cahir-McFarland et al., 2004; Nakayama et al., 2004) because of the sensitivity of our fibroblasts to BAY11 at late time points. At 2.5 AM, BAY11 had no cytotoxic effects at the time points tested, and cells were greater than

23

95% viable as determined by trypan blue (data not shown) and TUNEL staining (Supplemental Fig. 1). Decreased viral replication was not due to a block in viral infectivity Studies with other herpesviruses have suggested that inhibition of the phosphatidylinositol 3-kinase (PI3-K) cellular signaling pathway, which is upstream of NF-nB activation, significantly reduced infectivity by blocking viral entry (Naranatt et al., 2003; Wang et al., 2005). To determine if the block in HCMV replication observed in the presence of NF-nB inhibitors was due to a similar inhibition of HCMV entry into fibroblasts, cells were pretreated with aspirin, MG-132, and BAY11 for 1 h, or left untreated, and infected with BrdUlabeled HCMV. Confocal immunofluorescence microscopy was used to visualize infected fibroblasts stained with a BrdU-specific monoclonal antibody (Fig. 6A). Confocal microscopy revealed similar numbers of virus particles in the nuclei of untreated fibroblasts and fibroblasts treated with aspirin, MG-132, and BAY11. The viral DNA in the nucleus is marked with a white arrow. When the average number of virus particles per nucleus (n = 50) was calculated, similar levels of infectivity were observed following treatment with NF-nB inhibitory drugs (Fig. 6B). These results provide evidence that inhibition of the NF-nB pathway did not interfere with HCMV entry into cells and suggested that the observed effects of these drugs on HCMV replication occurred at the level of NF-nBdirected transcriptional control. Aspirin, MG-132, and BAY11 block NF-jB nuclear translocation To confirm that the drugs used in these studies blocked nuclear translocation of NF-nB, cellular localization of p65 was determined using immunofluorescence microscopy (Fig. 7). Cells were pretreated with aspirin, MG-132, BAY11, or the drug solvent DMSO and infected with HCMV (MOI 3– 5). As a positive control, untreated cells were infected, and mockinfected cultures were used as a negative control. Nuclear translocation of p65 was evident in untreated but infected cells and infected cells treated with the drug solvent DMSO alone. However mock-infected cells and cells treated with aspirin, MG-132, and BAY11 prior to infection revealed predominant cytoplasmic p65 staining with little or no detectable p65 localized to the nucleus. These data support the role that the

Fig. 4. Progeny virus production is inhibited by blocking NF-nB activation at late times of infection. Supernatant was collected at 96 hpi from fibroblasts cultures grown to confluency in 6-well tissue culture dishes and infected with GFP-HCMV (MOI 3 – 5). Cultures were either pretreated with aspirin, MG-132, or DMSO, or drugs were added 24 hpi or 48 hpi. Media were changed, and MEM containing fresh drugs was added every 24 h. Supernatants were serially diluted and plaque assays performed. (A) Plaques were visualized by fluorescence microscopy (10 1 dilution shown) at 60 hpi. (B) The total number of GFP-expressing cells at 60 hpi for each dilution was counted to determine the virus titer (displayed as infectious units (IU) of virus per milliliter). Mock represents uninfected fibroblasts. All experiments were repeated with similar results. A representative experiment is shown. (C) HEL fibroblasts were untreated, pretreated with the NF-nB inhibitors aspirin or MG-132 for 1 h prior to infection with HCMV (MOI 3 – 5), or the drugs were added to cultures at 6 hpi, 12 hpi, 24 hpi, or 48 hpi. All cultures were treated identically at each time point. Total cell lysates were collected at 72 hpi, and protein levels were analyzed by Western blot analysis using antibodies specific for the late HCMV proteins gB and pp65, as well as IE2-86. A monoclonal antibody specific for a-tubulin was used to verify equal loading in each lane. Mock represents uninfected fibroblasts. All experiments were repeated with similar results; a representative experiment is shown.

24

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

Fig. 5. The effects of BAY11 on HCMV replication are similar to those observed with other NF-nB inhibitors. (A) Fibroblasts were treated with BAY11 for 1 h prior to infection with GFP-HCMV, or drugs were added 24 hpi or 48 hpi. Untreated cultures and cultures treated with DMSO alone were used as controls; a mockinfected culture was used as the negative control. Fluorescence intensity of infected plates was measured every 24 h using a fluorescence plate reader. Results are displayed as fold-increase (Tstandard deviation) in fluorescence intensity of GFP-HCMV-infected cells over mock-infected cells. The data are the means of three independent experiments. P values were calculated using Student’s t test and demonstrate a significant increase ( P < 0.005) in both infected cultures when compared to cultures to which NF-nB inhibitory drugs were added 24 or 48 hpi. (B) HEL fibroblasts were untreated, pretreated with BAY11 for 1 h prior to infection with HCMV (MOI 3 – 5), or the drug was added to cultures at the times indicated following infection. Total cell lysates were collected at 72 hpi, and protein levels were analyzed by Western blot analysis using antibodies specific for the HCMV late protein gB. A monoclonal antibody specific for a-tubulin was used to verify equal protein loading in each lane. Mock represents uninfected fibroblasts. (C) To demonstrate the normal production of IE proteins in cells to which BAY11 was added 24 and 48 hpi, Western blot analysis was performed on replicate samples harvested at 72 hpi using a monoclonal antibody specific for IE2-86. No IE2-86 protein was detected in cells pretreated with BAY11. All experiments were repeated with similar results; representative experiments are shown.

