Prolonged reversal of chronic experimental allergic encephalomyelitis using a small molecule inhibitor of α4 integrin

Journal of Neuroimmunology 131 (2002) 147 – 159 www.elsevier.com/locate/jneuroim

Prolonged reversal of chronic experimental allergic encephalomyelitis using a small molecule inhibitor of a4 integrin P.S. Piraino a, T.A. Yednock b, S.B. Freedman b, E.K. Messersmith b, M.A. Pleiss b, C. Vandevert b, E.D. Thorsett b, S.J. Karlik a,c,* a

Department of Physiology, London Health Sciences Center, University of Western Ontario, London, ON, Canada N6A 5C1 b Elan Pharmaceuticals Inc., South San Francisco, CA, USA c Department of Diagnostic Radiology and Nuclear Medicine, London Health Sciences Center, University of Western Ontario, London, ON, Canada N6A 5C1 Received 10 June 2002; received in revised form 2 August 2002; accepted 5 August 2002

Abstract CNS leukocytic invasion in experimental allergic encephalomyelitis (EAE) depends on a4h1 integrin/vascular cell adhesion molecule-1 (VCAM-1) interactions. A small molecule inhibitor of a4h1 integrin (CT301) was administered to guinea pigs in the chronic phase ( > d40) of EAE for 10, 20, 30 or 40 days. CT301 elicited a rapid, significant improvement in the clinical and pathological scores that was maintained throughout the treatment period. A progressive loss of cells in the spinal cord of treated animals confirmed the resolution of inflammation associated with clinical recovery. Therefore, prolonged inhibition of a4h1 integrin caused a sustained reversal of disease pathology in chronic EAE and may be similarly useful in MS. D 2002 Elsevier Science B.V. All rights reserved. Keywords: CNS; EAE; a4 Integrin; Multiple sclerosis; Peptide; Therapeutics

1. Introduction Experimental allergic encephalomyelitis (EAE) is an experimentally induced, cell-mediated, autoimmune inflammatory disorder of the central nervous system (CNS) that serves as an animal model of multiple sclerosis (MS). Infiltrates typically consist of lymphocytes and macrophages, although polymorphonuclear cells are occasionally observed (Traugott et al., 1985, 1986). EAE is actively induced in susceptible animals by injection with homogenized CNS antigens in complete Freund’s adjuvant (CFA). EAE can also be passively transferred by activated myelin-specific T cells from an actively immunized animal (Paterson, 1960). Susceptibility to disease depends not only on the inducing antigen and animal species used, but it is also affected by age, sex and

* Corresponding author. University Campus, London Health Sciences Center, University of Western Ontario, 339 Windermere Road, London, ON, Canada N6A 5A5. Tel.: +1-519-663-3648; fax: +1-519-663-3544. E-mail address: [email protected] (S.J. Karlik).

commercial source of the animals (Tsunoda and Fujinami, 1996). Just as in MS, clinical EAE can manifest in several different forms. In some models, animals develop an acute, monophasic illness followed by spontaneous recovery. In other models, however, animals will develop a chronicrelapsing disease, characterized by recurrent clinical attacks with intermittent periods of recovery (Tsunoda and Fujinami, 1996). A chronic-progressive form of EAE can be induced in adult Hartley guinea pigs by immunization with whole CNS in adjuvant (Wisniewski and Madrid, 1983; Karlik et al., 1986, 1993), in which the animals show progressive worsening of clinical symptoms without periods of recovery or remission. Histologically, large confluent plaques of demyelination accompany continuous mononuclear CNS infiltration. a4h1 integrin is a key adhesion molecule constitutively expressed on lymphocytes, monocytes, macrophages, mast cells basophils and eosinophils. It has multiple ligands, including fibronectin and other ECM components, vascular cell adhesion molecule-1 (VCAM-1), and it functions in homotypic binding to itself. Through interactions with

0165-5728/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 5 7 2 8 ( 0 2 ) 0 0 2 7 3 - 4

148

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

VCAM-1 on endothelial cells, it mediates leukocyte migration into tissues during inflammatory responses (Springer, 1995). Usually, VCAM-1 cannot be detected in normal CNS, but during inflammation, the level of VCAM-1 expression is elevated on cerebral vessels (Cannella and Raine, 1995; Engelhardt et al., 1998), and T cells express high levels of a4 integrin (Engelhardt et al., 1998). Surface expression of a4 integrin by CD4+ T cells is required for their entry into the brain parenchyma (Baron et al., 1993), and the ability of different T cell clones to induce EAE is dependent on a4 integrin expression (Kuchroo et al., 1993). In fact, a reduction in spinal cord inflammation in EAE was associated with a decrease in VCAM-1/a4h1 integrin expression (Selmaj et al, 1998). More recent in vitro observations suggest that VCAM1/a4h1 integrin interactions are not involved in transendothelial migration, but rather in the initial interactions and firm adhesion of T cells to the brain vascular endothelium (Laschinger and Engelhardt, 2000). Anti-adhesion therapies have been under investigation in EAE and MS for some time, and several groups have reported anti-a4h1 integrin as an effective disease therapy in EAE (Yednock et al., 1992; Baron et al., 1993; Soilu-Hanninen et al., 1997). Our laboratory has demonstrated prevention and reversal of chronic-progressive EAE with administration of an anti-a4 integrin antibody (Kent et al., 1995a,b; Keszthleyi et al., 1996). This data has been key in allowing AntegrenR, the humanized antibody (Leger et al., 1997), to enter Phase II clinical trials for the treatment of MS (Tubridy et al., 1999). In the guinea pig studies, however, we have been limited by an immune reaction against the humanized antibody (or its murine precursor) so that after 7 – 10 days of treatment, disease symptoms begin to reappear. This issue may also have complicated interpretation of other long-term studies with antibodies (Theien et al., 2001). To obviate this problem, we have used a small molecule inhibitor of a4h1 integrin, which was initially derived from the protein sequence of AntegrenR (Yednock et al., in preparation), to examine the effect of prolonged treatment on the clinical and histopathological deficits associated with chronic-progressive EAE.

2. Materials and methods

urinary incontinence, fecal impaction; 3—paralysis; 4— terminal paralysis. 2.2. Treatment regimes CT301 (Elan Pharmaceuticals, South San Francisco, CA) is a small molecule that binds with high affinity to human and guinea pig a4 integrin (IC50 for inhibition of cell adhesion to VCAM = 1 nm). Disease in animals was considered chronic by day 40 post-immunization, and thus the treatment period began at this time, and lasted for 10, 20, 30 or 40 days. Animals received either 0.5 ml saline (vehicle for CT301; n = 20) or 30 mg/kg CT301 (n = 25) twice a day. With the dosing regimen, receptor saturation levels of CT301 (>10 nm) were maintained at all times. One subgroup of animals received CT301 for 30 days, and then treatment was withdrawn and the animals were maintained for an additional 10 days (n = 5). All treatments were administered subcutaneously. 2.3. Animal sacrifice and histological analysis Untreated, chronic EAE animals (n = 5) were sacrificed on day 40, as well as non-EAE controls (n = 5). Following each 10-day treatment interval, five animals from each group were sacrificed (0.25 ml sodium pentobarbital), blood samples were collected for FACS analysis (see below), and the brain Table 1 Pathological scoring scale M: Inflammatory reaction in the meninges 0: no changes 1: perivascular and/or meningeal infiltration by mononuclear cells, 1 – 3 vessels involved 2: 4 – 6 vessels involved 3: 6+ vessels involved 4: dense infiltration of meninges with nearly all or all blood vessels involved P: Parenchymal perivascular infiltration 0: no changes 1: 1 – 3 parenchymal vessels infiltrated in Virchow – Robin spaces 2: 4 – 6 vessels involved 3: 6+ vessels involved 4: virtually all or all vessels involved

