- Email: [email protected]
Promoter polymorphism and expression of β-arrestin 2 in neutrophils
Clinica Chimica Acta 385 (2007) 79 – 80 www.elsevier.com/locate/clinchim
Letter to the Editor Promoter polymorphism and expression of β-arrestin 2 in neutrophils Dear Editor, G-protein-coupled receptors (GPCRs) represent the largest and most versatile superfamily of cell membrane receptors, which transmit extracellular stimuli to the interior of cells and initiate various signaling pathways and cellular responses. The signal transduction pathway mediated by GPCRs is modulated by three families of regulatory proteins: G proteins, GPCR kinases and arrestins. G proteins are involved in receptor activation, whereas GPCR kinases and β-arrestins are mainly associated with receptor desensitization and endocytosis by means of binding to the phosphorylated receptors or interacting with proteins of the endocytic machinery [1,2]. The 2 forms of β-arrestin, β-arrestin 1 (ARRB1) and β-arrestin 2 (ARRB2), share over 78% amino acid identity and were detected in a variety of tissues and cells [3], and have functional redundancy [4,5]. However, ARRB2 plays an important role in regulating μ-opioid-receptor desensitization and sequestration. ARRB2 knockout mice showed prolongation of the analgesic effect of morphine due to impaired receptor desensitization [5,6]. We speculated that there is differential expression of ARRB2 between individuals due to their genetic background and this may affect biological function. To our knowledge, there have been no data on genetic regulation of ARRB2 expression. In this study, we examined the association of ARRB2 genetic polymorphisms with its expression and polymorphonuclear leukocyte (PMN) degranulation. PMNs are the most abundant leukocytes in peripheral blood and β-arrestins play an important role in mediator mobilization and release in PMN azurophilic granules [7]. Individuals from 2 racial groups were recruited into this study, including 60 Caucasian (33 female and 27 male) and 35 Asian (19 female and 16 male) healthy volunteers. The mean age of these racial groups was 34.7 ± 10.4 and 30.6 ± 7.8 y, respectively. The research protocol was approved by the Providence Health Care Research Ethics Board. All the participants gave written informed consent and donated 20 ml of peripheral blood. Promoter polymorphisms in the ARRB2 gene were screened by automated sequencing. In brief, approximately 1 kb of the 5′flanking region of the ARRB2 gene (from −718 to 228) was amplified. Purified PCR products were subjected to 2 overlapping sequencing reactions. A novel promoter polymorphism (−159C/T) identified by sequencing was further confirmed by restriction fragment length polymorphism (RFLP) analysis. In addition, six putative polymorphisms reported in the dbSNP database (http:// 0009-8981/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.cca.2007.07.021
www.ncbi.nlm.nih.gov/SNP) were included in the study and investigated by RFLP. The − 159C/T polymorphism was found in the Caucasian subjects but was not present in the Asian individuals. Another 2 polymorphisms, 1309A/G and 9019A/G, were detected in both ethnic groups. The genotype distribution of the three detected polymorphisms is shown in Table 1. The genotype frequencies conformed to what is expected from Hardy–Weinberg equilibrium (P N 0.05). The − 803A/G, − 705A/G, and 11,908C/T polymorphisms were monomorphic in our study groups. The minor allele of the 4683A/G polymorphism was only detected in one subject. These four polymorphisms were excluded from the gene expression study due to their low prevalence. PMNs were isolated from fresh peripheral blood by a Dextran–Ficoll sedimentation and centrifugation method [8]. Usually the preparations contained N 98% PMNs. Since the isolated PMNs were used for RNA extraction and gene expression analysis all the procedures were performed within 2 h after the blood was drawn. Genomic DNA was extracted from mononuclear cells. Total RNA was isolated from pure PMNs with the use of the RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada). The synthesis of first strand cDNA was carried out with the use of SuperScript RNase H− Reverse Transcriptase and random primers (Invitrogen; Burlington, ON, Canada). The mRNA levels for ARRB2 were measured by real-time PCR. The primers and TaqMan probe were as follows: Forward primer: AAGTCGAGCCCTAACTGCAA, Reverse primer: TTGCGGTCCTTCAGGTAGTC, TaqMan Probe: 6FAM-CACCTGGACAAAGTG. β-actin was chosen as the housekeeping gene for normalization [9]. Serially diluted, cloned PCR products of