activation and nuclear translocation of NF-nB plays in multiple steps in the viral life cycle. Discussion HCMV replication in immunocompromised individuals, such as transplant recipients, congenitally infected neonates, and AIDS patients, leads to severe disease (Pass, 2001). In the

present study, we demonstrated that pharmacological agents that inhibited activation of the NF-nB pathway were capable of preventing viral replication and release of progeny virus, even when activation was blocked after the initiation of HCMV replication. These results contribute to our understanding of the role NF-nB plays in the viral life cycle. This present study expands upon work previously performed by Yurochko et al. (1995) demonstrating that

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

25

Fig. 6. Decrease in viral replication was not due to a block in infectivity. HEL fibroblasts were pretreated with aspirin, MG-132, and BAY11 and infected with BrdUlabeled HCMV. Cells were stained for BrdU 3 hpi and visualized by confocal microscopy. Nuclei are shown in red, and BrdU-labeled virus particles are shown in green. White arrows mark nuclear viral DNA staining. Experiments were repeated with similar results. (B) The average number of BrdU-labeled virus particles per nucleus was determined by counting all BrdU particles in the nuclei of fifty cells. The experiments were performed in triplicate. Results are presented as the average number of virus particles per nucleus (Tstandard deviation). Untreated but infected cells were used as the positive control, whereas mock-infected cells were used as the negative control. No significant difference between untreated and treated cultures was observed.

following HCMV infection of fibroblasts, NF-nB activation occurred in two distinct phases. The first phase took place within minutes of infection and lasted for several hours, while the second phase of NF-nB activation occurred after 12 hpi and remained elevated throughout the course of infection. Our recent work elucidated a function for the initial phase of NFnB activation by providing evidence that the MIEP was largely dependent on activated NF-nB for its transactivation at IE times of infection (DeMeritt et al., 2004). In this study, we proposed that the initial phase of NF-nB activation functioned to ‘‘jump-start’’ viral gene expression immediately after infection. The work presented here details a role for the second phase of NF-nB activation and leads us to propose that NF-nB activity is also important for efficient viral replication and viral maturation.

To investigate the role NF-nB plays in the HCMV life cycle, the pharmacological agents aspirin, MG-132, lactacystin, and BAY11 were employed; each of these compounds effectively inhibits NF-nB activation (Cahir-McFarland et al., 2004; Kopp and Ghosh, 1994; Palombella et al., 1994; Pierce et al., 1997; Wu et al., 2002; Yin et al., 1998). An important consideration for our use of these agents was that each impaired NF-nB activation through a different mechanism: aspirin is the least specific inhibitor and affects signaling through IKKh and other factors upstream of NF-nB (Mitchell et al., 1997; Smith et al., 1993; Yin et al., 1998), MG-132 and lactacystin prevent degradation of InBa by inhibiting the 26S proteosome complex (Palombella et al., 1994), and BAY11 prevents the phosphorylation of InBa (Cahir-McFarland et al., 2004; Pierce et al., 1997). The combination of compounds used in the current

26

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

Fig. 7. Aspirin, MG-132, and BAY11 block NF-nB nuclear translocation. The nuclear translocation of NF-nB p65 was analyzed by confocal microscopy 1 hpi in the presence and absence of NF-nB inhibitory drugs aspirin, MG-132, and BAY11, or the drug solvent DMSO. Untreated but infected cultures were used as the positive control, and mock-infected cultures served as the negative control. Nuclei are shown in red, and p65 protein is shown in green. Experiments were repeated with similar results. A representative experiment is shown.

study, coupled with our previous results demonstrating significantly decreased levels of MIEP transactivation in the presence of dominant negative InBa, IKKa, and IKKh (DeMeritt et al., 2004), provides strong support for the requirement of NF-nB activity in the viral life cycle in human fibroblasts. Although the drugs used to inhibit NF-nB may exert additional effects on cellular physiology, the multiple approaches utilized to inhibit NF-nB activity suggest that our observations document the effects mediated by NF-nB on the transactivation of viral promoters. The robust inhibition of HCMV replication and maturation we observed when cells were pretreated with NF-nB inhibitors prior to infection supports our previous findings that virallyinduced NF-nB is a central factor in viral gene expression. However, the observation that there was a three-log decrease in viral replication when the drugs were added at 48 hpi, suggested that steps in the HCMV life cycle, in addition to IE gene expression, are affected by the inhibition of NF-nB activity. Although a more pronounced decrease in viral replication was observed when cells were pretreated with the NF-nB inhibitors than when the inhibitors were added at 48 hpi, these data indicated that HMCV replication can be reduced after a productive infection has initiated. Therefore, targeting the NFnB pathway – in combination with other anti-viral treatments – may provide an effective means of blocking HCMV replication in high-risk patients. The data documenting the inhibition of viral replication by drugs that block NF-nB activity suggested that one or more early genes critical for HCMV replication were responsive to NF-nB activation. While we are currently investigating the identity of potential NF-nB-responsive early genes, a likely candidate in our studies is the UL54 DNA polymerase. While no consensus NF-nB binding sites have been identified in this promoter, several regions of the promoter sequence (Kerry et al., 1994) share nucleotide homology with consensus NF-nB binding sites (nucleotides 98 to 89, 81 to 72, and 3 to