2.1. Animals and induction of EAE Female Hartley guinea pigs (Charles River Canada, St. Constant, Quebec) were maintained in a controlled light environment and allowed food and water ad libitum. EAE was induced in 50 animals (200 –250 g) via nuchal intradermal injection of 0.6 ml of a 1:1 mixture of homogenized, isologous CNS tissue and complete Freund’s adjuvant, with an additional 10 mg/ml of Mycobacterium tuberculosis (Difco). Animals were assessed daily by a blinded observer using a four-point clinical scale as follows: 0—no abnormality; 0.5—more than one consecutive day of weight loss; 1—ataxia and poor righting reflex; 2—hind limb paresis,

E: Encephalitis or myelitis 0: no invasion of the neural parenchyma; microglial or inflammatory cells invading neural parenchyma 1: a few scattered cells 2: invasion by cells from several perivascular cuffs 3: large areas of neural parenchyma involved 4: virtually the entire section is infiltrated D: Demyelination, remyelination and myelin debris 0: no demyelination 1: single focus of subpial demyelination or myelin debris 2: several small foci of demyelination 3: one large confluent area of demyelination 4: several large confluent areas of demyelination

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

149

and spinal cord dissected and sectioned. Three spinal sections were used, corresponding to lumbar, thoracic and cervical regions of the cord. The brain was cut into five transverse sections; the first three proximal sections were combined in one block, and the last two distal sections in another. Tissues were fixed in 10% formalin and embedded in paraffin. Fivemicrometer sections were stained with hematoxylin – eosin (H – E) or solochrome-R-cyanin (SCR) and evaluated by a blinded observer in each of four categories: meningeal inflammation, perivascular infiltration, encephalitis or myelitis and demyelination (Table 1). The combined pathological score represents the total score (out of a potential 20) from all five CNS sections in each animal. To quantify the abnormalities observed in the spinal cord, sections stained with H – E were divided into 12 representative pie-shaped areas. In each area, the number of cells within a 0.12-mm2 field of view was counted using Sigma Scan Pro image analysis software (SPSS), and the combined mean number of cells in all 12 areas was calculated for the whole spinal cord (36 fields of view per animal). Note that as all cell nuclei were counted, the number of cells may include neurons and glial cells in addition to infiltrates. Hence, the cell count in non-EAE animals served as a baseline. 2.4. Quantitative RT-PCR: IL-2, IL-10 and MCP-1 RNA was isolated from 30 mg of frozen guinea pig spinal cord using the S.N.A.P. Total RNA Isolation Kit (Invitrogen) according to manufacturer’s instructions, modi-

Table 2 Inflammatory gene analysis Gene

Primer/probe and standard RNA

Optimal concentration (nM)

IL-2

Forward primer: CTGATCAC AAAAACTTTCCCTTGA Reverse primer: GCTGTTTCG GATCCCTTTAGG Probe: ACACACCAA GGATTTCATCAGTAATAT CAATGTAACAGTT Standard RNA: GP spinal cord RNA 140 ng/Al and 1:3 dilutions Forward primer: GCCCCACAT GCTTCGAGA Reverse primer: GATCCTGTGTTT GGAAGAAAGTCTTC Probe: CCCTGCCAAAGGCAGCTCGGA Standard RNA: GP spleen RNA 2.85 ng/Al and 1:3 dilutions Forward primer: TTGCCAAACT GGACCAGAGAA Reverse primer: CGAATGTTC AAAGGCTTTGAAGT Probe: CCAGCAGAAACAG AACTCAACTGCACCTC Standard RNA: GP spleen RNA 11.4 ng/Al and 1:3 dilutions

900

IL-10

MCP-1

900 100

300 300 100

900 900 100

Fig. 1. (A) Prolonged reversal of chronic EAE during CT301 treatment. EAE was induced in female Hartley guinea pigs via nuchal intradermal injection of 0.6 ml of a 1:1 mixture of homogenized isologous CNS tissue and CFA, with 10 mg/ml of inactivated M. tuberculosis. Beginning on day 40 post-immunization, animals received either saline (n = 20, 0.5 ml/day) or CT301 (n = 25, 30 mg/kg, 2  /day) for 10, 20, 30 or 40 days. Over the course of the treatment period, the mean clinical score of animals treated with CT301 was significantly lower than that of the saline control group ( p < 0.001, Mann – Whitney rank sum test). Furthermore, there were no adverse side effects observed during prolonged CT301 administration, and no escape from treatment as has been previously observed with antibodies. The mean clinical score of each subgroup of animals at the time of sacrifice is indicated in brackets; the scores for saline-treated animals are above the graph, while CT301-treated scores are below. (B) Return to clinically active disease following removal of CT301. After 30 days of treatment with CT301, five animals were maintained for an additional 10 days without small molecule administration. Once CT301 was withdrawn, animals returned to clinical progression of disease. Between day 70 and day 80, the mean clinical score of post-CT301 animals was significantly higher than that of animals receiving CT301 throughout the treatment period ( p < 0.05, Mann – Whitney rank sum test). The mean clinical score of each subgroup of animals at the time of sacrifice is indicated in brackets beside the graph.

fied to include a second DNAse treatment step followed by an additional purification over the S.N.A.P. column. By adding the second DNAse treatment, we have found that DNA contamination is consistently undetectable for these samples and assays as measured using a reverse-transcriptase negative control RT-PCR assay. Primer/probe sequences and concentrations for IL-2, IL10 and MCP-1 are given in Table 2, as well as the standard

150

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

Fig. 2. Pathological recovery during prolonged CT301 treatment. Panels A, C, E, G, I and K were solochrome-R-cyanin (SCR)-stained spinal cord sections (magnification 40  ). Panels B, D, F, H, J and L show high magnification (250  ) of hematoxylin – eosin (H – E)-stained sections taken from the dorsal medial region of the corresponding SCR-stained photo. (A) This section taken from a normal guinea pig shows neither inflammation nor demyelination, as does panel B, the corresponding H – E section. (C) By day 40 post-immunization, an animal that had received no treatment showed extensive meningeal inflammation and a large dorso-medial plaque of demyelination. The density of infiltrating cells (D) in this area was much higher than in B. Even later in disease, at day 60 postimmunization, a saline-treated animal showed a large subpial area of demyelination (E), with a very high density of cellular infiltrates (F). In contrast, an animal that received 20 days of CT301 treatment had a much smaller area of demyelination (G), and a much lower density of cellular infiltration within the lesion area (H). The animal represented in (I) received 40 days of saline treatment. Virtually the entire section was infiltrated and demyelinated, including invasion of some areas of gray matter. While the cellular infiltration in (J) was reduced from day 60 post-immunization (F), it was still much higher than normal levels seen in B. After 40 days of CT301 treatment, however, there was almost no meningeal and perivascular inflammation, and the myelin was apparently intact (K). The cellular infiltration (L) was practically the same as in a normal animal (B).

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

151

Fig. 2 (continued).

