- Email: [email protected]
Properties of extended-spectrum β-lactamases constructed by site-directed mutagenesis
J Infect Chemother (2002) 8:211–217 DOI 10.1007/s10156-002-0183-9
© Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases 2002
ORIGINAL ARTICLE
Takashi Takenouchi · Yoshikazu Ishii · Keizo Yamaguchi
Properties of extended-spectrum β-lactamases constructed by site-directed mutagenesis
Received: December 25, 2001 / Accepted: April 15, 2002
Abstract Plasmids carrying three types of TEM-type extended-spectrum β-lactamase (ESBL) genes, encoding TEM-3, TEM-5, and TEM-9, respectively, were constructed by site-directed mutagenesis. ESBL producers were prepared by transformation of Escherichia coli JM109 with a plasmid carrying one gene of either the three TEM types, an SHV-type, or a Toho-1 group gene. This strategy with the same vector and host strain can exclude the contribution of other factors to susceptibility, and is useful in Japan, where few TEM-type ESBL producers have been isolated. In vitro antibacterial activities of 23 β-lactam antibiotics were tested against the ESBL producers by the agar dilution method, and the results were compared. The minimum inhibitory concentrations (MICs) of penicillins tested were more than 32 µg/ml against both the parental RTEM and ESBL producers, but they were substantially decreased by a combination with β-lactamase inhibitors. Compared with the MICs against the ESBL-nonproducing host strain, the MICs of the cephalosporins tested for the ESBL producers were increased more than eight times in most cases and in several cases soared to more than 2048 times against a Toho-1 ESBL producer. On the other hand, the MICs of carbapenem, cephamycin, and penem antibiotics were generally comparable to those against the host strain, and were increased by 32 times at most. Kinetic analysis revealed that extended-spectrum cephalosporins were hydrolyzed only slightly to moderately by the TEM-type ESBLs, while carbapenems and a cephamycin were scarcely hydrolyzed, and rather inhibited or inactivated the mutant enzymes.
T. Takenouchi (*) Biological Research Laboratories, Sankyo Co., Ltd., 2-58 Hiromachi 1-chome, Shinagawa-ku, Tokyo 140-8710, Japan Tel. 81-3-3492-3131; Fax 81-3-5436-8566 e-mail: [email protected] T. Takenouchi · Y. Ishii · K. Yamaguchi Department of Microbiology, Toho University School of Medicine, Tokyo, Japan
Key words Site-directed mutagenesis · β-Lactam antibiotics · MIC · Kinetics · Carbapenem · Cephamycin
Introduction Klebsiella pneumoniae strains showing transmissible resistance to broad-spectrum cephalosporins were first reported in Europe in 1983.1 Later it was discovered that the resistance mechanism in these strains was due to the production of extended-spectrum β-lactamase (ESBL), which has the ability to hydrolyze the extended-spectrum cephalosporins. Most ESBLs are variants of common TEM- or SHV-type βlactamases that have undergone one or more amino-acid substitutions near the active site of the enzyme. This results in an increase in its affinity for and hydrolytic ability towards broadspectrum cephalosporins and monobactams such as aztreonam.2–4 ESBL-producing strains are found worldwide, usually in hospitals, and are problematic because they are one of the major causes of outbreaks of nosocomial infection. In many cases, these enzymes are encoded by plasmids that can transfer resistance to other species of Enterobacteriaceae, such as Escherichia coli and K. pneumoniae.2–4 In Japan the emergence of ceftazidime-resistant K. pneumoniae was first reported in 1995.5 Since then, Toho-1 group β-lactamase-producing E. coli strains and an SFO-1 β-lactamase-producing Enterobacter cloacae strain have been reported.6–9 These enzymes are functionally classified, in a broad sense, as members of ESBLs (group 2be).10 Toho-1 group ESBL producers seem to be dominant over TEM- and SHV-type ESBL producers; however, the SHVtype ESBL producers have been more frequently isolated than has been expected.11 Although ESBL producers are of clinical concern, few studies have been reported on the comparative antibacterial activities of newer β-lactam antibiotics, which reflect current Japanese clinical settings, against a series of ESBL producers.12 In this report, three TEM-type ESBL genes were constructed by the introduction of site-directed muta-
212
tions to an AmpR selective marker on a plasmid, because ESBL producers, especially TEM-type ESBL-producing strains, are still rarely isolated from clinical samples in Japan. In vitro antimicrobial activities of several groups of β-lactam antibiotics were tested and compared against five types of class A ESBL producers. To confirm the results of the susceptibility test, kinetic parameters were also calculated between the TEM-type ESBLs and selected cephem and carbapenem antibiotics, which showed a great difference in the magnitude of decrease in activity by the βlactamases.
Materials and methods Antimicrobial agents Standard samples of ampicillin, ceftriaxone, ceftazidime, imipenem, and meropenem were obtained from the National Institute of Infectious Diseases (Tokyo, Japan). Tazobactam, cefpodoxime, panipenem, and R-95867, the active metabolite of the orally active carbapenem antibiotic CS-834,13 were synthesized by Sankyo (Tokyo, Japan). Piperacillin, cefoperazone, and cephalothin (Sigma Chemical, St. Louis, MO, USA); cefepime (BristolMyers Squibb, Tokyo, Japan); cefmetazole (Sankyo), cefotaxime, and cefpirome (Chugai Pharmaceutical, Tokyo, Japan), cefozopran (Takeda Chemical Industries, Osaka, Japan); and nitrocefin (Oxoid, Hampshire, UK) were obtained commercially. Clavulanic acid (Augmentin; Smith Kline Beecham Seiyaku, Tokyo, Japan), sulbactam (Sulperazon; Pfizer Pharmaceuticals, Tokyo, Japan), cefcapene (Shionogi, Osaka, Japan), cefdinir (Fujisawa Pharmaceutical, Osaka, Japan), cefditoren (Meiji Seika Kaisha, Tokyo, Japan), cefteram (Toyama Chemical, Tokyo, Japan), and faropenem (Yamanouchi Pharmaceutical, Tokyo, Japan) were extracted, and deesterified if needed, from commercial products by Chemtech Labo. (Tokyo, Japan). Susceptibility test Susceptibilities of the transformants were determined by the agar dilution method of the National Committee for Clinical Laboratory Standards (NCCLS),14 and expressed as minimal inhibitory concentrations (MICs; µg/ml). For the prevention of plasmid curing during preculture on heart infusion agar (Eiken Chemical, Tokyo, Japan) plates, ampicillin (Wako Pure Chemical Industries, Osaka, Japan) was added to the preculture medium at 100 µg/ml. Mueller Hinton II agar (Becton Dickinson, Cockeysville, MD, USA) was used. Tazobactam was added to piperacillin at a weight ratio of 1 : 4, according to the formula of the commercially available combination. Similarly, clavulanic acid was added to piperacillin at a weight ratio of 1 : 4, and sulbactam was added to cefoperazone at a weight ratio of 1 : 1. E. coli ATCC 25922 and K. pneumoniae ATCC 700603 were used as the control strains.