+8). Therefore, it is possible that NF-nB transactivates the UL54 promoter. Studies investigating a potential role for NFnB in the transactivation of this promoter are currently being conducted in our laboratory. Preliminary data suggest that UL54 mRNA levels are substantially decreased in the presence of all three NF-nB inhibitory drugs, thus providing a mechanism for the decrease in viral replication observed when NF-nB activity was inhibited. The effects of NF-nB inhibitors on HCMV replication at IE and early times of infection are explained by the fact that proteins produced at these times are required for the completion of the HCMV gene cascade. However, the observed decrease in viral maturation following inhibition of NF-nB activity at later times, when IE and early proteins are present, suggested that promoters for some of the late genes likely contain NF-nB binding sites. In our hands, pp65 and gB expression were inhibited when NF-nB activity was blocked at 24 hpi, but not at 48 hpi, suggesting that other late genes are more sensitive to the inhibition of NF-nB activity. Late proteins, including pp71, pUL69, and pUL97, have been demonstrated to be important for efficient viral replication (Bresnahan and Shenk, 2000; Hayashi et al., 2000; Prichard et al., 1999). The viral titers produced from cells infected with mutant viruses lacking these proteins are similar to those we observed from HEL fibroblasts infected with wild-type HCMV in the presence of the NF-nB inhibitors. We have not analyzed the proteome of virions produced in the presence of NF-nB inhibitors to determine which proteins, if any, are absent; these studies are currently being addressed in our laboratory. Our data suggesting a role for NF-nB in the progression of the HCMV life cycle were supported by Caposio et al. (2004), who recently demonstrated that IKKh was important for HCMV MIEP transactivation and viral replication. In addition, our previous report demonstrating that MG-132 significantly inhibited IE protein production (DeMeritt et al., 2004) was confirmed by Gealy et al. (2005). Likewise, efficient replica-

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

tion of herpes simplex virus type I was shown to be highly dependent on the NF-nB pathway (Gregory et al., 2004). However, the role NF-nB plays in the HCMV life cycle is controversial, as additional reports suggest that ‘‘classical’’ NFnB activity was not required for the transactivation of the HCMV MIEP (Benedict et al., 2004; Eickhoff and Cotten, 2005; Isomura et al., 2004). The source of the discrepancies among these studies is unknown but may represent differences in the cell lines or virus strains used. Regardless, further work will be needed to appreciate the full significance of the activation of NF-nB to HCMV pathobiology. Elevated levels of NF-nB are associated with a number of pathological states, many of which are similar to diseases associated with HCMV infection (Baldwin, 2001; Perkins, 2000), suggesting a link between HCMV pathogenesis and the viral induction of NF-nB. For instance, aberrant levels of NF-nB are associated with birth defects (reviewed in Aradhya and Nelson, 2001); could this aberrant NF-nB induction be a biological mechanism for the pathologies caused by congenital HCMV infection? In addition, evidence associates HCMV infection with inflammatory diseases such as atherosclerosis and restenosis (Blum et al., 1998; Bruggeman, 1999; Bruggeman et al., 1999; Epstein et al., 1999a, 1999b; Hendrix et al., 1990; Melnick et al., 1990; Sorlie et al., 2000; Zhu et al., 1999). Because genes upregulated in atherosclerotic plaques are mediated by NF-nB, the possibility exists that the induction of NF-nB in the infected vasculature could be involved in pathogenesis. Together, our observations implicate a role for viral-induced NF-nB in multiple steps in the viral life cycle and provide a possible biological explanation for viral-mediated disease. Materials and methods Cell culture and virus Primary human embryonic lung (HEL) fibroblasts (passage 13 –20) were cultured in Eagle’s minimal essential media (MEM, Cellgro Mediatech, Inc., Herndon, VA) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gemini, Woodland, CA), penicillin (100 IU/ml), and streptomycin (100 Ag/ml). In all experiments, either a Toledo strain of HCMV expressing Green Fluorescent Protein (GFP-HCMV) (Iwata et al., 1999) or a low passage Towne/E strain of HCMV (passage 35 –42) (Yurochko et al., 1997a) was used. Unless otherwise stated, all infections were performed with a multiplicity of infection (MOI) of three to five. Virus stocks were cultured in HEL fibroblasts grown in Eagle’s MEM (Cellgro Mediatech, Inc.) supplemented with 4% heatinactivated FBS (Gemini), penicillin (100 IU/ml), and streptomycin (100 Ag/ml). NF-jB inhibitory drugs To inhibit NF-nB activation, aspirin (acetylsalicylic acid, Sigma, St. Louis, MO), MG-132 (Z-Leu-Leu-Leu-al; Sigma), lactacystin (EMD Biosciences, Inc., La Jolla, CA), and