RNA used for each gene. RT-PCR was carried out in triplicate using the ABI PRISMR 7700 Sequence Detection System. Fifty-microliter reactions contained 10 to 800 ng of total RNA and primers and probes at the concentrations indicated above in reaction buffer consisting of 6.67% glycerol (Amresco); 5.5 mM MgCl2; 300 AM dATP, dCTP, dGTP and dUTP; 100 nM probe; 1.25 U of AmpliTaq GoldR DNA Polymerase (Applied Biosystems); 1  TaqMan Buffer A

(TaqManR PCR Core reagents kit, Applied Biosystems), 20 U of RNase Inhibitor (Roche); 1.25 U of MuLV Reverse Transcriptase (Applied Biosystems). Reverse-transcription of RNA was carried out at 48 jC for 30 min, followed by a 10min denaturing step at 95 jC. PCR was carried out by 40 thermo-cycles consisting of 95 jC for 15 s followed by 60 jC for 1 min. Each plate included a standard curve using the standard RNA listed in Table 2 and two additional control

152

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

samples: (1) a positive control RNA sample used on all plates; (2) non-template control (NTC). The correlation coefficients of the standard curves were greater than 0.990 for all data shown. The coefficients of variation for sample triplicates were less than 0.2. Since the RNA used for the standard curve is a heterogeneous mix of RNA containing a constant but unknown amount of the target message, the numbers calculated are relative.

2.5. FACS analysis On day 80 post-immunization, heparinized blood samples were collected from non-EAE animals, saline-treated animals, CT301-treated animals and animals 10 days following withdrawal of CT301. All samples were maintained at 4 jC for all procedures. Samples (150 Al) were exposed to primary antibody for 30 min, washed twice, and then incubated with PE-conjugated goat anti-mouse

Fig. 3. Reduced pathological abnormality in chronic EAE during CT301 treatment. Animals received either saline (n = 20) or CT301 (n = 25) for 10, 20, 30 or 40 days. Additionally, a subgroup of animals received CT301 for 30 days, and then treatment was withdrawn for the remaining 10 days of the experiment (PostCT301 group). Following sacrifice, the brain and spinal cord were fixed in formalin and embedded in paraffin. Five-micrometer sections were stained with hematoxylin – eosin or solochrome-R-cyanin, and blindly assigned a four-digit pathological score based on evaluation in each of four categories: meningeal inflammation, perivascular infiltration, encephalitis and demyelination. Note that non-EAE animals would have a score of 0 in all categories. Over the course of the treatment period, animals that received CT301 showed a significant decrease in the mean pathological score in each of the four categories with respect to saline-treated animals ( p < 0.001, two-way ANOVA). When CT301 was removed and animals were maintained for an additional 10 days without treatment, the mean combined pathological score in all four categories returned to significantly higher than animals that continued to receive the small molecule ( p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test).

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

IgG Fc in the presence of 5% guinea pig serum (Beckman Coulter #PN IM0551). Red blood cells were lysed with Becton-Dickinson lysing solution and the samples were examined on a FACScan flow cytometer (Becton Dickinson, Mountain View, CA), gating on different cell populations by light scatter. The hybridoma secreting IB4, against human and guinea pig h2 integrin, was obtained from the ATCC (HB-10164) and used for production of ascites. The antibody was purified by ammonium sulfate precipitation and FPLC. The antibody AN100226m, against human and guinea pig a4 integrin, has been previously described (Kent et al., 1995a). Control murine IgG1 was obtained from Sigma. 2.6. Statistical analysis Statistical analysis was performed using SigmaStat v2 software (SPSS). Clinical scores were assessed using the Mann –Whitney rank sum test, while pathological scores were assessed with a two-way ANOVA. Quantitative abnormalities were compared using Kruskal – Wallis ANOVA on ranks. In each case, p < 0.05 was considered significant. A linear regression was performed on the mean cell counts in the spinal cord.

3. Results

153

as we have observed previously with antibodies to a4 integrin, where the animal stops responding to the therapy altogether due to guinea pig rejection of the murine or humanized antibody. There were no ancillary problems, (such as injection site inflammation), with treatment of animals for extended periods of time with CT301. In one subgroup of animals, CT301 was administered for 30 days and then removed, and the animals were maintained on saline injections for the final 10 days of the experiment. Once CT301 was withdrawn, clinical progression returned, similar to the clinical course of animals that received saline for the duration of the treatment period (Fig. 1B). Between day 70 and day 80 post-immunization, the mean clinical score of post-CT301-treated animals was significantly greater than that of animals which received CT301 throughout the treatment period ( p < 0.05, Mann – Whitney rank sum test). In summary, CT301 was successfully administered for up to 40 days without any adverse side effects, and it maintained a reversal of the clinical deficits associated with chronic-progressive EAE. 3.2. Reversal of pathological abnormalities Pathological abnormalities were evaluated on H –E- and SCR-stained brain and spinal sections. In Fig. 2, panels on the left are SCR-stained sections, which stains myelin blue (  40). Panels on the right are high magnification (  250)

3.1. Clinical reversal Animals began to show clinical signs of disease on day 9 post-immunization and continued through to day 40. At this point, the disease was considered to be chronic. The treatment period began on day 40 and lasted a minimum of 10 days, to a maximum of 40 days. While animals that received saline showed a continued clinical progression until the end of the experiment, animals treated with CT301 began to show a clinical reversal commencing 2– 3 days following the initial treatment (Fig. 1A). In several animals that had an established clinical score of 2 before treatment began, CT301 reversed the paresis, and the animals were able to use their hind limbs throughout the treatment period (i.e. reversion to a clinical score of 1). Depending on the duration of treatment, some animals that had previously shown signs of disease appeared completely disease-free while receiving CT301. Over the course of the treatment period, the mean clinical scores of CT301-treated animals were significantly lower than that of saline-treated animals ( p < 0.001, Mann – Whitney rank sum test). Although there was a progressive decrease in clinical signs in the CT301-treated group, there was a small transient increase centered on day 54 post-immunization (Fig. 1A). Two animals showed a moderate fluctuation in the degree of clinical symptoms; they wavered from a complete absence of clinical signs (score of 0) to a very slight ataxia (score of 1). None of the animals, however, escaped from treatment,

Fig. 4. Reduced spinal cord infiltration with CT301 treatment. The mean number of infiltrating cells was counted in representative areas from 12 pie-shaped areas covering the whole spinal cord (see Materials and methods). A significant increase in cellular infiltration occurred with the induction of EAE compared to non-EAE animals (d, p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test). CT301-treated animals had fewer cells in the spinal cord than saline-treated animals following 10, 20, 30 or 40 days of therapy (*, p < 0.001, two-way ANOVA). Furthermore, animals treated for 20, 30 or 40 days with CT301 had significantly lower cell counts than control (d40) EAE animals ( p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test). After removal of CT301, the mean cell count in animals maintained for an additional 10 days without the small molecule was significantly increased compared to animals that received continuous CT301 treatment (#, p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test).