ARRB2 and βactin were used to build standard curves. Diluted cDNA samples were run in triplicate on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). The mean Ct values of ARRB2 and β-actin for each individual sample were converted into copy numbers using the standard curves. The ARRB2 mRNA level was expressed as the ratio of β-arrestin 2 over β-actin. Myeloperoxidase (MPO), one of the mediators stored in azurophilic granules, was used as a marker of azurophilic granule degranulation as previously described [10,11]. The association between genetic polymorphisms and ARRB2 expression was evaluated using a codominant model. Due to the rarity of the −159T/T, 1309 A/A, and 9019 A/A genotypes, they were excluded from the statistical analysis. We found that the novel promoter polymorphism −159C/T was associated with ARRB2 mRNA expression in the Caucasians. The CC genotype had significantly higher mRNA than the TT genotype (1.26 ± 0.09
80
Letter to the Editor
Table 1 Genotype distribution of ARRB2 polymorphisms in Caucasians and Asians − 159 C/T
Caucasian Asian
1309 A/G
9019 A/G
C/C
C/T
T/T
G/G
A/G
A/A
G/G
A/G
A/A
40 35
19 0
1 0
37 22
21 11
2 2
38 24
20 10
2 1
vs. 0.91 ± 0.08, P = 0.015). There was no association observed for the other polymorphisms. A similar analysis was made to assess the relationship of the polymorphisms to the amount of released MPO but no association was observed (data not shown). To explore the influence of the promoter polymorphism on gene transcription a promoter region (− 333 to − 28 upstream of the first codon), which spanned the − 159C/T polymorphism and harbored a number of putative transcription factor binding sites was amplified from − 159CC and − 159TT homozygotes. The primers were: Forward primer: aattctcgaggcaattgaaccgctcacc; Reverse primer: aattaagcttcttcccagcctggtagcc. The XhoI site and HindIII sites (the underlined bases) were chosen as insertion sites and added into the forward and reverse primers, respectively, for directional cloning. The PCR product was inserted into a promoterless pGL3-luciferase reporter gene basic vector (Promega, Madison, WI). The constructed plasmids were propagated in E. coli DH5α and purified from bacterial cultures with the use of QIAprep Maxi Kits (Qiagen). The orientation and the sequence of inserts were confirmed by sequencing analysis. A549 pulmonary type II epithelial cells (ATCC, Manassas, VA) were transiently transfected with the luciferase gene constructs using Lipofectamine 2000 (Invitrogen). Cells were harvested 18 h after transfection. Cell lysates were prepared in 100 μl of Laemmli lysis buffer. The transfection efficiency was normalized by cotransfection of the Renilla luciferase expression vector pRLTK (Promega). Three independent plasmid preparations were performed for each allele and a total of three independent transfection experiments were performed for each plasmid preparation. The results demonstrated that the C allele had significantly higher normalized luciferase activity compared with the T allele (1.00 ± 0.18 vs. 0.86 ± 0.16, P = 0.004), consistent with the mRNA data presented above. In this study we identified a novel polymorphism (−159C/T) in the promoter region of the ARRB2 gene in Caucasians and found that it was associated with ARRB2 expression. The CC genotype had a higher level of ARRB2 mRNA than the CT genotype, which implies that the − 159C/T polymorphism modulates ARRB2 gene transcription. The −159C/T polymorphism is located within the proximal promoter region of ARRB2 and is adjacent to the binding sites of several putative transcription factors, such as Sp1, CTF, and GCR, when analyzed by several computer programs for transcription factor prediction. It is possible that the substitution of T for C at −159 bp affects the binding of potential sequence-specific transcription factors and consequently decreases the efficiency of gene transcription. In order to further characterize the influence of the −159C/T polymorphism on gene expression we performed a reporter gene assay. We studied a promoter region of approximately 350 bp upstream of the transcription start site because this region harbors a number of putative transcription factor binding sites. Therefore,