27

BAY11-7082 (BAY11; EMD Biosciences, Inc.) were resuspended in appropriate solvents (1 M Tris [pH 8.0] for aspirin; dimethyl sulfoxide [DMSO] for MG-132, lactacystin, and BAY11) and diluted to their appropriate concentrations (3 mM for aspirin, 2.5 AM for MG-132, lactacystin, and BAY11) in Eagle’s MEM (Cellgro Mediatech, Inc.) supplemented with 4% heat-inactivated FBS (Gemini), penicillin (100 IU/ml), and streptomycin (100 Ag/ml). Titrations of drugs were performed to determine the optimal doses for use in our studies (data not shown). For some experiments, the diluted drugs were incubated with HEL fibroblast cultures for 1 h prior to infection. After pretreatment, the media were removed, and cultures were infected with HCMV (MOI 3– 5) in drugcontaining media, which were replaced every 24 h. For experiments in which the NF-nB inhibitory drugs were added to the cultured cells at various times post-infection, infections were performed in drug-free media which were replaced every 24 h. For all experiments involving NF-nB inhibitory drugs, replicate control cultures were treated with identical concentrations of the drug solvents at the same time points. Additionally, replicate mock-infected cultures were performed to ensure that the NF-nB inhibitory drugs had no effect on the fluorescence readings. Cells treated with the NF-nB inhibitory drugs and drug solvents were tested for cytotoxicity using trypan blue (Cellgro Mediatech, Inc.) exclusion staining (data not shown) and TUNEL staining (Supplemental Fig. 1): greater than 95% of all cells were viable at all time points used in our assays. Quantification of fluorescence intensity HEL fibroblasts were cultured in 6-well tissue culture dishes and, when confluent, infected with GFP-HCMV in the presence of NF-nB inhibitors, or control compounds. Every 24 hpi, relative fluorescence intensity of HEL cultures infected with GFP-HCMV was measured using a POLARstar OPTIMA fluorescence plate reader (BMG Labtech, Inc., Durham, NC) and FLUOstar OPTIMA software (BMG Labtech, Inc.). Raw fluorescence data were converted to the fold increase in fluorescence intensity of each sample over that of mockinfected cells. P values were calculated using Student’s t test on three independent replicates of the experiment. DNA isolation and dot blot analysis Total cellular DNA was harvested from HCMV-infected fibroblasts using the Qiagen DNeasy kit (Qiagen, Inc., Valencia, CA). DNA was denatured by heating to 100 -C for 10 min in a solution containing 0.4 M NaOH and 10 mM EDTA. DNA was then spotted onto a Zeta-Probe Blotting membrane (Bio-Rad Laboratories, Hercules, CA) using a microfiltration vacuum apparatus (Bio-Rad Laboratories). Wells were then washed and the DNA cross-linked to the membrane using ultraviolet light. A radioactive probe specific for the genomic sequence of the region from exon 2 to exon 4 of IE1-72 was generated by PCR on viral DNA isolated from HCMV-infected fibroblasts. Primers corresponding to exon 2 (sense: ACACGATG-

28

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

GAGTCCTCTGCC) and exon 4 (antisense: TTCTATGCCGCACCATGTCC) (Gerna et al., 1992) were used to amplify genomic IE1-72. The amplification product of 587 bp confirmed the presence of the correct intronic sequences in the PCR product (data not shown). PCR was carried out in the presence of 1 Al 32P-CTP (ICN Biomedicals, Inc., Irvine, CA) and, following amplification for 35 cycles (94 -C for 1 min, 57.5 -C for 1 min, 72 -C for 1.5 min), the PCR product was filtered through a NucTrap probe purification column (Stratagene, La Jolla, CA). Hybridization was performed by overnight incubation of the membrane at 65 -C in a hybridization buffer (1 mM EDTA, 0.5 M Na2HPO4, 7% SDS) containing the radioactive probe. The membrane was washed twice with washing buffer (1 mM EDTA, 0.5 M Na2HPO4) containing 5% SDS and twice with washing buffer containing 1% SDS for 30 min per wash. Following washing, the membrane was visualized by autoradiography. Infectious unit assays HEL fibroblasts were grown to confluency in 6-well tissue culture dishes and infected with GFP-HCMV (MOI 3 –5) in the presence or absence of aspirin (3 mM), MG-132 (2.5 AM), or BAY11 (2.5 AM). Cell supernatants from infected or mocktreated cells incubated with the NF-nB inhibitory compounds or the drug solvents were collected at various times postinfection. Infectious unit assays were performed similarly to the plaque assay protocol described by Kowalik et al. (1994). Fresh HEL fibroblasts were grown to confluency in 24-well dishes and infected with 1 ml of serially diluted virus from the different treatment groups. Wells were then washed with PBS (phosphate-buffered saline) and overlayed with 1 methylcellulose (Sigma) containing 1 MEM (Mediatech, Inc.) supplemented with 4% FBS (Gemini), penicillin (100 IU/ ml), and streptomycin (100 Ag/ml). Infected cells expressing GFP (each GFP-expressing cell was counted as one infectious unit of virus) were visualized and counted using fluorescence microscopy. Western blot analysis Infected fibroblast cultures were harvested for Western blot analysis in Laemmli sample buffer (Bio-Rad Laboratories) supplemented with 2.5% h-Mercaptoethanol (DeMeritt et al., 2004). Cell lysates were boiled and SDS-10% polyacrylamide gel electrophoresis was performed. Equal amounts of protein were loaded in each lane. Electrophoresed proteins were transferred to ImmunoBlot polyvinylidene difluoride membranes (BioRad laboratories) and incubated in a blocking buffer (5% skim milk, 0.1% Tween-20, 1 PBS). Membranes were incubated with primary antibodies diluted in blocking buffer and, following incubation, blots were washed with a 1 PBS/0.1% Tween-20 solution. Membranes were then incubated with a horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences, Piscataway, NJ) diluted in blocking buffer. Blots were washed and developed using the ECL+ system (Amersham Biosciences) according to the manufac-