Plasmids Plasmids pTEM-1, pTEM-2, pTEM-3, pTEM-5, and pTEM-9 were constructed from pUC19 (Takara Shuzo, Kyoto, Japan) by site-directed mutagenesis by the method of Deng and Nickoloff.15 The procedure employs two oligonucleotide mutagenic primers. One primer contains the desired mutation and the second contains a mutation in a unique, nonessential restriction site. Elimination of the site renders the mutated plasmid DNA resistant to restriction digestion, providing the basis for selection. A U.S.E. mutagenesis kit and SspI/StuI U.S.E. selection/toggle primers were obtained from Amersham Pharmacia Biotech (Tokyo, Japan). Target mutagenic primers were synthesized by Amersham Pharmacia Biotech, and their 5-termini were phosphorylated using ATP and T4 polynucleotide kinase (Amersham Pharmacia Biotech). The primers were designated as “TEM-” plus alteration of one or two amino acids at given residues to another one or two amino acids, respectively, and their sequences are listed in Table 1. Plasmid pSHV1216 was kindly provided by Dr. Yoshichika Arakawa (National Institute of Infectious Diseases, Tokyo), and plasmid pMTY0106 is described elsewhere. Preparation, digestion, and transformation of plasmids were carried out using conventional methods.17 Restriction enzymes were obtained commercially: SspI and StuI were from Amersham Pharmacia Biotech; HincII, PstI, and Sau3AI were from Toyobo (Osaka, Japan); Cfr10I was from Takara Shuzo; and MseI and NlaIII were from New England Biolabs (Beverly, MA, USA). Each plasmid was introduced into E. coli JM109 (Takara Shuzo). As a selective agent, ampicillin (Wako Pure Chemical Industries) was added to the media at final concentrations of 50 or 100 µg/ml. Sequencing DNA sequences of the mutated plasmids were determined by a cycle sequencing method, using the PRISM BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied BioSystems Japan, Chiba, Japan). Sequencing primers were synthesized by Amersham Pharmacia Biotech, and their sequences are listed in Table 1. The extension products were purified using Centri-Sep Columns (Princeton Separations, Adelphia, NJ, USA). The purified products were automatically analyzed in an ABI PRISM 3700 DNA sequencer. Program DNASIS (v3.6, Macintosh edition, Hitachi Software Engineering, Kanagawa, Japan) was used for sequence matching. Purification of TEM enzymes The TEM enzymes were purified by the method of Raquet et al.18 The E. coli strains harboring the plasmids coding for the TEM enzymes were grown at 37°C overnight in 400 ml of Luria-Bertani broth containing 50 µg/ml of ampicillin. The cells were collected by centrifugation and the periplasmic fraction was liberated by lysozyme treatment.
213 Table 1. Sequences of the primers used in site-directed mutagenesis and sequencing Primer Selection/toggle primers U.S.E. SspI/StuI selection primer U.S.E. StuI/SspI toggle primer Mutagenic primers TEM-L19F TEM-Q37K TEM-I82V TEM-E102K TEM-R162S TEM-V182A TEM-A235T E237K TEM-G236S TEM-T261M Sequencing primers TEM-F11 TEM-F12 TEM-F13 TEM-R11 TEM-R12 TEM-R13
Sequence (5Æ3)
Position
CTCTTCCTTTTTCAGGCCTATTGAAGCATTTATCAGG CTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGG
Complementary to 883 to 847 Complementary to 883 to 847
GCAAAAACAGGAAAGCAAAATGCCGC CGTGCACCCAACTTATCTTCAGCATC GCTCTTGCCCGGCGTCAACACGGGATAATACC GACTGGTGAGTACTTAACCAAGTCATTC CCGGTTCCCAACTATCAAGGCGAG CGTTGTTGCCATTGCTGCAGGCATCGTGG CCGCGAGACCCACGCTTACCGGTTCCAGATTTATCAGC GACCCACGCTCACTGGCTCCAGATTTATCAGC CTGACTCCCCGTCATGTAGATAACTAC
Complementary to 952 to 927 Complementary to 1006 to 981 Complementary to 1146 to 1115 Complementary to 1202 to 1175 Complementary to 1380 to 1357 Complementary to 1445 to 1417 Complementary to 1609 to 1572 Complementary to 1603 to 1572 Complementary to 1679 to 1653
GTATCCGCTCATGAGAC GTTTTCCAATGATGAGCAC CTGGCGAACTACTTACTC GTGCTCATCATTGGAAAAC GAGTAAGTAGTTCGCCAG GGATCTTCACCTAGATCC
824 to 840 1072 to 1090 1462 to 1479 Complementary to 1090 to 1072 Complementary to 1479 to 1462 Complementary to 1827 to 1810
The desired mutations are denoted in boldface
The supernatant was then dialyzed against 10 mM Tris-HCl buffer (pH 7.5) and loaded onto a UNO Q-12 column (BioRad Laboratories, Hercules, CA, USA) equilibrated with the same buffer. The enzymes were eluted with a linear NaCl gradient (250 mM final) over ten column volumes by using an ÄKTApurifier system (Amersham Pharmacia Biotech). The active fractions were pooled, dialyzed against 10 mM Tris-HCl buffer (pH 6.5), and loaded onto the same column. The enzymes were eluted under isocratic conditions with the same buffer. The purity of all the enzyme preparations was verified by sodium dodecyl sulfate-polyacrylamide electrophoresis, followed by staining with Coomassie Brilliant Blue R-250. All preparations were more than 80% pure.
the first-order rate constants for acylation and deacylation, respectively. If k3 is very low or equal to zero, the β-lactam compound becomes a transient or irreversible inactivator. The steady-state kinetic parameters (Km and kcat) were determined by analyzing the complete hydrolysis time courses, as described by De Meester et al.19 In some cases, Km was measured as Ki, the dissociation constant of the enzyme-inhibitor complex, in competition experiments with 10–100 µM nitrocefin as a reporter substrate. The individual parameters k2 and K were calculated by linearization of the equation, as follows:
ki k3
Determination of kinetic parameters Hydrolysis of the compounds by TEM enzymes was followed by monitoring the changes in absorbance of the βlactams in 50 mM sodium phosphate buffer (pH 7.2) on a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan). The reactions were performed in a total volume of 500 µl at 30°C. For dilution of the β-lactamases, 50 mM sodium phosphate buffer containing 1 mg/ml of bovine serum albumin (pH 7.2) was used in order to prevent enzyme denaturation. For analysis of the kinetics of the hydrolysis reaction catalyzed by β-lactamase, the following simple linear threestep model was applied: k1 k2 k3 ææ Æ E S¨ ææ ES ææÆ ES * ææÆ E P(s ) k1
where E is the enzyme, S is the substrate or inhibitor (βlactam compound), P(s) are the inactive degradation product(s) of the antibiotic, ES is the Michaelis complex, ES* is the acyl-enzyme intermediate, and k2 and k3 are
k2 [I] Ê K [S] ˆ K ¢Á ˜ [ I] s Ë Km ¯ s m
where Kms and [S] are the Km for and concentration of the reporter substrate, respectively; kcat/Km is the apparent second-order rate constant for substrate hydrolysis, corresponding to the apparent second-order rate constant for acyl-enzyme formation (k2/K). The extinction coefficients (Dε, DAbsorbance/mM per cm) and wavelengths (nm) used were 10.0 and 482 for nitrocefin, 1.14 and 233 for penicillin G, 7.66 and 262 for cephalothin, 7.25 and 264 for cefotaxime, 10.3 and 265 for ceftazidime, 8.38 and 275 for cefmetazole, 9.63 and 300 for panipenem, and 10.2 and 300 for R-95867, respectively.