154

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

H – E-stained sections taken from the dorsal medial region of the corresponding SCR photo (Fig. 2). The sections shown in panels A and B were taken from a normal guinea pig, and show neither inflammation nor demyelination. By day 40 post-immunization, chronic animals had extensive meningeal and perivascular inflammation, as well as one or more large subpial plaques of demyelination (Fig. 2C). The density of infiltrating cells was markedly increased (Fig. 2D). The observed pathological abnormalities became more extreme as the disease progressed. At day 60 post-immunization, control animals that received 20 days of saline treatment had severe meningeal infiltration, large areas of myelitis and focal demyelination (Fig. 2E,F), and by day 80 post-immunization, virtually the entire spinal sections were infiltrated and demyelinated, including invasion of some areas of gray matter (Fig. 2I,J). In contrast, animals that received 20 days of CT301 treatment had much smaller areas of demyelination at day 60 post-immunization, and there was a paucity of meningeal and perivascular cell invasion (Fig. 2G,H). After 40 days of CT301 treatment, the pathological recovery was greater still; animals showed almost no meningeal and perivascular infiltration, and the myelin remained intact (Fig. 2K,L). A total of five blocks from each animal were scored by a blinded observer, and the combined pathological score represents the total score from all five sections in each of the four categories (meningeal inflammation, perivascular infiltration, myelitis and demyelination; Fig. 3). Over the

course of the treatment period, animals that received CT301 showed a significant decrease in mean pathological score in all four categories with respect to saline-treated animals ( p < 0.001, two-way ANOVA). When CT301 was removed, and animals were maintained for an additional 10 days without treatment, the mean combined pathological score in all four categories was significantly higher than animals that continued to receive the small molecule for the duration of the treatment period (Fig. 3; p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test). 3.3. Quantitation of pathological abnormalities The pathological reversal scored qualitatively above was quantitatively confirmed in the spinal cord. The mean number of cells was calculated from 12 representative 0.12-mm2 areas on H –E-stained sections of lumbar, thoracic and cervical cord, and combined to examine the whole spinal cord (Fig. 4). All untreated EAE animals had significantly higher cell counts than non-EAE animals, indicating that cellular infiltration increased during disease, as expected ( p < 0.001, two-way ANOVA). A significant reduction in cell number was observed after as little as 10 days of CT301 treatment, and was maintained through 20, 30 and 40 days of treatment with respect to saline-treated animals ( p < 0.001, two-way ANOVA). Furthermore, the mean cell counts of animals treated for 20, 30 or 40 days with CT301 were significantly lower than that of chronic

Fig. 5. Reduced expression of inflammatory cytokines with CT301 treatment. A piece of lumbar spinal cord was snap frozen in liquid nitrogen and routinely processed to extract RNA for quantitative PCR analysis. While negligible cytokine RNA levels were detected in non-EAE animals, expression of IL-2, IL-10 and MCP-1 were elevated in d40 control animals with CNS inflammation. While saline-treated animals had increased inflammatory cytokine levels throughout the duration of the experiment, animals receiving CT301 showed a marked decrease in their expression, coincident with clinical and pathological recovery. Upon removal of CT301 and reinfiltration of the CNS, expression of IL-2, IL-10 and MCP-1 again rose to levels comparable to those in saline-treated animals. Cytokine levels are expressed per picogram of total RNA.

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

control animals ( p < 0.05, Kruskal – Wallis ANOVA on ranks with SNK test), and after 40 days of CT301 treatment, the mean cell count in the spinal cord was not different than that of non-EAE animals. A linear regression of these means demonstrates a progressive loss of inflammatory cells in the spinal cord (r2 = 0.90). From the slope of this line, we can calculate a rate of cell loss of 8 cells/mm2/day. After removal of CT301, in animals that were maintained on

155

saline for an additional 10 days, a significant increase in the mean number of cells was again observed ( p < 0.05, ANOVA on ranks with SNK test). 3.4. Quantitative PCR Quantitative PCR was performed on lumbar sections of spinal cord to assess levels of IL-2, IL-10 and MCP-1, and the results compliment the pathological reversal already discussed. In saline-treated animals, the amount of IL-2 increased through the chronic phase of disease. In contrast, animals receiving CT301 had almost no detectable IL-2 RNA. Following the withdrawal of CT301, the amount of IL-2 in the spinal cord returned to levels comparable to saline-treated animals. Similar results were seen regarding IL-10 and MCP-1. A significant reduction in cytokine RNA levels was evident during treatment, followed by a return to high levels after removal of the inhibitor (Fig. 5). 3.5. FACS analysis As determined by FACS analysis, treatment of EAE animals with CT301 caused a large increase in the percentage of a4 integrin-bright lymphocytes in the circulation, compared to saline-treated animals. These results suggest that lymphocytes activated by peripheral immunization were unable to enter the CNS in the presence of CT301, and accumulated in the circulation (Fig. 6A). Consistent with this suggestion, the percentage of a4 integrin-bright lymphocytes in the circulation returned to saline-treated levels when CT301 was removed and CNS inflammation returned (Fig. 6A). There were no discernable subpopulations of a4 integrin low and high monocytes (not shown); however, the general expression of a4 integrin on circulating monocytes increased in EAE animals (Fig. 6B). This increase was not affected by CT301, further suggesting that the peripheral immune reaction was not inhibited by the treatment.

4. Discussion

Fig. 6. Expression of a4 integrin on lymphocytes and monocytes in the circulation at day 80 post-immunization. Heparinized blood samples were collected from all groups of animals on day 80 post-immunization, exposed to antibody against a4 integrin, and sorted by flow cytometry. (A) Treatment with CT301 caused a large increase in the percentage of a4 integrin-bright lymphocytes in the circulation compared to non-EAE and saline-treated animals, suggesting that activated peripheral lymphocytes were unable to enter the CNS in the presence of the inhibitor. Consistent with this idea, the percentage of these cells in the circulation returned to saline-treated levels when CT301 was removed and CNS inflammation returned. (B) The general expression of a4 integrin on circulating monocytes was increased in all EAE animals, although there were no discernable subpopulations. This monocytic increase in a4 integrin expression was not affected by CT301, suggesting that the inhibitor did not affect the peripheral immune reaction.

The importance of a4 integrin in neuroinflammation is well established (Yednock et al., 1992; Baron et al., 1993; Kuchroo et al., 1993; Engelhardt et al., 1998), where it appears to be involved in the initial contact of lymphocytes with blood – brain barrier endothelial cells, rather than in transendothelial migration (Laschinger and Engelhardt, 2000). The data presented herein demonstrate prolonged reversal of the clinical deficits associated with chronic EAE following administration of a small molecule that interferes with a4 integrin binding (Fig. 1). Anti-a4h1 antibodies have been reported to be effective in the treatment of EAE (Yednock et al., 1992; Baron et al., 1993; Kent et al., 1995a,b; Keszthleyi et al., 1996; Soilu-Hanninen et al., 1997; Brocke et al., 1999), but this is the first study demonstrating the efficacy of a small molecule. Further-