turer’s protocol. Monoclonal antibodies specific for HCMV IE1-72 (6E1) and IE2-86 (12E2) were used previously (Yurochko et al., 1997a). The monoclonal a-tubulin (TU-02) antibody (catalog #sc-8035) was obtained from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). Mouse monoclonal antibodies specific for the HCMV glycoprotein B (Abcam, Inc., Cambridge, MA; catalog #ab6499) and pp65 (Virusys Corporation, Sykesville, MD; catalog #CA003-100) were also used in these studies. Bromodeoxyuridine-labeling of HCMV To visualize viral entry into HEL fibroblasts, HCMV particles were labeled with 5-bromo-2V-deoxyuridine (BrdU; Calbiochem, San Diego, CA) according to the protocol of Rosenke and Fortunato (2004). Briefly, confluent HEL fibroblasts were infected with the Towne/E strain of HCMV and incubated overnight in Eagle’s MEM (Cellgro Mediatech, Inc.) supplemented with 4% heat-inactivated FBS (Gemini), penicillin (100 IU/ml), and streptomycin (100 Ag/ml). When cytopathic effects were observed in 80– 90% of the cells, media were replaced with fresh media containing 10 AM BrdU. After incubation for 48 h, additional BrdU was added to cultures, and cells were incubated for another 24 h before virus was harvested. To visualize viral entry into cells, HEL fibroblasts were grown on glass coverslips and treated with aspirin (3 mM), MG-132 (2.5 AM), or BAY11 (2.5 AM), or left untreated, for 1 h prior to infection. Cells were infected with BrdU-labeled HCMV and infection was allowed to proceed for 3 h. Following infection, coverslips were washed with PBS and cells were fixed in 3% paraformaldehyde for 10 min. Cells were then permeabilized with 1% Triton X-100, followed by treatment with 4 N HCl to expose the BrdU residues. Coverslips were blocked with PBS containing 1% FBS (Gemini) and then treated with a mouse monoclonal antiBrdU (Ab-3) antibody (Calbiochem; catalog #NA61) followed by a FITC-labeled goat anti-mouse secondary antibody (Santa Cruz Biotechnology, Inc.; catalog #sc-2010). Nuclei were stained with TO-PRO-3 iodide (Molecular Probes, Inc., Eugene, OR; catalog #T3605). Cells were visualized by confocal microscopy. Visualization of NF-jB p65 localization Fibroblasts were grown on glass coverslips and treated for 1 h with aspirin, MG-132, BAY11, or the drug solvent DMSO; replicate untreated and mock-infected cultures were also used. Cells were infected with HCMV Towne/E (MOI 3– 5) for 1 h. Following infection, coverslips were washed with PBS, cells were fixed in 3% formaldehyde and permeabilized with 1% Triton X-100. Coverslips were blocked in a 30% FBS blocking solution containing 1% BSA and 0.01% Tween-20 in PBS prior to the addition of a primary rabbit polyclonal antibody specific for NF-nB p65 (Santa Cruz Biotechnology; catalog #sc-109). Following incubation, coverslips were washed with PBS, and a FITC-

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

conjugated goat anti-rabbit secondary antibody (Santa Cruz Biotechnology; catalog #sc-2012) was applied. Nuclei were stained using TO-PRO-3 iodide (Molecular Probes, Inc.; catalog #T3605), and coverslips were mounted on glass slides with the SlowFade Light Anti-Fade kit (Molecular Probes, Inc.; catalog #S7461). Cells were visualized using confocal microscopy. Acknowledgments The authors would like to thank Kathleen Llorens in the LSUHSC Research Core Facilities for her excellent technical assistance. This work was supported in part by grants from the American Heart Association (0365207B and 0415120B), the March of Dimes Foundation (1-FY01-332), and the National Institutes of Health (1-P20-RR018724-01 and 1-R01-AI56077-01A1). Appendix A. Supplementary data Supplementary data associated with this article can be found in the online version at doi:10.1016/j.virol.2005.09.065. References Aradhya, S., Nelson, D.L., 2001. NF-nB signaling and human disease. Curr. Opin. Gen. Dev. 11, 300 – 306. Baldwin Jr., A.S., 2001. Series introduction: the transcription factor NF-nB and human disease. J. Clin. Invest. 107, 3 – 6. Benedict, C.A., Angulo, A., Patterson, G., Ha, S., Huang, H., Messerle, M., Ware, C.F., Ghazal, P., 2004. Neutrality of the canonical NF-nB-dependent pathway for human and murine cytomegalovirus transcription and replication in vitro. J. Virol. 78, 741 – 750. Benitah, S.A., Valeron, P.F., Lacal, J.C., 2003. ROCK and nuclear factornB-dependent activation of cyclooxygenase-2 by Rho GTPases: effects on tumor growth and therapeutic consequences. Mol. Biol. Cell 14, 3041 – 3054. Blanton, R.A., Tevethia, M.J., 1981. Immunoprecipitation of virus-specific immediate-early and early polypeptides from cells lytically infected with human cytomegalovirus strain AD 169. Virology 112, 262 – 273. Blum, A., Giladi, M., Weinberg, M., Kaplan, G., Pasternack, H., Laniado, S., Miller, H., 1998. High anti-cytomegalovirus (CMV) IgG antibody titer is associated with coronary artery disease and may predict post-coronary balloon angioplasty restenosis. Am. J. Cardiol. 81, 866 – 868. Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B., Schaffner, W., 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41, 521 – 530. Bresnahan, W.A., Shenk, T.E., 2000. UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proc. Natl. Acad. Sci. U.S.A. 97, 14506 – 14511. Bresnahan, W.A., Hultman, G.E., Shenk, T., 2000. Replication of wild-type and mutant human cytomegalovirus in life-extended human diploid fibroblasts. J. Virol. 74, 10816 – 10818. Britt, W.J., Alford, C.A., 1996. Cytomegalovirus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, third edR Lippincott-Raven Publishers, Philadelphia, PA, pp. 2493 – 2523. Bruggeman, C., 1999. Cytomegalovirus is involved in vascular pathology. Am. Heart J. 138, S473 – S475. Bruggeman, C.A., Marjorie, H.J., Nelissen-Vrancken, G., 1999. Cytomegalovirus and atherogenesis. Antivir. Res. 43, 135 – 144. Cahir-McFarland, E.D., Carter, K., Rosenwald, A., Giltnane, J.M., Henrickson, S.E., Staudt, L.M., Kieff, E., 2004. Role of NF-nB in cell survival and