Results Construction of plasmids carrying the blaTEM genes Plasmid pBR32220 carries AmpR (the blaRTEM gene) which encodes typical RTEM (TEM-1) β-lactamase as a selective
214
marker. In the first round of mutagenesis, two conflicts between pUC1921 and pBR322 were reverse-mutated, accompanied by an alteration of the unique SspI site to a StuI site. The conflicts were A and T at nucleotides 1128 and 1429 of pUC19, which correspond to G and C at nucleotides 3910 and 3609 of the source plasmid pBR322, respectively. When mutagenic primers TEM-I82V and TEM-V182A were used, new HincII (GT[CT][AG]AC) and PstI (CTGCAG) sites were generated at nucleotides 1128 and 1426, respectively (5-terminal of the site). In the second round of mutagenesis, mutations of the residues that lead to an extended substrate spectrum of the enzyme3,22 were introduced, accompanying an alteration of the new StuI site to the ex-SspI site. Besides the StuI/SspI toggle primer, other mutagenic primers were used: TEMQ37K, TEM-E102K, and TEM-G236S for constructing pTEM-3, which carries a mutated blaTEM gene encoding TEM-3 (CTX-1) β-lactamase; TEM-R162S, and TEMA235T E237K for pTEM-5 encoding TEM-5 (CAZ-1); and TEM-L19F, TEM-E102K, TEM-R162S, and TEM-T261M for pTEM-9 encoding TEM-9 (RHH-1). When mutagenic primers TEM-E102K and TEM-T261M were used, new MseI (TTAA) and NlaIII (CATG) sites were generated at nucleotides 1186 and 1664, respectively. In contrast, when mutagenic primers TEM-Q37K, TEM-R162S, and TEMG236S or TEM-A235T E237K were used, the mutations led to the loss of Sau3AI (GATC), Sau3AI, and Cfr10I ([AG]CCGG[TC]) sites at nucleotides 990, 1365, and 1587, respectively. After carrying out a series of mutagenesis-selection steps, the introduction of the target mutations was screened by checking the generation and loss of the restriction sites, followed by sequencing of the region encompassing the mutated blaTEM genes for confirmation. Desired plasmids pTEM-3, pTEM-5, and pTEM-9 were obtained, and plasmids pTEM-1 and pTEM-2, which carry the parent nonESBL β-lactamase genes, were also obtained.
TEM-2 β-lactamase producers were comparable to those against the host strain JM109. The MICs of the parenteral cephalosporins tested, except for cefpirome, against TEMand SHV-type ESBL producers were increased more than 16 times compared with those against the host strain. Moreover, the MICs of these cephalosporins against the Toho-1 producer increased more than 256 times, showing MICs of 32 µg/ml or higher. Cefpirome showed a similar tendency; however, the magnitude of the increase in MICs was smaller than that for the other parenteral cephalosporins tested. Among the parenteral cephalosporins tested, ceftazidime was the most affected by all the types of ESBLs tested. The MICs of cefmetazole, a cephamycin, against the transformants, as well as the host, were 1 or 2 µg/ml and almost unchanged. The MICs of cefdinir, cefditoren, cefpodoxime, and cefteram against TEM- and SHV-type ESBL-producers were increased more than 16 times compared with those against the host, except for the MIC of cefdinir against JM109 containing pTEM-9, which was 0.5 µg/ml and almost unchanged. In contrast, the increases in the MICs of cefcapene against TEM- and SHV-type ESBL-producers were marginal. The MIC of each oral cephalosporin tested against the transformant that produces Toho-1 β-lactamase was greater than 128 µg/ml. The MIC of imipenem against the host and transformants was uniformly 0.12 µg/ml. Meropenem and panipenem showed similar tendencies, i.e., comparable MICs against the host and transformants. The MICs of R95867 against transformants containing plasmids carrying TEM- and SHV-type ESBL genes were 0.016 or 0.03 µg/ml, showing that the magnitude of increase in MICs was two to four times that against the host. The MIC of R-95867 against the Toho-1 producer rose 32 times, compared with that against the host, but was still as low as 0.25 µg/ml. This group showed the lowest values among the MICs of the βlactam antibiotics tested. The antibacterial activity of faropenem, a penem, was also only slightly affected by the ESBLs.
Antibacterial activities of β-lactam antibiotics against ESBL producers
Kinetic analysis
Table 2 shows the antibacterial activities of 23 β-lactam antibiotics against the host strain E. coli JM109 and its transformants, determined by the agar dilution method, and MIC interpretive standards stipulated by NCCLS.23 The MICs of ampicillin were greater than 128 µg/ml, not only against ESBL producers but also against the parent TEMtype β-lactamase producers containing pTEM-1 and pTEM-2. Although the activity of piperacillin was also greatly affected by transformation with the plasmids, the magnitude of decrease in the activity of piperacillin became much smaller by combination with clavulanic acid or tazobactam. Similarly, combination of cefoperazone with sulbactam restored, to a smaller extent, the activity of cefoperazone against β-lactamase producers in comparison with cefoperazone alone. Besides that of cefoperazone, the MICs of the parenteral and oral cephalosporins tested against parental RTEM and
Table 3 shows the kinetic parameters of seven β-lactam antibiotics with four TEM-type β-lactamases. The parent enzyme RTEM showed typical penicillinase activity: penicillin G was hydrolyzed more easily than cephalothin by the enzyme. With penicillin G, the kcat and Km values were eight times as high and less than a seventh as high as those of cephalothin, respectively, leading to a 65 times higher kcat/ Km ratio. Because the parameters for cefotaxime could not be calculated, due to little hydrolysis by and weak inhibition of the RTEM enzyme, no further examination was attempted between the remaining substrates and RTEM. For the three enzymes TEM-3, TEM-5, and TEM-9, the penicillinase activity was decreased, with a more marked reduction in the kcat, and therefore in the kcat/Km ratio. Cefotaxime was only slightly but certainly degraded by TEM-3 with low catalytic efficiency. Because the affinities of ceftazidime and cefmetazole to TEM-3 were very low,
128 128 8/0.53 16/4 4/4 0.03 1 8 0.06 0.06 0.06 0.03 0.12 0.5 0.25 0.25 0.5 0.5 0.12 0.016 0.06 0.016 1
4 4 2/0.13 2/0.5 0.25/0.25 0.016 1 0.25 0.06 0.06 0.06 0.03 0.12 0.5 0.25 0.25 0.5 0.25 0.12 0.016 0.06 0.008 1
pTEM-1 (RTEM)
b
a
MIC, minimum inhibitory concentration Each value is the median of three determinations Cited from reference 23: S, susceptible; I, intermediate; R, resistant c ND Not defined
Penicillins Ampicillin Piperacillin β-Lactam/β-lactamase inhibitor combinations Piperacillin/clavulanic acid Piperacillin/tazobactam Cefoperazone/sulbactam Cephems (parenteral) Cefepime Cefmetazole Cefoperazone Cefotaxime Cefozopran Cefpirome Ceftriaxone Ceftazidime Cephems (oral) Cefcapene Cefdinir Cefditoren Cefpodoxime Cefteram Carbapenems Imipenem Meropenem Panipenem R-95867 Penem Faropenem
None
1
0.12 0.016 0.06 0.016
0.5 0.25 0.25 0.5 0.5
0.06 1 16 0.06 0.06 0.06 0.03 0.12
8/0.53 16/4 4/4
128 128
pTEM-2 (TEM-2)
1
0.12 0.016 0.06 0.03
0.5 4 16 64 32
0.5 1 16 8 2 2 8 16