156

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

more, while antibody treatments are rendered ineffective within 7 – 10 days due to rejection of the murine or human antibodies by the guinea pig, CT301 was administered herein for up to 40 days without evidence of escape from treatment. This inherent lack of immunogenicity is due to the structure of the inhibitor itself. CT301 does not crosslink a4h1 integrin and exert any costimulatory functions. The current study also demonstrates that the clinical recovery observed with CT301 treatment is accompanied by a resolution of inflammation within the CNS (Figs. 2– 4). Evidence of pathological abnormalities in the CNS were significantly reduced after as little as 10 days of CT301 treatment, and these reductions were maintained throughout the duration of small molecule treatment (Figs. 2 and 3). Agents that block a4h1 integrin have proven effective in a number of other inflammatory animal models, including adjuvant-induced arthritis (Seiffge, 1996), allergic airways inflammation (Pretolani et al., 1994; Rabb et al., 1994; Nakajima et al., 1994; Abraham et al., 1994; Laberge et al., 1995; Das et al., 1995; Milne and Piper, 1995; Chin et al., 1997; Fryer et al., 1997; Wang et al., 2000), graft rejection (Isobe et al., 1994; Yang et al., 1995), nephritis (Molina et al., 1994; Wu et al., 1996; Allen et al., 1999), autoimmune diabetes (Yang et al., 1994; Baron et al., 1994), ulcerative colitis (Podolsky et al., 1993) and cerebral ischemia (Relton et al., 2001). Based on the established importance of a4h1 integrin and the efficacy of antibodies against this receptor in the treatment of inflammatory disease, several advances have been made toward small molecule a4h1 integrin antagonists (Molossi et al., 1995; Abraham et al., 1997, 2000; Chen et al., 1998; Lin and Castro, 1998; Lin et al., 1999). The present study represents the first use of a small molecule antagonist of a4h1 integrin in the treatment of EAE. Few studies have attempted long-term reversal of established chronic EAE. Transforming growth factor-h2 significantly reduced the clinical and pathological signs of chronic-relapsing EAE when administered for 2 months following the first clinical episode (Racke et al., 1993). Oral administration of bovine myelin in SJL/J mice for 6 months suppressed inflammatory and demyelinating foci in the CNS with no clinical exacerbation of disease (al-Sabbagh et al., 1996). Antibodies against MAdCAM-1 caused a gradual remission of disease when given 8 –12 days following onset of paralysis in MOG-induced EAE in C57BL/6 mice, and no clinical symptoms were apparent 50 days after suspension of antibody treatment. In this study, however, as disease became more established, it became more refractory to anti-MAdCAM-1 treatment (Kanwar et al., 2000). Most recently, Theien et al. (2001) were unable to successfully treat relapsing EAE with antibodies to a4h1 integrin when treatment was administered at the peak of acute disease or during remission; in fact, the antibodies exacerbated chronic disease. In the current study, treatment was withheld until day 40 post-immunization, when the CNS is chronically inflamed and the disease is well established, and clinical and pathological recovery still ensued.

Apoptosis has been suggested as a mechanism for termination of an immune response, and the resolution of inflammation in both acute- and chronic-relapsing EAE is a consequence of this deletion of infiltrating cells. T cell and (to a lesser extent) macrophage apoptosis has been demonstrated in both acute- and chronic-relapsing models of EAE in rats and mice (Pender et al., 1991; Schmied et al., 1993; Zeine and Owens, 1993; Nguyen et al., 1994, 1997; Smith et al., 1996; Gordon et al., 2001). Our lab has previously shown the presence of apoptotic cells in the CNS throughout chronic-progressive EAE of the guinea pig in the absence of clinical recovery. Similarly, apoptotic cells were observed in the CNS during anti-a4 integrin-mediated recovery from both acute and chronic diseases. These findings imply that a continual influx of inflammatory cells is required to maintain disease activity, and that the recovery from EAE is due to the cessation of the influx of new inflammatory cells required to replace those undergoing apoptosis (Hyduk and Karlik, 1998). While we did not stain for apoptotic nuclei in the current study, the data support our previous hypothesis, insofar as we observed a progressive loss of cells (8 cells/mm2/day) within the CNS during CT301 administration (Fig. 4). In accord with our hypothesis is data suggesting that each relapse in chronic-relapsing EAE is not due to the reactivation of cells that had entered at an earlier time in the disease course, but rather due to a fresh influx of inflammatory cells (Zeine and Owens, 1993). Therefore, the recovery and protection conferred by CT301 was due to its ability to block the migration and accumulation of inflammatory cells within the CNS. The return of both the clinical and pathological symptoms of disease following the withdrawal of CT301 has several implications. It supports our contention that anti-a4 integrin-mediated inhibition of disease is via prevention of the influx of new inflammatory cells, as opposed to alteration or suppression of the immune response. The data from FACS analysis of blood samples demonstrated high levels of a4 integrin-bright lymphocytes in the circulation of animals receiving CT301 (Fig. 6), coincident with the lowered cell counts in the spinal cord (Fig. 4). Following CT301 withdrawal, the levels of a4 integrin-bright lymphocytes in the circulation decreased, coincident with the return to high cell counts in the spinal cord. Thus, it is clear that CT301 is not acting by depleting the peripheral lymphocyte pool or preventing an immune response, such as may occur with general immunosuppression. While there was an increase in the level of a4 integrin expression on monocytes in the circulation with the induction of EAE, there was no change with CT301 treatment. These results suggest that the immunization protocol used to induce EAE resulted in an upregulation of a4 integrin on monocytes, and that CT301 did not affect this response. The rapid return of disease following CT301 removal may reflect this ongoing immune reaction in the periphery driven by the depot of CNS homogenate and adjuvant in the skin. Memory T cells express high levels of a4 integrin (Picker et al., 1990;

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

Shimizu et al., 1990; Laffon et al., 1991), and as they are generated in the periphery, CT301 appeared to prevent their migration into the CNS and allowed their accumulation in the circulation (Figs. 5 and 6). Thus, when CT301 was removed, the memory cells were free to enter the CNS and reinitiate disease. While we have no evidence of more severe disease following CT301 withdrawal, in order to determine whether a rebound effect occurs, it would be necessary to monitor the animals for longer periods of time following cessation of CT301 treatment. Presumably though, in MS and other autoimmune disorders, this phenomenon would not occur since immune cell activation and memory cell production is likely to occur within the brain or other target organ. The level of IL-2, IL-10 and MCP-1 expression decreased in the CNS of treated animals, and subsequently returned to disease levels following removal of CT301 (Fig. 5), coincident with the reinfiltration of the CNS (Figs. 2 – 4). IL-2 is secreted by CD4+ T cells and stimulates T cell proliferation and differentiation, as well as B cell activation (Minami et al., 1993). Levels of IL-2 mRNA are significantly upregulated in the brain and in T cells from the cerebrospinal fluid during EAE in SJL/J mice (Renno et al., 1994). IL-10 is produced by T cells and macrophages (Moore et al., 1993). Its expression in EAE has been correlated with recovery (Kennedy et al., 1992), but in one study, administration of exogenous IL-10 in an attempt to abrogate disease failed; in fact, IL-10 was found to elicit a worsening of symptoms or to have no effect (Cannella et al., 1996). The decreased levels of IL-10 in this study likely reflect the fact that the inflammation within the CNS was eliminated. MCP-1 is secreted mainly by monocytes and macrophages, as well as by endothelial cells. It is a chemoattractant and activator of macrophages (Miller and Krangel, 1992) and its expression has been demonstrated during EAE (Hulkower et al., 1993; Ransohoff et al., 1993). Therefore, the inflammatory potential of the effector cells appears unaltered by CT301, since upon compound withdrawal, they are able to reinfiltrate the CNS, secrete cytokines and degrade myelin (Figs. 2 and 5). Furthermore, the unaltered expression of a4 integrin on monocytes (Fig. 6B) indicates that the inflammatory stimuli continue in the presence of CT301. We have shown evidence for the prevention of inflammatory cell entry into the CNS by CT301 as a mechanism for recovery from chronic-progressive EAE. The ability of this small molecule to maintain this blockade for as long as 40 days may allow for the complete resolution of inflammation; indeed, the mean cell count in the spinal cord after 40 days of CT301 treatment was not different than that of non-EAE animals (Fig. 4). It is therefore possible that a sustained inhibition of disease activity may be permissive for endogenous reparative mechanisms. Extensive remyelination does occur within MS lesions (Prineas and McDonald, 1997), and extensive spontaneous remyelination has been described in several model systems of CNS demyeli-