29

transcription of latent membrane protein 1-expressing or Epstein – Barr virus latency III-infected cells. J. Virol. 78, 4108 – 4119. Caposio, P., Dreano, M., Garotta, G., Gribaudo, G., Landolfo, S., 2004. Human cytomegalovirus stimulates cellular IKK2 activity and requires the enzyme for productive replication. J. Virol. 78, 3190 – 3195. Chen, L.F., Greene, W.C., 2004. Shaping the nuclear action of NF-nB. Nat. Rev., Mol. Cell Biol. 5, 392 – 401. Chen, Z., Hagler, J., Palombella, V.J., Melandri, F., Scherer, D., Ballard, D., Maniatis, T., 1995. Signal-induced site-specific phosphorylation targets InBa to the ubiquitin-proteasome pathway. Genes Dev. 9, 1586 – 1597. Cherrington, J.M., Mocarski, E.S., 1989. Human cytomegalovirus ie1 transactivates the a promoter-enhancer via an 18-base-pair repeat element. J. Virol. 63, 1435 – 1440. Cherrington, J.M., Khoury, E.L., Mocarski, E.S., 1991. Human cytomegalovirus ie2 negatively regulates a gene expression via a short target sequence near the transcription start site. J. Virol. 65, 887 – 896. Crumpacker, C.S., 2000. Cytomegalovirus. In: Mandell, G.L., Bennett, J.E., Dolin, R. (EdR). Principles and Practice of Infectious Diseases, 5th ed. vol. 2. Churchill Livingstone, Philadelphia, PA, pp. 1586 – 1599. Degre, M., 2002. Has cytomegalovirus infection any role in the development of atherosclerosis? Clin. Microbiol. Infect. 8, 191 – 195. DeMeritt, I.B., Milford, L.E., Yurochko, A.D., 2004. Activation of the NFnB pathway in human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediate-early promoter. J. Virol. 78, 4498 – 4507. DiDonato, J., Mercurio, F., Rosette, C., Wu-Li, J., Suyang, H., Ghosh, S., Karin, M., 1996. Mapping of the inducible InB phosphorylation sites that signal its ubiquitination and degradation. Mol. Cell. Biol. 16, 1295 – 1304. Eickhoff, J.E., Cotten, M., 2005. NF-nB activation can mediate inhibition of human cytomegalovirus replication. J. Gen. Virol. 86, 285 – 295. Epstein, S.E., Zhou, Y.F., Zhu, J., 1999a. Infection and atherosclerosis: emerging mechanistic paradigms. Circulation 100, e20 – e28. Epstein, S.E., Zhou, Y.F., Zhu, J., 1999b. Potential role of cytomegalovirus in the pathogenesis of restenosis and atherosclerosis. Am. Heart J. 138, S476 – S478. Gawn, J.M., Greaves, R.F., 2002. Absence of IE1 p72 protein function during low-multiplicity infection by human cytomegalovirus results in a broad block to viral delayed-early gene expression. J. Virol. 76, 4441 – 4455. Gealy, C., Denson, M., Humphreys, C., McSharry, B., Wilkinson, G., Caswell, R., 2005. Posttranscriptional suppression of interleukin-6 production by human cytomegalovirus. J. Virol. 79, 472 – 485. Gerna, G., Zipeto, D., Percivalle, E., Parea, M., Revello, M.G., Maccario, R., Peri, G., Milanesi, G., 1992. Human cytomegalovirus infection of the major leukocyte subpopulations and evidence for initial viral replication in polymorphonuclear leukocytes from viremic patients. J. Infect. Dis. 166, 1236 – 1244. Greaves, R.F., Mocarski, E.S., 1998. Defective growth correlates with reduced accumulation of a viral DNA replication protein after lowmultiplicity infection by a human cytomegalovirus ie1 mutant. J. Virol. 72, 366 – 379. Gregory, D., Hargett, D., Holmes, D., Money, E., Bachenheimer, S.L., 2004. Efficient replication by herpes simplex virus type 1 involves activation of the InB kinase-InB-p65 pathway. J. Virol. 78, 13582 – 13590. Hayashi, M.L., Blankenship, C., Shenk, T., 2000. Human cytomegalovirus UL69 protein is required for efficient accumulation of infected cells in the G1 phase of the cell cycle. Proc. Natl. Acad. Sci. U.S.A. 97, 2692 – 2696. Heider, J.A., Bresnahan, W.A., Shenk, T.E., 2002. Construction of a rationally designed human cytomegalovirus variant encoding a temperature-sensitive immediate-early 2 protein. Proc. Natl. Acad. Sci. U.S.A. 99, 3141 – 3146. Hendrix, M.G., Salimans, M.M., van Boven, C.P., Bruggeman, C.A., 1990. High prevalence of latently present cytomegalovirus in arterial walls of patients suffering from grade III atherosclerosis. Am. J. Pathol. 136, 23 – 28. Hermiston, T.W., Malone, C.L., Stinski, M.F., 1990. Human cytomegalovirus immediate-early two protein region involved in negative regulation of the major immediate-early promoter. J. Virol. 64, 3532 – 3536. Isomura, H., Stinski, M.F., 2003. The human cytomegalovirus major