2/0.13 1/0.25 1/1
128 128
pTEM-3 (TEM-3)
2
0.12 0.016 0.06 0.03
0.5 8 4 16 4
0.25 1 8 1 1 0.5 2 32
2/0.13 4/1 1/1
128 32
pTEM-5 (TEM-5)
2
0.12 0.016 0.06 0.03
0.5 0.5 8 32 8
2 1 32 1 2 4 1 128
4/0.27 4/1 2/2
128 128
pTEM-9 (TEM-9)
1
0.12 0.016 0.06 0.016
1 4 4 32 8
0.25 1 4 4 1 0.5 4 32
1/0.07 2/0.5 1/1
128 64
pSHV12 (SHV-12)
MIC (µg/ml) against E. coli JM109 containing a plasmid (β-Lactamase type encoded)a
Table 2. In vitro antibacterial activities of 23 β-lactam antibiotics against Escherichia coli JM109 and its β-lactamase-producing transformants
Antimicrobial agent
ND 2 ND 4 ND 8 8 ND ND
ND 1 ND 2 ND 4 4 ND ND
128 128 128 128 128
4
0.12 0.03 0.12 0.25
ND
16 32 32 16–32 ND ND 16–32 16
8 16 16 8 ND ND 8 8 64 2 128 128 128 8 128 32
ND
ND 32/4–64/4 ND
4/0.27 2/0.5 8/8
NDc 16/4 ND
I 16 32–64
S 8 16
128 128
pMTY010 (Toho-1)
MIC (µg/ml) Interpretive standardb
ND
16 16 ND ND
ND 4 ND 8 ND
32 64 64 64 ND ND 64 32
ND 128/4 ND
32 128
R
215
216 Table 3. Kinetic parameters of β-lactam substrates with TEM-type β-lactamases Substrate
Penicillin G Cephalothin Cefotaxime Ceftazidime Cefmetazole Panipenem R-95867
TEM-1 (RTEM)
TEM-3 (CTX-1)
TEM-5 (CAZ-1)
TEM-9 (RHH-1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
2200 270 –b NDc ND ND ND
31 240 – ND ND ND ND
71 1.1 – ND ND ND ND
18 9.3 0.77 – – 9.3 103d 9.1 103d
29a 5.4 120 5600a 660a – –
0.64 1.7 6.3 103 – – 3.2 104e 4.7 104e
8.7 16 – 14 4.1 103d 1 103d 2.4 103
8.7a 110a 140a 100 – 0.56f 0.96a
1.0 0.15 – 0.13 2.4 104e 0.044e 2.5 103
27 12 2.6 27 5 103d 9 103d 6 103d
45a 90 13 110 280f 1.4f 1.9f
0.60 0.13 0.21 0.24 1.1 104e 4.3 103e 9.9 103e
See text for definitions of kinetic parameters a Km was obtained as Ki, using nitrocefin as the reporter substrate b –, Not measurable c ND, Not determined d kcat was obtained as k3 e kcat/Km was obtained as k2/K f Km was obtained as K
showing Km (Ki) values of more than 660 µM, the saturating concentrations of the substrates were too high to determine the maximal rate of degradation of the substrates spectrophotometrically. The kcat values for TEM-3 with the carbapenems panipenem and R-95867 were less than 1/1000, compared with the value with penicillin G. In contrast, ceftazidime was moderately hydrolyzed by TEM-5, with a kcat value similar to that with cephalothin. The kcat values with the cephamycin, cefmetazole, and carbapenems were in the order of 103 s1 and this result suggested that these substrates were stable to hydrolysis by the enzyme. Panipenem showed inactivation of this enzyme. Cefotaxime and ceftazidime were relatively good substrates for TEM-9, with kcat/Km ratios being greater than a third of that for penicillin G. Cefmetazole, panipenem, and R-95867 were, again, scarcely hydrolyzed by this enzyme, thus showing quite low efficiencies, and they behaved as inactivators of the enzyme.
Discussion Comparative activities of currently available β-lactam antibiotics against five ESBL producers were tested. The results were in good accordance with previous reports in the respect that the MICs against TEM- and SHV-type ESBL producers were higher with ceftazidime than with cefotaxime, and vice versa against a Toho-1 producer.3,4,6 It is noteworthy that the MICs of penicillins, cefoperazone, and β-lactam/β-lactamase inhibitors against parent TEM-type β-lactamase producers containing pTEM-1 and pTEM-2 were comparable to, or higher than, those against the TEMtype ESBL producers tested. According to the standards of the NCCLS,23 all β-lactamase producers were interpreted as being nonsusceptible to the penicillins tested; however, this was apparently reversed in combination with β-lactamase inhibitors. The TEM- and SHV-type ESBL producers were
susceptible to the parenteral cephalosporins, other than cefoperazone and ceftazidime, although the MICs were increased more than eight times compared with those against the host strain and the parental RTEM producer. In contrast, the ESBL producers appeared not to be susceptible to oral cephalosporins, except for cefcapene. The Toho-1 producer was seemingly resistant to both parenteral and oral cephalosporins tested; however, cefpirome was the exception. On the other hand, the present results show that the activities of carbapenems, a cephamycin (cefmetazole), and a penem were virtually unchanged against the ESBL producers tested against. This property is one of the advantages of these groups of β-lactam compounds over cephalosporins and penicillins. The activity of R-95867 was only slightly affected by the ESBLs; this was probably due to the differences in chemical profiles among the carbapenems. R-95867 is an anionic compound, while imipenem, meropenem, and panipenem are zwitterionic compounds. An inappropriate selection or dosage regimen of antimicrobial agents that is not fully effective against ESBL producers will not only lead to clinical failure in an individual patient but will also provide these epidemic producers with a breeding ground and result in a serious outbreak of nosocomial infections by them. Peña et al.24 reported that the restricted use of oxyiminocephalosporins was effective for the eradication of ESBL producers. Furthermore, some class A β-lactamases are resistant to β-lactamase inhibitors,22,25 and many ESBL producers showed multidrug resistance to aminoglycosides, fluoroquinolones and so forth.3,4 Prudent use of antimicrobial agents is required to prevent an increase in the prevalence of ESBL producers. The development of many new ESBLs has been caused by spontaneous mutations in wild-type β-lactamases. In this study, each ESBL gene was subcloned into a plasmid and the plasmid was introduced into the same host strain. Therefore, the contribution of other resistance mechanisms and of differences in β-lactamase expression levels could be excluded, at least among the TEM-type β-lactamase producers. The results of the susceptibility test and kinetic analysis reinforced the idea that the behavior of TEM-type
217
β-lactamases derived from mutant plasmids constructed by site-directed mutagenesis was consistent with the behavior of those of natural origin.3,4 This strategy will accelerate the development of study in this field, especially in a country such as Japan, where ESBL producers are rarely isolated. However, the fact that ESBL producers are frequently found in countries in which there are high levels of travel and transport interchange with Japan could increase the incidence of these producers here in Japan in the near future. Furthermore, this possibility is increasing as the levels of β-lactamase producers are rising rapidly worldwide, so it is never too early to start preventive measures. Acknowledgments We thank Dr. Yoshichika Arakawa, National Institute of Infectious Diseases, for generously providing plasmid pSHV12. This study was presented in part at the 48th General Meeting of the West Japan Branch of the Japanese Society of Chemotherapy, Kyoto, 7 and 8 December 2000, and was recommended by the chairman to be submitted to this journal. We are grateful to many members of the committee of the society who participated in this matter.