157

nation, including Theiler’s murine encephalomyelitis virus (TMEV)-induced demyelination (Dal Canto and Barbano, 1984) and in a chronic-relapsing model of EAE (Raine and Traugott, 1985). Furthermore, therapeutically induced remyelination has been observed following administration of certain immunosuppressive agents in the TMEV model (Rodriguez and Lindsley, 1992). Since elimination of inflammatory infiltrates in the CNS under the influence of long-term CT301 therapy may achieve an end result similar to that of immunosuppression, it is possible that we may be setting the stage for CNS repair. Ultimately, the ideal treatment of MS would not only stop the inflammatory response, but would also allow the regrowth of myelin. References Abraham, W.M., Sielczak, M.W., Ahmed, A., Cortes, A., Lauredo, I.T., Pepinsky, R.B., Benjamin, C.D., Leone, D.R., Lobb, R.R., et al., 1994. a4 Integrins mediate antigen-induced late bronchial responses and prolonged airway hyperresponsiveness in sheep. J. Clin. Invest. 93, 776 – 787. Abraham, W.M., Ahmed, A., Sielczak, M.W., Narita, M., Arrhenius, T., Elices, M.J., 1997. Blockade of late-phase-airway responses and airway hyperresponsiveness in allergic sheep with a small molecule peptide inhibitor of VLA-4. Am. J. Respir. Crit. Care Med. 156, 696 – 703. Abraham, W.M., Gill, A., Ahmed, A., Sielczak, M.W., Lauredo, I.T., Botinnikova, Y., Lin, K., Pepinsky, R.B., Leone, D.R., Lobb, R.R., et al., 2000. A small molecule, tight-binding inhibitor of the integrin a4h1 blocks antigen-induced airway responses and inflammation in experimental asthma in sheep. Am. J. Respir. Crit. Care Med. 162, 603 – 611. Allen, A.R., McHale, J., Smith, J., Cook, H.T., Karkar, A., Haskard, D.O., Lobb, R.R., Pusey, C.D., 1999. Endothelial expression of VCAM-1 in experimental crescentic nephritis and effect of antibodies to very late antigen-4 or VCAM-1 on glomerular injury. J. Immunol. 162, 5519 – 5527. al-Sabbagh, A.M., Goad, E.P., Weiner, H.L., Nelson, P.A., 1996. Decreased CNS inflammation and absence of clinical exacerbation of disease after six months oral administration of bovine myelin in diseased SJL/J mice with chronic relapsing experimental autoimmune encephalomyelitis. J. Neurosci. Res. 45 (4), 424 – 429. Baron, J.L., Madri, J.A., Ruddle, N.H., Hashim, G., Janeway, C.A.J., 1993. Surface expression of a4 integrin by CD4 T cells is required for their entry into brain parenchyma. J. Exp. Med. 177, 57 – 68. Baron, J.L., Reich, E.P., Visintin, I., Janeway, C.A.J., 1994. The pathogenesis of adoptive murine autoimmune diabetes requires an interaction between a4 integrins and vascular cell adhesion molecule-1. J. Clin. Invest. 93, 1700 – 1708. Brocke, S., Piercy, C., Steinman, L., Weissman, I.L., Veromaa, T., 1999. Antibodies to CD44 and integrin a4, but not L-selectin, prevent central nervous system inflammation and experimental encephalomyelitis by blocking secondary leukocyte recruitment. PNAS 96 (12), 6896 – 6901. Cannella, B., Raine, C.S., 1995. The adhesion molecule and cytokine profile of multiple sclerosis lesions. Ann. Neurol. 37, 424 – 435. Cannella, B., Gao, Y., Brosnan, C.F., Raine, C.S., 1996. IL-10 fails to abrogate experimental autoimmune encephalomyelitis. J. Neurosci. Res. 45 (6), 735 – 746. Chen, L.L., Lobb, R.R., Cuervo, J.H., Lin, K., Adams, S.P., Pepinsky, R.B., 1998. Identification of ligand binding sites on integrin a4h1 through chemical cross-linking. Biochemistry 37, 8743 – 8753. Chin, J., Hatfield, C., Winterrwod, G., Brashler, J.R., Vonderfecht, S.L., Fidler, S.F., Griffin, R.L., Kolbasa, K.P., Krzesicki, R.F., Sly, L.M., et al., 1997. Airway recruitment of leukocytes in mice in dependent