30

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31

immediate-early enhancer determines the efficiency of immediate-early gene transcription and viral replication in permissive cells at low multiplicity of infection. J. Virol. 77, 3602 – 3614. Isomura, H., Tsurumi, T., Stinski, M.F., 2004. Role of the proximal enhancer of the major immediate-early promoter in human cytomegalovirus replication. J. Virol. 78, 12788 – 12799. Iwata, M., Vieira, J., Byrne, M., Horton, H., Torok-Storb, B., 1999. Interleukin1 (IL-1) inhibits growth of cytomegalovirus in human marrow stromal cells: inhibition is reversed upon removal of IL-1. Blood 94, 572 – 578. Johnson, R.A., Wang, X., Ma, X.L., Huong, S.M., Huang, E.S., 2001. Human cytomegalovirus up-regulates the phosphatidylinositol 3-kinase (PI3-K) pathway: inhibition of PI3-K activity inhibits viral replication and virusinduced signaling. J. Virol. 75, 6022 – 6032. Karin, M., Ben-Neriah, Y., 2000. Phosphorylation meets ubiquitination: the control of NF-nB activity. Annu. Rev. Immunol. 18, 621 – 663. Kerry, J.A., Priddy, M.A., Stenberg, R.M., 1994. Identification of sequence elements in the human cytomegalovirus DNA polymerase gene promoter required for activation by viral gene products. J. Virol. 68, 4167 – 4176. Klemola, E., Kaariainen, L., 1965. Cytomegalovirus as a possible cause of a disease resembling infectious mononucleosis. Br. Med. J. 5470, 1099 – 1102. Kopp, E., Ghosh, S., 1994. Inhibition of NF-nB by sodium salicylate and aspirin. Science 265, 956 – 959. Kowalik, T.F., Wing, B., Haskill, J.S., Azizkhan, J.C., Baldwin Jr., A.S., Huang, E.S., 1993. Multiple mechanisms are implicated in the regulation of NF-nB activity during human cytomegalovirus infection. Proc. Natl. Acad. Sci. U.S.A. 90, 1107 – 1111. Kowalik, T.F., Yurochko, A.D., Rinehart, C.A., Lee, C.Y., Huang, E.S., 1994. Productive infection of human endometrial stromal cells by human cytomegalovirus. Virology 202, 247 – 257. Liu, B., Hermiston, T.W., Stinski, M.F., 1991. A cis-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2. J. Virol. 65, 897 – 903. Marchini, A., Liu, H., Zhu, H., 2001. Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J. Virol. 75, 1870 – 1878. Meier, J.L., Pruessner, J.A., 2000. The human cytomegalovirus major immediate-early distal enhancer region is required for efficient viral replication and immediate-early gene expression. J. Virol. 74, 1602 – 1613. Melnick, J.L., Adam, E., DeBakey, M.E., 1990. Possible role of cytomegalovirus in atherogenesis. JAMA 263, 2204 – 2207. Mitchell, J.A., Saunders, M., Barnes, P.J., Newton, R., Belvisi, M.G., 1997. Sodium salicylate inhibits cyclo-oxygenase-2 activity independently of transcription factor (nuclear factor nB) activation: role of arachidonic acid. Mol. Pharmacol. 51, 907 – 912. Mocarski, E.S., Courcelle, C.T., 2001. Cytomegaloviruses and their replication. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (EdsR). Fields Virology, 4th ed. vol. 2. Lippincott Williams and Wilkins, Philadelphia, PA, pp. 2629 – 2673R 2 vols. Mocarski, E.S., Kemble, G.W., Lyle, J.M., Greaves, R.F., 1996. A deletion mutant in the human cytomegalovirus gene encoding IE1(491aa) is replication defective due to a failure in autoregulation. Proc. Natl. Acad. Sci. U.S.A. 93, 11321 – 11326. Nakayama, T., Hieshima, K., Nagakubo, D., Sato, E., Nakayama, M., Kawa, K., Yoshie, O., 2004. Selective induction of Th2-attracting chemokines CCL17 and CCL22 in human B cells by latent membrane protein 1 of Epstein – Barr virus. J. Virol. 78, 1665 – 1674. Naranatt, P.P., Akula, S.M., Zien, C.A., Krishnan, H.H., Chandran, B., 2003. Kaposi’s sarcoma-associated herpesvirus induces the phosphatidylinositol 3-kinase-PKC-~-MEK-ERK signaling pathway in target cells early during infection: implications for infectivity. J. Virol. 77, 1524 – 1539. Palombella, V.J., Rando, O.J., Goldberg, A.L., Maniatis, T., 1994. The ubiquitin-proteasome pathway is required for processing the NF-nB1 precursor protein and the activation of NF-nB. Cell 78, 773 – 785. Pass, R.F., 2001. Cytomegalovirus. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Martin, M.A., Lamb, R.A., Roizman, B., Straus, S.E. (EdsR). Fields Virology, 4th ed. vol. 2. Lippincott Williams and Wilkins, Philadelphia, PA, pp. 2675 – 2705R 2 vols. Perkins, N.D., 2000. The Rel/NF-nB family: friend and foe. Trends Biochem. Sci. 25, 434 – 440.