References 1. Knothe H, Shah P, Krcmery V, Antal M, Mitsuhashi S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 1983;11:315–7. 2. Jacoby GA. Epidemiology of extended-spectrum β-lactamases. Clin Infect Dis 1998;27:81–3. 3. Philippon A, Labia R, Jacoby G. Extended-spectrum β-lactamases. Antimicrob Agents Chemother 1989;33:1131–6. 4. Jacoby GA, Medeiros AA. More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991;35:1697–704. 5. Kurokawa H, Oguro K, Nagata A, Suzuki K, Arakawa Y. A report of ceftazidime-resistant Klebsiella pneumoniae (in Japanese). Jpn J Chemother 1995;43:462–3. 6. Ishii Y, Ohno A, Taguchi H, Imajo S, Ishiguro M, Matsuzawa H. Cloning and sequence of the gene encoding a cefotaximehydrolyzing class A β-lactamase isolated from Escherichia coli. Antimicrob Agents Chemother 1995;39:2269–75. 7. Yagi T, Kurokawa H, Senda K, Ichiyama S, Ito H, Ohsuka S, et al. Nosocomial spread of cephem-resistant Escherichia coli strains carrying multiple Toho-1-like β-lactamase genes. Antimicrob Agents Chemother 1997;41:2606–11. 8. Ma L, Ishii Y, Ishiguro M, Matsuzawa H, Yamaguchi K. Cloning and sequencing of the gene encoding Toho-2, a class A β-lactamase preferentially inhibited by tazobactam. Antimicrob Agents Chemother 1998;42:1181–6. 9. Matsumoto Y, Inoue M. Characterization of SFO-1, a plasmidmediated inducible class A β-lactamase from Enterobacter cloacae. Antimicrob Agents Chemother 1999;43:307–13.
10. Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 1995;39:1211–33. 11. Yagi T, Kurokawa H, Shibata N, Shibayama K, Arakawa Y. A preliminary survey of extended-spectrum β-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. FEMS Microbiol Lett 2000;184:53–6. 12. Kuga A, Yano H, Okamoto R, Sato Y, Miyata A, Inoue M. Antibacterial activity of β-lactam antibiotics against extendedspectrum β-lactamase producing bacteria (in Japanese). Jpn J Antibiot 1999;52:585–94. 13. Fukuoka T, Ohya S, Utsui Y, Domon H, Takenouchi T, Koga T, et al. In vitro and in vivo antibacterial activities of CS-834, a novel oral carbapenem. Antimicrob Agents Chemother 1997;41:2652–63. 14. National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 5th Ed. Approved standard M7-A5. Wayne, PA: National Committee for Clinical Laboratory Standards; 2000. 15. Deng WP, Nickoloff JA. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal Biochem 1992;200:81–8. 16. Nakamura T, Uchida S, Heijyo H, Masuda M, Takahashi H, Komatsu M, et al. An SHV-derived extended-spectrum βlactamase (SHV-12) produced by an Escherichia coli recovered from wound abscess in post-operative case with rectal carcinoma (in Japanese). Kansenshogaku Zasshi (J Jpn Assoc Infect Dis) 2000;74:112–9. 17. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd Ed. New York: Cold Spring Harbor Laboratory Press; 1989. 18. Raquet X, Lamotte-Brasseur J, Fonzé E, Goussard S, Courvalin P, Frère JM. TEM β-lactamase mutants hydrolysing third-generation cephalosporins. A kinetic and molecular modeling analysis. J Mol Biol 1994;244:625–39. 19. De Meester F, Joris B, Reckinger G, Bellefroid-Bourguignon C, Frère JM. Automated analysis of enzyme inactivation phenomena. Application to β-lactamases and dd-peptidases. Biochem Pharmacol 1987;36:2393–403. 20. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, Boyer HW. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 1977;2:95– 113. 21. Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985;33:103–19. 22. Knox JR. Extended-spectrum and inhibitor-resistant TEM-type βlactamases: mutations, specificity, and three-dimensional structure. Antimicrob Agents Chemother 1995;39:2593–601. 23. National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial susceptibility testing. Eleventh informational supplement M100-S11. Wayne, PA: National Committee for Clinical Laboratory Standards; 2001. 24. Peña C, Pujol M, Ardanuy C, Ricart A, Pallares R, Liñares J, et al. Epidemiology and successful control of a large outbreak due to Klebsiella pneumoniae producing extended-spectrum βlactamases. Antimicrob Agents Chemother 1998;42:53–8. 25. Chaïbi EB, Sirot D, Paul G, Labia R. Inhibitor-resistant TEM βlactamases: phenotypic, genetic and biochemical characteristics. J Antimicrob Chemother 1999;43:447–58.
© Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases 2002
ORIGINAL ARTICLE
Takashi Takenouchi · Yoshikazu Ishii · Keizo Yamaguchi
Properties of extended-spectrum β-lactamases constructed by site-directed mutagenesis
Received: December 25, 2001 / Accepted: April 15, 2002
Abstract Plasmids carrying three types of TEM-type extended-spectrum β-lactamase (ESBL) genes, encoding TEM-3, TEM-5, and TEM-9, respectively, were constructed by site-directed mutagenesis. ESBL producers were prepared by transformation of Escherichia coli JM109 with a plasmid carrying one gene of either the three TEM types, an SHV-type, or a Toho-1 group gene. This strategy with the same vector and host strain can exclude the contribution of other factors to susceptibility, and is useful in Japan, where few TEM-type ESBL producers have been isolated. In vitro antibacterial activities of 23 β-lactam antibiotics were tested against the ESBL producers by the agar dilution method, and the results were compared. The minimum inhibitory concentrations (MICs) of penicillins tested were more than 32 µg/ml against both the parental RTEM and ESBL producers, but they were substantially decreased by a combination with β-lactamase inhibitors. Compared with the MICs against the ESBL-nonproducing host strain, the MICs of the cephalosporins tested for the ESBL producers were increased more than eight times in most cases and in several cases soared to more than 2048 times against a Toho-1 ESBL producer. On the other hand, the MICs of carbapenem, cephamycin, and penem antibiotics were generally comparable to those against the host strain, and were increased by 32 times at most. Kinetic analysis revealed that extended-spectrum cephalosporins were hydrolyzed only slightly to moderately by the TEM-type ESBLs, while carbapenems and a cephamycin were scarcely hydrolyzed, and rather inhibited or inactivated the mutant enzymes.