this short region could maintain basal transcription activity in vitro. The reporter gene study was performed in an airway epithelial cell line A549 due to the availability of this cell line and its expression of ARRB2. The results demonstrated that the C allele had significantly higher normalized luciferase activity than the T allele and provided evidence that the −159C/T polymorphism could directly affect ARRB2 gene expression. The molecular mechanism underlying this observation may be a change in the binding pattern of a transcription factor. In summary, we discovered a novel promoter polymorphism (−159C/T) that was associated with differential expression of the ARRB2 gene in PMNs. Acknowledgements AJS is the recipient of a Canada Research Chair in genetics. This study was supported by grants from the American Thoracic Society and the British Columbia Lung Association. References [1] Goodman Jr OB, Krupnick JG, Santini F, et al. Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 1996;383:447–50. [2] Kohout TA, Lefkowitz RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 2003;63:9–18. [3] Attramadal H, Arriza JL, Aoki C, et al. Beta-arrestin2, a novel member of the arrestin/beta-arrestin gene family. J Biol Chem 1992;267:17882–90. [4] Conner DA, Mathier MA, Mortensen RM, et al. Beta-arrestin1 knockout mice appear normal but demonstrate altered cardiac responses to betaadrenergic stimulation. Circ Res 1997;81:1021–6. [5] Bohn LM, Lefkowitz RJ, Gainetdinov RR, Peppel K, Caron MG, Lin FT. Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science 1999;286:2495–8. [6] Bohn LM, Gainetdinov RR, Lin FT, Lefkowitz RJ, Caron MG. Mu-opioid receptor desensitization by beta-arrestin-2 determines morphine tolerance but not dependence. Nature 2000;408:720–3. [7] Barlic J, Andrews JD, Kelvin AA, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1:227–33. [8] Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97:77–89. [9] Zhang X, Ding L, Sandford AJ. Selection of reference genes for gene expression studies in human neutrophils by real-time PCR. BMC Mol Biol 2005;6:4. [10] Barlic J, Khandaker MH, Mahon E, et al. Beta-arrestins regulate interleukin8-induced CXCR1 internalization. J Biol Chem 1999;274:16287–94. [11] Lacy P, Mahmudi-Azer S, Bablitz B, et al. Rapid mobilization of intracellularly stored RANTES in response to interferon-gamma in human eosinophils. Blood 1999;94:23–32.
Xiaozhu Zhang Jian-Qing He Lily Ding Peter D. Paré Andrew J. Sandford⁎ The James Hogg iCAPTURE Centre for Cardiovascular and Pulmonary Research, St. Paul's Hospital, University of British Columbia, Vancouver, BC, Canada ⁎ Corresponding author. Tel.: +04 806 9008; fax: +04 806 8351. E-mail address: [email protected] (A.J. Sandford). 1 May 2007
Letter to the Editor Promoter polymorphism and expression of β-arrestin 2 in neutrophils Dear Editor, G-protein-coupled receptors (GPCRs) represent the largest and most versatile superfamily of cell membrane receptors, which transmit extracellular stimuli to the interior of cells and initiate various signaling pathways and cellular responses. The signal transduction pathway mediated by GPCRs is modulated by three families of regulatory proteins: G proteins, GPCR kinases and arrestins. G proteins are involved in receptor activation, whereas GPCR kinases and β-arrestins are mainly associated with receptor desensitization and endocytosis by means of binding to the phosphorylated receptors or interacting with proteins of the endocytic machinery [1,2]. The 2 forms of β-arrestin, β-arrestin 1 (ARRB1) and β-arrestin 2 (ARRB2), share over 78% amino acid identity and were detected in a variety of tissues and cells [3], and have functional redundancy [4,5]. However, ARRB2 plays an important role in regulating μ-opioid-receptor desensitization and sequestration. ARRB2 knockout mice showed prolongation of the analgesic effect of morphine due to impaired receptor desensitization [5,6]. We speculated that there is differential expression of ARRB2 between individuals due to their genetic background and this may affect biological function. To our knowledge, there have been no data on genetic regulation of ARRB2 expression. In this study, we examined the association of ARRB2 genetic polymorphisms with its expression and polymorphonuclear leukocyte (PMN) degranulation. PMNs are the most abundant leukocytes in peripheral blood and β-arrestins play an important role in mediator mobilization and release in PMN azurophilic granules [7]. Individuals from 2 racial groups were recruited into this study, including 60 Caucasian (33 female and 27 male) and 35 Asian (19 female and 16 male) healthy volunteers. The mean age of these racial groups was 34.7 ± 10.4 and 30.6 ± 7.8 y, respectively. The research protocol was approved by the Providence Health Care Research Ethics Board. All the participants gave written informed consent and donated 20 ml of peripheral blood. Promoter polymorphisms in the ARRB2 gene were screened by automated sequencing. In brief, approximately 1 kb of the 5′flanking region of the ARRB2 gene (from −718 to 228) was amplified. Purified PCR products were subjected to 2 overlapping sequencing reactions. A novel promoter polymorphism (−159C/T) identified by sequencing was further confirmed by restriction fragment length polymorphism (RFLP) analysis. In addition, six putative polymorphisms reported in the dbSNP database (http:// 0009-8981/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.cca.2007.07.021