158

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159

on alpha-4 integrins and vascular cell adhesion molecule-1. Am. J. Physiol. 272, L219 – L229. Dal Canto, M.C., Barbano, R.L., 1984. Remyelination during remission in Theiler’s virus infection. Am. J. Pathol. 116, 30 – 45. Das, A.M., Williams, T.J., Lobb, R.R., Nourshaugh, S., 1995. Lung eosinophilia is dependent on IL-5 and the adhesion molecules CD18 and VLA-4, in a guinea pig model. Immunology 84, 41 – 46. Engelhardt, B., Martin-Simonet, M.T.G, Rott, L.J., Butcher, E.C., Michie, S.A., 1998. Adhesion molecule phenotype of T lymphocytes in inflamed CNS. J. Neuroimmunol. 84, 92 – 104. Fryer, A.D., Costello, R.W., Yost, B.L., Lobb, R.R., Tedder, T.F., Steeber, D.A., Bochner, B.S., 1997. Antibody to VLA-4, but not to L-selectin, protects neuronal M2 muscarinic receptors in antigen-challenged guinea pig airways. J. Clin. Invest. 99, 2036 – 2044. Gordon, F.L., Nguyen, K.B., White, C.A., Pender, M.P., 2001. Rapid entry and downregulation of T cells in the central nervous system during the reinduction of experimental autoimmune encephalomyelitis. J. Neuroimmunol. 112, 15 – 27. Hulkower, K., Brosnan, C.F., Aquino, D.A., Cammer, W., Kulshrestha, S., Guida, M.P., Rapoport, D.A., Berman, J.W., 1993. Expression of CSF-1, c-fms, and MCP-1 in the central nervous system of rats with experimental allergic encephalomyelitis. J. Immunol. 150 (6), 2525 – 2533. Hyduk, S.J., Karlik, S.J., 1998. Apoptotic cells are present in the CNS throughout acute and chronic progressive EAE in the absence of clinical recovery. J. Neuropathol. Exp. Neurol. 57 (6), 602 – 614. Isobe, M., Suzuki, J., Yagita, H., Okumura, K., Yamazaki, S., Nagai, R., Yazaki, Y., Sekiguchi, M., 1994. Immunosuppression to cardiac allografts and soluble antigens by anti-vascular cellular adhesion molecule1 and anti-very late antigen-4 monoclonal antibodies. J. Immunol. 153, 5810 – 5818. Kanwar, J.R., Kanwar, R.K., Wang, D., Krissansen, G.W., 2000. Prevention of a chronic progressive form of experimental autoimmune encephalomyelitis by an antibody against mucosal addressin cell adhesion molecule-1, given early in the course of disease progression. Immunol. Cell Biol. 78 (6), 641 – 645. Karlik, S.J., Strejan, G., Gilbert, J.J., Noseworthy, J.H., 1986. NMR studies in experimental allergic encephalomyelitis (EAE): normalization of T1 and T2 with parenchymal cellular infiltration. Neurology 36, 1112 – 1114. Karlik, S.J., Grant, E.A., Lee, D.H., Noseworthy, J.H., 1993. Gadolinium enhancement in acute and chronic progressive experimental allergic encephalomyelitis in the guinea pig. Magn. Reson. Med. 30, 326 – 331. Kennedy, M.K., Torrance, D.S., Picha, K.S., Mohler, K.M., 1992. Analysis of cytokine mRNA expression in the central nervous system of mice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA correlates with recovery. J. Immunol. 149 (7), 2496 – 2505. Kent, S.J., Karlik, S.J., Cannon, C., Hines, D.K., Yednock, T.A., Fritz, L.C., Horner, H.C., 1995a. A monoclonal antibody to a4 integrin suppresses and reverses active experimental allergic encephalomyelitis. J. Neuroimmunol. 58, 1 – 10. Kent, S.J., Karlik, S.J., Rice, G.P., Horner, H.C., 1995b. A monoclonal antibody to a4 integrin reverses the MR-detectable signs of experimental allergic encephalomyelitis in the guinea pig. J. Magn. Reson. Imaging 5 (5), 535 – 540. Keszthleyi, E., Karlik, S.J., Hyduk, S.J., Rice, G.P., Gordon, G., Yednock, T.A., Horner, H.C., 1996. Evidence for a prolonged role of a4 integrin throughout active experimental allergic encephalomyelitis. Neurology 47, 1053 – 1059. Kuchroo, V.K., Martin, C.A., Greer, J.M., Ju, S., Sobel, R.A., Dorf, M.E., 1993. Cytokines and adhesion molecules contribute to the ability of myelin proteolipid protein-specific T cell clones to mediate experimental allergic encephalomyelitis. J. Immunol. 151 (8), 4371 – 4382. Laberge, S., Rabb, H.A., Issekutz, T.B., Martin, J.G., 1995. Role of VLA-4 and LFA-1 in allergen-induced airway hyperresponsiveness and lung inflammation in the rat. Am. J. Respir. Crit. Care Med. 151, 822 – 829. Laffon, A., Garcia-Vicuna, R., Humbria, A., Postigo, A.A., Corbi, A.L., de Landazuri, M.O., Sanchez-Madrid, F., 1991. Upregulated expression

and function of VLA-4 fibronectin receptors on human activated T cells in rheumatoid arthritis. J. Clin. Invest. 88 (2), 546 – 552. Laschinger, M., Engelhardt, B., 2000. Interaction of a4-integrin with VCAM-1 is involved in adhesion of encephalitogenic T cell blasts to brain endothelium but not in their transendothelial migration in vitro. J. Neuroimmunol. 102, 32 – 43. Leger, O.J., Yednock, T.A., Tanner, L., Horner, H.C., Hines, D.K., Keen, S., Saldanha, J., Jones, S.T., Fritz, L.C., Bendig, M.M., 1997. Humanization of a mouse antibody against human a4 integrin: a potential therapeutic for the treatment of multiple sclerosis. Hum. Antib. 8 (1), 3 – 16. Lin, K., Castro, A.C., 1998. Very late antigen 4 (VLA4) antagonists as antiinflammatory agents. Curr. Opin. Chem. Biol. 2, 453 – 457. Lin, K., Ateeq, H.S., Hsiung, S.H., Chong, L.T., Zimmerman, C.T., Castro, A.C., Lee, W., Hammond, C.E., Kalkunte, S., Chen, L.L. et al., , 1999. Selective, tight-binding inhibitors of integrin a4h1 that inhibit allergic airway responses. J. Med. Chem. 42, 920 – 934. Miller, M.D., Krangel, M.S., 1992. Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Curr. Rev. Immunol. 12 (1/2), 17 – 46. Milne, A., Piper, P., 1995. Role of the VLA-4 integrin in leukocyte recruitment and bronchial hyperresponsiveness in the guinea pig. Eur. J. Pharmacol. 282, 243 – 249. Minami, Y., Kono, T., Miyazaki, T., Taniguchi, T., 1993. The IL-2 receptor complex: it’s structure, function and target genes. Annu. Rev. Immunol. 11, 245 – 267. Molina, A., Sanchez-Madrid, F., Bricio, T., Martin, A., Barat, A., Alvarez, V., Mampaso, F., 1994. Prevention of mercuric chloride-induced nephritis in the brown Norway rat by treatment with antibodies against the alpha-4 integrin. J. Immunol. (153), 2313 – 2320. Molossi, S., Elices, M.J., Arrhenius, T., Diaz, R., Coulber, C., Rabinovitch, M., 1995. Blockade of very late antigen-4 integrin binding to fibronectin with connecting segment-1 peptide reduces accelerated coronary arteriopathy in rabbit cardiac allografts. J. Clin. Invest. 95, 2601 – 2610. Moore, K.W., O’Garra, A., deWaal Malefyt, R., Viera, R., Mossman, T.R., 1993. Interleukin-10. Annu. Rev. Immunol. 11, 165 – 190. Nakajima, H., Sano, H., Nishimura, T., Yoshida, S., Iwamoto, I., 1994. Role of vascular cell adhesion molecule-1/very late activation antigen-4 and intercellular adhesion molecule-1/leukocyte function associated antigen-1 interactions in antigen-induced eosinophil and T cell recruitment into the tissue. J. Exp. Med. 179, 1145 – 1154. Nguyen, K.B., McCombe, P.A., Pender, M.P., 1994. Macrophage apoptosis in the central nervous system in experimental autoimmune encephalomyelitis. J. Autoimmun. 7, 145 – 152. Nguyen, K.B., McCombe, P.A., Pender, M.P., 1997. Increased apoptosis of T lymphocytes and macrophages in the central and peripheral nervous systems of Lewis rats with experimental autoimmune encephalomyelitis treated with dexamethasone. J. Neuropathol. Exp. Neurol. 56 (1), 58 – 69. Paterson, P.Y., 1960. Transfer of allergic encephalomyelitis in rats by means of lymph node cells. J. Exp. Med. 111, 119 – 136. Pender, M.P., Nguyen, K.B., McCombe, P.A., Kerr, J.F.R., 1991. Apoptosis in the nervous system in experimental allergic encephalomyelitis. J. Neurol. Sci. 104, 81 – 87. Picker, L.J., Terstappen, L.W., Rott, L.S., Streeter, P.R., Stein, H., Butcher, E.C., 1990. Differential expression of homing-associated adhesion molecules by T cell subsets in man. J. Immunol. 145 (10), 3247 – 3255. Podolsky, D.K., Lobb, R.R., King, N., Benjamin, C.D., Pepinsky, R.B., Sehgal, P., deBeaumont, M., 1993. Attenuation of colitis in the cottontop tamarin by anti-alpha-4 integrin monoclonal antibody. J. Clin. Invest. 92, 372 – 380. Pretolani, M., Ruffie, C., Silva, J.R.L.E., Joseph, D., Lobb, R.R., Vargaftig, B.B., 1994. Antibody to very late activation antigen 4 prevents antigeninduced bronchial hyperreactivity and cellular infiltration in the guinea pig airways. J. Exp. Med. 180, 795 – 806. Prineas, J.W., McDonald, W.I., 1997. Demyelinating diseases. In: Graham, D.I., Lantos, P.L. (Eds.), Greenfield’s Neuropathology, 6th ed. Oxford Univ. Press, New York, NY, pp. 813 – 896.