T. Takenouchi (*) Biological Research Laboratories, Sankyo Co., Ltd., 2-58 Hiromachi 1-chome, Shinagawa-ku, Tokyo 140-8710, Japan Tel. 81-3-3492-3131; Fax 81-3-5436-8566 e-mail: [email protected] T. Takenouchi · Y. Ishii · K. Yamaguchi Department of Microbiology, Toho University School of Medicine, Tokyo, Japan
Key words Site-directed mutagenesis · β-Lactam antibiotics · MIC · Kinetics · Carbapenem · Cephamycin
Introduction Klebsiella pneumoniae strains showing transmissible resistance to broad-spectrum cephalosporins were first reported in Europe in 1983.1 Later it was discovered that the resistance mechanism in these strains was due to the production of extended-spectrum β-lactamase (ESBL), which has the ability to hydrolyze the extended-spectrum cephalosporins. Most ESBLs are variants of common TEM- or SHV-type βlactamases that have undergone one or more amino-acid substitutions near the active site of the enzyme. This results in an increase in its affinity for and hydrolytic ability towards broadspectrum cephalosporins and monobactams such as aztreonam.2–4 ESBL-producing strains are found worldwide, usually in hospitals, and are problematic because they are one of the major causes of outbreaks of nosocomial infection. In many cases, these enzymes are encoded by plasmids that can transfer resistance to other species of Enterobacteriaceae, such as Escherichia coli and K. pneumoniae.2–4 In Japan the emergence of ceftazidime-resistant K. pneumoniae was first reported in 1995.5 Since then, Toho-1 group β-lactamase-producing E. coli strains and an SFO-1 β-lactamase-producing Enterobacter cloacae strain have been reported.6–9 These enzymes are functionally classified, in a broad sense, as members of ESBLs (group 2be).10 Toho-1 group ESBL producers seem to be dominant over TEM- and SHV-type ESBL producers; however, the SHVtype ESBL producers have been more frequently isolated than has been expected.11 Although ESBL producers are of clinical concern, few studies have been reported on the comparative antibacterial activities of newer β-lactam antibiotics, which reflect current Japanese clinical settings, against a series of ESBL producers.12 In this report, three TEM-type ESBL genes were constructed by the introduction of site-directed muta-
212
tions to an AmpR selective marker on a plasmid, because ESBL producers, especially TEM-type ESBL-producing strains, are still rarely isolated from clinical samples in Japan. In vitro antimicrobial activities of several groups of β-lactam antibiotics were tested and compared against five types of class A ESBL producers. To confirm the results of the susceptibility test, kinetic parameters were also calculated between the TEM-type ESBLs and selected cephem and carbapenem antibiotics, which showed a great difference in the magnitude of decrease in activity by the βlactamases.
Materials and methods Antimicrobial agents Standard samples of ampicillin, ceftriaxone, ceftazidime, imipenem, and meropenem were obtained from the National Institute of Infectious Diseases (Tokyo, Japan). Tazobactam, cefpodoxime, panipenem, and R-95867, the active metabolite of the orally active carbapenem antibiotic CS-834,13 were synthesized by Sankyo (Tokyo, Japan). Piperacillin, cefoperazone, and cephalothin (Sigma Chemical, St. Louis, MO, USA); cefepime (BristolMyers Squibb, Tokyo, Japan); cefmetazole (Sankyo), cefotaxime, and cefpirome (Chugai Pharmaceutical, Tokyo, Japan), cefozopran (Takeda Chemical Industries, Osaka, Japan); and nitrocefin (Oxoid, Hampshire, UK) were obtained commercially. Clavulanic acid (Augmentin; Smith Kline Beecham Seiyaku, Tokyo, Japan), sulbactam (Sulperazon; Pfizer Pharmaceuticals, Tokyo, Japan), cefcapene (Shionogi, Osaka, Japan), cefdinir (Fujisawa Pharmaceutical, Osaka, Japan), cefditoren (Meiji Seika Kaisha, Tokyo, Japan), cefteram (Toyama Chemical, Tokyo, Japan), and faropenem (Yamanouchi Pharmaceutical, Tokyo, Japan) were extracted, and deesterified if needed, from commercial products by Chemtech Labo. (Tokyo, Japan). Susceptibility test Susceptibilities of the transformants were determined by the agar dilution method of the National Committee for Clinical Laboratory Standards (NCCLS),14 and expressed as minimal inhibitory concentrations (MICs; µg/ml). For the prevention of plasmid curing during preculture on heart infusion agar (Eiken Chemical, Tokyo, Japan) plates, ampicillin (Wako Pure Chemical Industries, Osaka, Japan) was added to the preculture medium at 100 µg/ml. Mueller Hinton II agar (Becton Dickinson, Cockeysville, MD, USA) was used. Tazobactam was added to piperacillin at a weight ratio of 1 : 4, according to the formula of the commercially available combination. Similarly, clavulanic acid was added to piperacillin at a weight ratio of 1 : 4, and sulbactam was added to cefoperazone at a weight ratio of 1 : 1. E. coli ATCC 25922 and K. pneumoniae ATCC 700603 were used as the control strains.
Plasmids Plasmids pTEM-1, pTEM-2, pTEM-3, pTEM-5, and pTEM-9 were constructed from pUC19 (Takara Shuzo, Kyoto, Japan) by site-directed mutagenesis by the method of Deng and Nickoloff.15 The procedure employs two oligonucleotide mutagenic primers. One primer contains the desired mutation and the second contains a mutation in a unique, nonessential restriction site. Elimination of the site renders the mutated plasmid DNA resistant to restriction digestion, providing the basis for selection. A U.S.E. mutagenesis kit and SspI/StuI U.S.E. selection/toggle primers were obtained from Amersham Pharmacia Biotech (Tokyo, Japan). Target mutagenic primers were synthesized by Amersham Pharmacia Biotech, and their 5-termini were phosphorylated using ATP and T4 polynucleotide kinase (Amersham Pharmacia Biotech). The primers were designated as “TEM-” plus alteration of one or two amino acids at given residues to another one or two amino acids, respectively, and their sequences are listed in Table 1. Plasmid pSHV1216 was kindly provided by Dr. Yoshichika Arakawa (National Institute of Infectious Diseases, Tokyo), and plasmid pMTY0106 is described elsewhere. Preparation, digestion, and transformation of plasmids were carried out using conventional methods.17 Restriction enzymes were obtained commercially: SspI and StuI were from Amersham Pharmacia Biotech; HincII, PstI, and Sau3AI were from Toyobo (Osaka, Japan); Cfr10I was from Takara Shuzo; and MseI and NlaIII were from New England Biolabs (Beverly, MA, USA). Each plasmid was introduced into E. coli JM109 (Takara Shuzo). As a selective agent, ampicillin (Wako Pure Chemical Industries) was added to the media at final concentrations of 50 or 100 µg/ml. Sequencing DNA sequences of the mutated plasmids were determined by a cycle sequencing method, using the PRISM BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied BioSystems Japan, Chiba, Japan). Sequencing primers were synthesized by Amersham Pharmacia Biotech, and their sequences are listed in Table 1. The extension products were purified using Centri-Sep Columns (Princeton Separations, Adelphia, NJ, USA). The purified products were automatically analyzed in an ABI PRISM 3700 DNA sequencer. Program DNASIS (v3.6, Macintosh edition, Hitachi Software Engineering, Kanagawa, Japan) was used for sequence matching. Purification of TEM enzymes The TEM enzymes were purified by the method of Raquet et al.18 The E. coli strains harboring the plasmids coding for the TEM enzymes were grown at 37°C overnight in 400 ml of Luria-Bertani broth containing 50 µg/ml of ampicillin. The cells were collected by centrifugation and the periplasmic fraction was liberated by lysozyme treatment.