www.ncbi.nlm.nih.gov/SNP) were included in the study and investigated by RFLP. The − 159C/T polymorphism was found in the Caucasian subjects but was not present in the Asian individuals. Another 2 polymorphisms, 1309A/G and 9019A/G, were detected in both ethnic groups. The genotype distribution of the three detected polymorphisms is shown in Table 1. The genotype frequencies conformed to what is expected from Hardy–Weinberg equilibrium (P N 0.05). The − 803A/G, − 705A/G, and 11,908C/T polymorphisms were monomorphic in our study groups. The minor allele of the 4683A/G polymorphism was only detected in one subject. These four polymorphisms were excluded from the gene expression study due to their low prevalence. PMNs were isolated from fresh peripheral blood by a Dextran–Ficoll sedimentation and centrifugation method [8]. Usually the preparations contained N 98% PMNs. Since the isolated PMNs were used for RNA extraction and gene expression analysis all the procedures were performed within 2 h after the blood was drawn. Genomic DNA was extracted from mononuclear cells. Total RNA was isolated from pure PMNs with the use of the RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada). The synthesis of first strand cDNA was carried out with the use of SuperScript RNase H− Reverse Transcriptase and random primers (Invitrogen; Burlington, ON, Canada). The mRNA levels for ARRB2 were measured by real-time PCR. The primers and TaqMan probe were as follows: Forward primer: AAGTCGAGCCCTAACTGCAA, Reverse primer: TTGCGGTCCTTCAGGTAGTC, TaqMan Probe: 6FAM-CACCTGGACAAAGTG. β-actin was chosen as the housekeeping gene for normalization [9]. Serially diluted, cloned PCR products of ARRB2 and βactin were used to build standard curves. Diluted cDNA samples were run in triplicate on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). The mean Ct values of ARRB2 and β-actin for each individual sample were converted into copy numbers using the standard curves. The ARRB2 mRNA level was expressed as the ratio of β-arrestin 2 over β-actin. Myeloperoxidase (MPO), one of the mediators stored in azurophilic granules, was used as a marker of azurophilic granule degranulation as previously described [10,11]. The association between genetic polymorphisms and ARRB2 expression was evaluated using a codominant model. Due to the rarity of the −159T/T, 1309 A/A, and 9019 A/A genotypes, they were excluded from the statistical analysis. We found that the novel promoter polymorphism −159C/T was associated with ARRB2 mRNA expression in the Caucasians. The CC genotype had significantly higher mRNA than the TT genotype (1.26 ± 0.09
80
Letter to the Editor
Table 1 Genotype distribution of ARRB2 polymorphisms in Caucasians and Asians − 159 C/T
Caucasian Asian
1309 A/G
9019 A/G
C/C
C/T
T/T
G/G
A/G
A/A
G/G
A/G
A/A
40 35
19 0
1 0
37 22
21 11
2 2
38 24
20 10
2 1
vs. 0.91 ± 0.08, P = 0.015). There was no association observed for the other polymorphisms. A similar analysis was made to assess the relationship of the polymorphisms to the amount of released MPO but no association was observed (data not shown). To explore the influence of the promoter polymorphism on gene transcription a promoter region (− 333 to − 28 upstream of the first codon), which spanned the − 159C/T polymorphism and harbored a number of putative transcription factor binding sites was amplified from − 159CC and − 159TT homozygotes. The primers were: Forward primer: aattctcgaggcaattgaaccgctcacc; Reverse primer: aattaagcttcttcccagcctggtagcc. The XhoI site and HindIII sites (the underlined bases) were chosen as insertion sites and added into the forward and reverse primers, respectively, for directional cloning. The PCR product was inserted into a promoterless pGL3-luciferase reporter gene basic vector (Promega, Madison, WI). The constructed plasmids were propagated in E. coli DH5α and purified from bacterial cultures with the use of QIAprep Maxi Kits (Qiagen). The orientation and the sequence of inserts were confirmed by sequencing analysis. A549 pulmonary type II epithelial cells (ATCC, Manassas, VA) were transiently transfected with the luciferase gene constructs using Lipofectamine 2000 (Invitrogen). Cells were harvested 18 h after transfection. Cell lysates were prepared in 100 μl of Laemmli lysis buffer. The transfection efficiency was normalized by cotransfection of the Renilla luciferase expression vector pRLTK (Promega). Three independent plasmid preparations were performed for each allele and a total of three independent transfection experiments were performed for each plasmid preparation. The results demonstrated that the C allele had significantly higher normalized luciferase activity compared with the T allele (1.00 ± 0.18 vs. 0.86 ± 0.16, P = 0.004), consistent with the mRNA data presented above. In this study we identified a novel polymorphism (−159C/T) in the promoter region of the ARRB2 gene in Caucasians and found that it was associated with ARRB2 expression. The CC genotype had a higher level of ARRB2 mRNA than the CT genotype, which implies that the − 159C/T polymorphism modulates ARRB2 gene transcription. The −159C/T polymorphism is located within the proximal promoter region of ARRB2 and is adjacent to the binding sites of several putative transcription factors, such as Sp1, CTF, and GCR, when analyzed by several computer programs for transcription factor prediction. It is possible that the substitution of T for C at −159 bp affects the binding of potential sequence-specific transcription factors and consequently decreases the efficiency of gene transcription. In order to further characterize the influence of the −159C/T polymorphism on gene expression we performed a reporter gene assay. We studied a promoter region of approximately 350 bp upstream of the transcription start site because this region harbors a number of putative transcription factor binding sites. Therefore,
this short region could maintain basal transcription activity in vitro. The reporter gene study was performed in an airway epithelial cell line A549 due to the availability of this cell line and its expression of ARRB2. The results demonstrated that the C allele had significantly higher normalized luciferase activity than the T allele and provided evidence that the −159C/T polymorphism could directly affect ARRB2 gene expression. The molecular mechanism underlying this observation may be a change in the binding pattern of a transcription factor. In summary, we discovered a novel promoter polymorphism (−159C/T) that was associated with differential expression of the ARRB2 gene in PMNs. Acknowledgements AJS is the recipient of a Canada Research Chair in genetics. This study was supported by grants from the American Thoracic Society and the British Columbia Lung Association. References [1] Goodman Jr OB, Krupnick JG, Santini F, et al. Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 1996;383:447–50. [2] Kohout TA, Lefkowitz RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 2003;63:9–18. [3] Attramadal H, Arriza JL, Aoki C, et al. Beta-arrestin2, a novel member of the arrestin/beta-arrestin gene family. J Biol Chem 1992;267:17882–90. [4] Conner DA, Mathier MA, Mortensen RM, et al. Beta-arrestin1 knockout mice appear normal but demonstrate altered cardiac responses to betaadrenergic stimulation. Circ Res 1997;81:1021–6. [5] Bohn LM, Lefkowitz RJ, Gainetdinov RR, Peppel K, Caron MG, Lin FT. Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science 1999;286:2495–8. [6] Bohn LM, Gainetdinov RR, Lin FT, Lefkowitz RJ, Caron MG. Mu-opioid receptor desensitization by beta-arrestin-2 determines morphine tolerance but not dependence. Nature 2000;408:720–3. [7] Barlic J, Andrews JD, Kelvin AA, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1:227–33. [8] Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97:77–89. [9] Zhang X, Ding L, Sandford AJ. Selection of reference genes for gene expression studies in human neutrophils by real-time PCR. BMC Mol Biol 2005;6:4. [10] Barlic J, Khandaker MH, Mahon E, et al. Beta-arrestins regulate interleukin8-induced CXCR1 internalization. J Biol Chem 1999;274:16287–94. [11] Lacy P, Mahmudi-Azer S, Bablitz B, et al. Rapid mobilization of intracellularly stored RANTES in response to interferon-gamma in human eosinophils. Blood 1999;94:23–32.
Xiaozhu Zhang Jian-Qing He Lily Ding Peter D. Paré Andrew J. Sandford⁎ The James Hogg iCAPTURE Centre for Cardiovascular and Pulmonary Research, St. Paul's Hospital, University of British Columbia, Vancouver, BC, Canada ⁎ Corresponding author. Tel.: +04 806 9008; fax: +04 806 8351. E-mail address: [email protected] (A.J. Sandford). 1 May 2007