P.S. Piraino et al. / Journal of Neuroimmunology 131 (2002) 147–159 Rabb, H.A., Olivenstein, R., Issekutz, T.B., Renzi, P.M., Martin, J.G., 1994. The role of the leukocyte adhesion molecules VLA-4, LFA-1 and Mac-1 in allergic airway responses in the rat. Am. J. Respir. Crit. Care Med. 149, 1186 – 1191. Racke, M.K., Sriram, S., Carlino, J., Cannella, B., Raine, C.S., McFarlin, D.E., 1993. Long-term treatment of chronic relapsing experimental allergic encephalomyelitis by transforming growth factor-h2. J. Neuroimmunol. 46, 175 – 184. Raine, C.S., Traugott, U., 1985. Remyelination in chronic relapsing experimental allergic encephalomyelitis and multiple sclerosis. In: Adachi, M., Hirano, A., Aronson, S.M. (Eds.), The Pathology of the Myelinated Axon, 1st ed. Igaku-Shoin, Tokyo, pp. 229 – 275. Ransohoff, R.M., Hamilton, T.A., Tani, M., Stoler, M.H., Shick, H.E., Major, J.A., Estes, M.L., Thomas, D.M., Tuohy, V.K., 1993. Astrocyte expression of mRNA encoding cytokines IP-10 and JE/MCP-1 in experimental autoimmune encephalomyelitis. FASEB 7, 592 – 600. Relton, J.K., Sloan, K.E., Frew, E.M., Whalley, E.T., Adams, S.P., Lobb, R.R., 2001. Inhibition of a4 integrin protects against transient focal cerebral ischemia in normotensive and hypertensive rats. Stroke 32, 199 – 205. Renno, T., Lin, J., Piccirillo, C., Antel, J.P., Owens, T., 1994. Cytokine production by cells in the cerebrospinal fluid during experimental allergic encephalomyelitis in SJL/J mice. J. Neuroimmunol. 49, 1 – 7. Rodriguez, M., Lindsley, M.D., 1992. Immunosuppression promotes CNS remyelination in chronic virus-induced demyelinating disease. Neurology 42, 348 – 357. Schmied, M., Breitschopf, H., Gold, R., Zischler, H., Rothe, G., Werkle, H., Lassmann, H., 1993. Apoptosis of T lymphocytes in experimental autoimmune encephalomyelitis. Am. J. Pathol. 143, 446 – 452. Seiffge, D., 1996. Protective effects of monoclonal antibody to VLA-4 on leukocyte adhesion and course of disease in adjuvant arthritis in rats. J. Rheumatol. 23, 2086 – 2091. Selmaj, K., Walczak, A., Mycko, M., Berkowicz, T., Kohno, T., Raine, C.S., 1998. Suppression of experimental autoimmune encephalomyelitis with a TNF binding protein (TNFbp) correlates with a down-regulation of VCAM-1/VLA-4. Eur. J. Immunol. 28, 2035 – 2044. Shimizu, Y., Van Seventer, G.A., Horgan, K.J., Shaw, S., 1990. Regulated expression and binding of three VLA (beta 1) integrin receptors on T cells. Nature 345 (6272), 250 – 253. Smith, T., Schmied, M., Hewson, A.K., Lassmann, H., Cuzner, M.L., 1996. Apoptosis of T cells and macrophages in the central nervous system of intact and adrenalectomized Lewis rats during experimental allergic encephalomyelitis. J. Autoimmun. 9, 167 – 174. Soilu-Hanninen, M., Roytta, M., Salmi, A., Salonen, R., 1997. Therapy with antibody against leukocyte integrin VLA-4 (CD49d) is effective

159

and safe in virus-facilitated experimental allergic encephalomyelitis. J. Neuroimmunol. 72, 95 – 105. Springer, T.A., 1995. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57, 827 – 872. Theien, B.E., Vanderlugt, C.L., Eagar, T.N., Nickerson-Nutter, C., Nazareno, R., Kuchroo, V.K., Miller, S.D., 2001. Discordant effects for anti-VLA-4 treatment before and after onset of relapsing experimental autoimmune encephalomyelitis. J. Clin. Invest. 107, 995 – 1006. Traugott, U., Raine, C.S., McFarlin, D.E., 1985. Acute experimental allergic encephalomyelitis in the mouse: immunopathology of the developing lesion. Cell. Immunol. 91, 240 – 254. Traugott, U., McFarlin, D.E., Raine, C.S., 1986. Immunopathology of the lesion in chronic relapsing experimental allergic encephalomyelitis in the mouse. Cell. Immunol. 99, 395 – 410. Tsunoda, I., Fujinami, R.S., 1996. Two models for multiple sclerosis: experimental allergic encephalomyelitis and Theiler’s murine encephalomyelitis virus. J. Neuropathol. Exp. Neurol. 55 (6), 673 – 686. Tubridy, N., Behan, P.O., Capildeo, R., Chaudhuri, A., Forbes, R., Hawkins, C.P., Hughes, R.A., Palace, J., Sharrack, B., Swingler, R., et al., 1999. The effect of anti-a4 integrin antibody on brain lesion activity in MS. The UK Antegren Study Group. Neurology 53 (3), 466 – 472. Wang, Q., Wang, Y., Hyde, D.M., Gotwals, P.J., Lobb, R.R., Ryan, S.T., Giri, S.N., 2000. Effect of antibody against a4 integrin on bleomycin-induced pulmonary fibrosis in mice. Biochem. Pharmacol. 60, 1949 – 1958. Wisniewski, H.M., Madrid, R.E., 1983. Chronic progressive experimental allergic encephalomyelitis (EAE) in adult guinea pigs. J. Neuropathol. Exp. Neurol. 42, 243 – 255. Wu, X., Tiwari, A., Issekutz, T.B., Lefkowith, J., 1996. Differing roles of CD18 and VLA-4 in leukocyte migration/activation during anti-GBM nephritis. Kidney Int. 50, 462 – 472. Yang, X.D., Michie, S.A., Tisch, R., Karin, N., Steinman, L., McDevitt, H.O., 1994. A predominant role of integrin a4 in the spontaneous development of autoimmune diabetes in nonobese diabetic mice. PNAS 91, 12604 – 12608. Yang, H., Issekutz, T.B., Wright, J.J., 1995. Prolongation of rat islet allograft survival by treatment with monoclonal antibodies against VLA-4 and LFA-1. Transplantation 60, 71 – 76. Yednock, T.A., Cannon, C., Fritz, L.C., Sanchez-Madrid, F., Steinman, L., Karin, N., 1992. Prevention of experimental autoimmune encephalomyelitis by antibodies against a4h1 integrin. Nature 356, 63 – 66. Zeine, R., Owens, T., 1993. Loss rather than downregulation of CD4+ T cells as a mechanism for remission from experimental allergic encephalomyelitis. J. Neuroimmunol. 44, 193 – 198.