213 Table 1. Sequences of the primers used in site-directed mutagenesis and sequencing Primer Selection/toggle primers U.S.E. SspI/StuI selection primer U.S.E. StuI/SspI toggle primer Mutagenic primers TEM-L19F TEM-Q37K TEM-I82V TEM-E102K TEM-R162S TEM-V182A TEM-A235T E237K TEM-G236S TEM-T261M Sequencing primers TEM-F11 TEM-F12 TEM-F13 TEM-R11 TEM-R12 TEM-R13
Sequence (5Æ3)
Position
CTCTTCCTTTTTCAGGCCTATTGAAGCATTTATCAGG CTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGG
Complementary to 883 to 847 Complementary to 883 to 847
GCAAAAACAGGAAAGCAAAATGCCGC CGTGCACCCAACTTATCTTCAGCATC GCTCTTGCCCGGCGTCAACACGGGATAATACC GACTGGTGAGTACTTAACCAAGTCATTC CCGGTTCCCAACTATCAAGGCGAG CGTTGTTGCCATTGCTGCAGGCATCGTGG CCGCGAGACCCACGCTTACCGGTTCCAGATTTATCAGC GACCCACGCTCACTGGCTCCAGATTTATCAGC CTGACTCCCCGTCATGTAGATAACTAC
Complementary to 952 to 927 Complementary to 1006 to 981 Complementary to 1146 to 1115 Complementary to 1202 to 1175 Complementary to 1380 to 1357 Complementary to 1445 to 1417 Complementary to 1609 to 1572 Complementary to 1603 to 1572 Complementary to 1679 to 1653
GTATCCGCTCATGAGAC GTTTTCCAATGATGAGCAC CTGGCGAACTACTTACTC GTGCTCATCATTGGAAAAC GAGTAAGTAGTTCGCCAG GGATCTTCACCTAGATCC
824 to 840 1072 to 1090 1462 to 1479 Complementary to 1090 to 1072 Complementary to 1479 to 1462 Complementary to 1827 to 1810
The desired mutations are denoted in boldface
The supernatant was then dialyzed against 10 mM Tris-HCl buffer (pH 7.5) and loaded onto a UNO Q-12 column (BioRad Laboratories, Hercules, CA, USA) equilibrated with the same buffer. The enzymes were eluted with a linear NaCl gradient (250 mM final) over ten column volumes by using an ÄKTApurifier system (Amersham Pharmacia Biotech). The active fractions were pooled, dialyzed against 10 mM Tris-HCl buffer (pH 6.5), and loaded onto the same column. The enzymes were eluted under isocratic conditions with the same buffer. The purity of all the enzyme preparations was verified by sodium dodecyl sulfate-polyacrylamide electrophoresis, followed by staining with Coomassie Brilliant Blue R-250. All preparations were more than 80% pure.
the first-order rate constants for acylation and deacylation, respectively. If k3 is very low or equal to zero, the β-lactam compound becomes a transient or irreversible inactivator. The steady-state kinetic parameters (Km and kcat) were determined by analyzing the complete hydrolysis time courses, as described by De Meester et al.19 In some cases, Km was measured as Ki, the dissociation constant of the enzyme-inhibitor complex, in competition experiments with 10–100 µM nitrocefin as a reporter substrate. The individual parameters k2 and K were calculated by linearization of the equation, as follows:
ki k3
Determination of kinetic parameters Hydrolysis of the compounds by TEM enzymes was followed by monitoring the changes in absorbance of the βlactams in 50 mM sodium phosphate buffer (pH 7.2) on a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan). The reactions were performed in a total volume of 500 µl at 30°C. For dilution of the β-lactamases, 50 mM sodium phosphate buffer containing 1 mg/ml of bovine serum albumin (pH 7.2) was used in order to prevent enzyme denaturation. For analysis of the kinetics of the hydrolysis reaction catalyzed by β-lactamase, the following simple linear threestep model was applied: k1 k2 k3 ææ Æ E S¨ ææ ES ææÆ ES * ææÆ E P(s ) k1
where E is the enzyme, S is the substrate or inhibitor (βlactam compound), P(s) are the inactive degradation product(s) of the antibiotic, ES is the Michaelis complex, ES* is the acyl-enzyme intermediate, and k2 and k3 are
k2 [I] Ê K [S] ˆ K ¢Á ˜ [ I] s Ë Km ¯ s m
where Kms and [S] are the Km for and concentration of the reporter substrate, respectively; kcat/Km is the apparent second-order rate constant for substrate hydrolysis, corresponding to the apparent second-order rate constant for acyl-enzyme formation (k2/K). The extinction coefficients (Dε, DAbsorbance/mM per cm) and wavelengths (nm) used were 10.0 and 482 for nitrocefin, 1.14 and 233 for penicillin G, 7.66 and 262 for cephalothin, 7.25 and 264 for cefotaxime, 10.3 and 265 for ceftazidime, 8.38 and 275 for cefmetazole, 9.63 and 300 for panipenem, and 10.2 and 300 for R-95867, respectively.
Results Construction of plasmids carrying the blaTEM genes Plasmid pBR32220 carries AmpR (the blaRTEM gene) which encodes typical RTEM (TEM-1) β-lactamase as a selective
214
marker. In the first round of mutagenesis, two conflicts between pUC1921 and pBR322 were reverse-mutated, accompanied by an alteration of the unique SspI site to a StuI site. The conflicts were A and T at nucleotides 1128 and 1429 of pUC19, which correspond to G and C at nucleotides 3910 and 3609 of the source plasmid pBR322, respectively. When mutagenic primers TEM-I82V and TEM-V182A were used, new HincII (GT[CT][AG]AC) and PstI (CTGCAG) sites were generated at nucleotides 1128 and 1426, respectively (5-terminal of the site). In the second round of mutagenesis, mutations of the residues that lead to an extended substrate spectrum of the enzyme3,22 were introduced, accompanying an alteration of the new StuI site to the ex-SspI site. Besides the StuI/SspI toggle primer, other mutagenic primers were used: TEMQ37K, TEM-E102K, and TEM-G236S for constructing pTEM-3, which carries a mutated blaTEM gene encoding TEM-3 (CTX-1) β-lactamase; TEM-R162S, and TEMA235T E237K for pTEM-5 encoding TEM-5 (CAZ-1); and TEM-L19F, TEM-E102K, TEM-R162S, and TEM-T261M for pTEM-9 encoding TEM-9 (RHH-1). When mutagenic primers TEM-E102K and TEM-T261M were used, new MseI (TTAA) and NlaIII (CATG) sites were generated at nucleotides 1186 and 1664, respectively. In contrast, when mutagenic primers TEM-Q37K, TEM-R162S, and TEMG236S or TEM-A235T E237K were used, the mutations led to the loss of Sau3AI (GATC), Sau3AI, and Cfr10I ([AG]CCGG[TC]) sites at nucleotides 990, 1365, and 1587, respectively. After carrying out a series of mutagenesis-selection steps, the introduction of the target mutations was screened by checking the generation and loss of the restriction sites, followed by sequencing of the region encompassing the mutated blaTEM genes for confirmation. Desired plasmids pTEM-3, pTEM-5, and pTEM-9 were obtained, and plasmids pTEM-1 and pTEM-2, which carry the parent nonESBL β-lactamase genes, were also obtained.