Pierce, J.W., Read, M.A., Ding, H., Luscinskas, F.W., Collins, T., 1996. Salicylates inhibit InBa phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J. Immunol. 156, 3961 – 3969. Pierce, J.W., Schoenleber, R., Jesmok, G., Best, J., Moore, S.A., Collins, T., Gerritsen, M.E., 1997. Novel inhibitors of cytokineinduced InBa phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J. Biol. Chem. 272, 21096 – 21103. Pizzorno, M.C., Hayward, G.S., 1990. The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site. J. Virol. 64, 6154 – 6165. Pizzorno, M.C., O’Hare, P., Sha, L., LaFemina, R.L., Hayward, G.S., 1988. Trans-activation and autoregulation of gene expression by the immediateearly region 2 gene products of human cytomegalovirus. J. Virol. 62, 1167 – 1179. Poma, E.E., Kowalik, T.F., Zhu, L., Sinclair, J.H., Huang, E.S., 1996. The human cytomegalovirus IE1-72 protein interacts with the cellular p107 protein and relieves p107-mediated transcriptional repression of an E2Fresponsive promoter. J. Virol. 70, 7867 – 7877. Prichard, M.N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D.M., Parker, B.O., Pari, G.S., 1999. A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J. Virol. 73, 5663 – 5670. Rosenke, K., Fortunato, E.A., 2004. Bromodeoxyuridine-labeled viral particles as a tool for visualization of the immediate-early events of human cytomegalovirus infection. J. Virol. 78, 7818 – 7822. Sambucetti, L.C., Cherrington, J.M., Wilkinson, G.W., Mocarski, E.S., 1989. NF-nB activation of the cytomegalovirus enhancer is mediated by a viral transactivator and by T cell stimulation. EMBO J. 8, 4251 – 4258. Sanchez, V., Clark, C.L., Yen, J.Y., Dwarakanath, R., Spector, D.H., 2002. Viable human cytomegalovirus recombinant virus with an internal deletion of the IE2 86 gene affects late stages of viral replication. J. Virol. 76, 2973 – 2989. Smith, W.L., DeWitt, D.L., Meade, E.A., 1993. Differential inhibition of prostaglandin endoperoxide synthase (cyclooxygenase) isozymes by aspirin and other non-steroidal anti-inflammatory drugs. J. Biol. Chem. 268, 6610 – 6614. Sorlie, P.D., Nieto, F.J., Adam, E., Folsom, A.R., Shahar, E., Massing, M., 2000. A prospective study of cytomegalovirus, herpes simplex virus 1, and coronary heart disease: the atherosclerosis risk in communities (ARIC) study. Arch. Intern. Med. 160, 2027 – 2032. Stenberg, R.M., Thomsen, D.R., Stinski, M.F., 1984. Structural analysis of the major immediate early gene of human cytomegalovirus. J. Virol. 49, 190 – 199. Stenberg, R.M., Witte, P.R., Stinski, M.F., 1985. Multiple spliced and unspliced transcripts from human cytomegalovirus immediate-early region 2 and evidence for a common initiation site within immediate-early region 1. J. Virol. 56, 665 – 675. Stenberg, R.M., Depto, A.S., Fortney, J., Nelson, J.A., 1989. Regulated expression of early and late RNAs and proteins from the human cytomegalovirus immediate-early gene region. J. Virol. 63, 2699 – 2708. Stenberg, R.M., Fortney, J., Barlow, S.W., Magrane, B.P., Nelson, J.A., Ghazal, P., 1990. Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains. J. Virol. 64, 1556 – 1565. Stinski, M.F., Thomsen, D.R., Stenberg, R.M., Goldstein, L.C., 1983. Organization and expression of the immediate early genes of human cytomegalovirus. J. Virol. 46, 1 – 14. Streblow, D.N., Orloff, S.L., Nelson, J.A., 2001. Do pathogens accelerate atherosclerosis? J. Nutr. 131, 2798S – 2804S. Thomsen, D.R., Stenberg, R.M., Goins, W.F., Stinski, M.F., 1984. Promoterregulatory region of the major immediate early gene of human cytomegalovirus. Proc. Natl. Acad. Sci. U.S.A. 81, 659 – 663. Wang, X., Huang, D.Y., Huong, S.M., Huang, E.S., 2005. Integrin avh3 is a coreceptor for human cytomegalovirus. Nat. Med. 11, 515 – 521.

I.B. DeMeritt et al. / Virology 346 (2006) 15 – 31 White, E.A., Clark, C.L., Sanchez, V., Spector, D.H., 2004. Small internal deletions in the human cytomegalovirus IE2 gene result in nonviable recombinant viruses with differential defects in viral gene expression. J. Virol. 78, 1817 – 1830. Wu, H.M., Chi, K.H., Lin, W.W., 2002. Proteasome inhibitors stimulate activator protein-1 pathway via reactive oxygen species production. FEBS Lett. 526, 101 – 105. Yin, M.J., Yamamoto, Y., Gaynor, R.B., 1998. The anti-inflammatory agents aspirin and salicylate inhibit the activity of InB kinase-h. Nature 396, 77 – 80. Yurochko, A.D., Huang, E.S., 1999. Human cytomegalovirus binding to human monocytes induces immunoregulatory gene expression. J. Immunol. 162, 4806 – 4816. Yurochko, A.D., Kowalik, T.F., Huong, S.M., Huang, E.S., 1995. Human

31

cytomegalovirus upregulates NF-nB activity by transactivating the NF-nB p105/p50 and p65 promoters. J. Virol. 69, 5391 – 5400. Yurochko, A.D., Hwang, E.S., Rasmussen, L., Keay, S., Pereira, L., Huang, E.S., 1997a. The human cytomegalovirus UL55 (gB) and UL75 (gH) glycoprotein ligands initiate the rapid activation of Sp1 and NF-nB during infection. J. Virol. 71, 5051 – 5059. Yurochko, A.D., Mayo, M.W., Poma, E.E., Baldwin Jr., A.S., Huang, E.S., 1997b. Induction of the transcription factor Sp1 during human cytomegalovirus infection mediates upregulation of the p65 and p105/p50 NF-nB promoters. J. Virol. 71, 4638 – 4648. Zhu, J., Quyyumi, A.A., Norman, J.E., Csako, G., Epstein, S.E., 1999. Cytomegalovirus in the pathogenesis of atherosclerosis: the role of inflammation as reflected by elevated C-reactive protein levels. J. Am. Coll. Cardiol. 34, 1738 – 1743.