TEM-2 β-lactamase producers were comparable to those against the host strain JM109. The MICs of the parenteral cephalosporins tested, except for cefpirome, against TEMand SHV-type ESBL producers were increased more than 16 times compared with those against the host strain. Moreover, the MICs of these cephalosporins against the Toho-1 producer increased more than 256 times, showing MICs of 32 µg/ml or higher. Cefpirome showed a similar tendency; however, the magnitude of the increase in MICs was smaller than that for the other parenteral cephalosporins tested. Among the parenteral cephalosporins tested, ceftazidime was the most affected by all the types of ESBLs tested. The MICs of cefmetazole, a cephamycin, against the transformants, as well as the host, were 1 or 2 µg/ml and almost unchanged. The MICs of cefdinir, cefditoren, cefpodoxime, and cefteram against TEM- and SHV-type ESBL-producers were increased more than 16 times compared with those against the host, except for the MIC of cefdinir against JM109 containing pTEM-9, which was 0.5 µg/ml and almost unchanged. In contrast, the increases in the MICs of cefcapene against TEM- and SHV-type ESBL-producers were marginal. The MIC of each oral cephalosporin tested against the transformant that produces Toho-1 β-lactamase was greater than 128 µg/ml. The MIC of imipenem against the host and transformants was uniformly 0.12 µg/ml. Meropenem and panipenem showed similar tendencies, i.e., comparable MICs against the host and transformants. The MICs of R95867 against transformants containing plasmids carrying TEM- and SHV-type ESBL genes were 0.016 or 0.03 µg/ml, showing that the magnitude of increase in MICs was two to four times that against the host. The MIC of R-95867 against the Toho-1 producer rose 32 times, compared with that against the host, but was still as low as 0.25 µg/ml. This group showed the lowest values among the MICs of the βlactam antibiotics tested. The antibacterial activity of faropenem, a penem, was also only slightly affected by the ESBLs.
Antibacterial activities of β-lactam antibiotics against ESBL producers
Kinetic analysis
Table 2 shows the antibacterial activities of 23 β-lactam antibiotics against the host strain E. coli JM109 and its transformants, determined by the agar dilution method, and MIC interpretive standards stipulated by NCCLS.23 The MICs of ampicillin were greater than 128 µg/ml, not only against ESBL producers but also against the parent TEMtype β-lactamase producers containing pTEM-1 and pTEM-2. Although the activity of piperacillin was also greatly affected by transformation with the plasmids, the magnitude of decrease in the activity of piperacillin became much smaller by combination with clavulanic acid or tazobactam. Similarly, combination of cefoperazone with sulbactam restored, to a smaller extent, the activity of cefoperazone against β-lactamase producers in comparison with cefoperazone alone. Besides that of cefoperazone, the MICs of the parenteral and oral cephalosporins tested against parental RTEM and
Table 3 shows the kinetic parameters of seven β-lactam antibiotics with four TEM-type β-lactamases. The parent enzyme RTEM showed typical penicillinase activity: penicillin G was hydrolyzed more easily than cephalothin by the enzyme. With penicillin G, the kcat and Km values were eight times as high and less than a seventh as high as those of cephalothin, respectively, leading to a 65 times higher kcat/ Km ratio. Because the parameters for cefotaxime could not be calculated, due to little hydrolysis by and weak inhibition of the RTEM enzyme, no further examination was attempted between the remaining substrates and RTEM. For the three enzymes TEM-3, TEM-5, and TEM-9, the penicillinase activity was decreased, with a more marked reduction in the kcat, and therefore in the kcat/Km ratio. Cefotaxime was only slightly but certainly degraded by TEM-3 with low catalytic efficiency. Because the affinities of ceftazidime and cefmetazole to TEM-3 were very low,
128 128 8/0.53 16/4 4/4 0.03 1 8 0.06 0.06 0.06 0.03 0.12 0.5 0.25 0.25 0.5 0.5 0.12 0.016 0.06 0.016 1
4 4 2/0.13 2/0.5 0.25/0.25 0.016 1 0.25 0.06 0.06 0.06 0.03 0.12 0.5 0.25 0.25 0.5 0.25 0.12 0.016 0.06 0.008 1
pTEM-1 (RTEM)
b
a
MIC, minimum inhibitory concentration Each value is the median of three determinations Cited from reference 23: S, susceptible; I, intermediate; R, resistant c ND Not defined
Penicillins Ampicillin Piperacillin β-Lactam/β-lactamase inhibitor combinations Piperacillin/clavulanic acid Piperacillin/tazobactam Cefoperazone/sulbactam Cephems (parenteral) Cefepime Cefmetazole Cefoperazone Cefotaxime Cefozopran Cefpirome Ceftriaxone Ceftazidime Cephems (oral) Cefcapene Cefdinir Cefditoren Cefpodoxime Cefteram Carbapenems Imipenem Meropenem Panipenem R-95867 Penem Faropenem
None
1
0.12 0.016 0.06 0.016
0.5 0.25 0.25 0.5 0.5
0.06 1 16 0.06 0.06 0.06 0.03 0.12
8/0.53 16/4 4/4
128 128
pTEM-2 (TEM-2)
1
0.12 0.016 0.06 0.03
0.5 4 16 64 32
0.5 1 16 8 2 2 8 16
2/0.13 1/0.25 1/1
128 128
pTEM-3 (TEM-3)
2
0.12 0.016 0.06 0.03
0.5 8 4 16 4
0.25 1 8 1 1 0.5 2 32
2/0.13 4/1 1/1
128 32
pTEM-5 (TEM-5)
2
0.12 0.016 0.06 0.03
0.5 0.5 8 32 8
2 1 32 1 2 4 1 128
4/0.27 4/1 2/2
128 128
pTEM-9 (TEM-9)
1
0.12 0.016 0.06 0.016
1 4 4 32 8
0.25 1 4 4 1 0.5 4 32
1/0.07 2/0.5 1/1
128 64
pSHV12 (SHV-12)
MIC (µg/ml) against E. coli JM109 containing a plasmid (β-Lactamase type encoded)a
Table 2. In vitro antibacterial activities of 23 β-lactam antibiotics against Escherichia coli JM109 and its β-lactamase-producing transformants
Antimicrobial agent
ND 2 ND 4 ND 8 8 ND ND
ND 1 ND 2 ND 4 4 ND ND
128 128 128 128 128
4
0.12 0.03 0.12 0.25
ND
16 32 32 16–32 ND ND 16–32 16
8 16 16 8 ND ND 8 8 64 2 128 128 128 8 128 32
ND
ND 32/4–64/4 ND
4/0.27 2/0.5 8/8
NDc 16/4 ND
I 16 32–64
S 8 16
128 128
pMTY010 (Toho-1)
MIC (µg/ml) Interpretive standardb
ND
16 16 ND ND
ND 4 ND 8 ND
32 64 64 64 ND ND 64 32
ND 128/4 ND
32 128
R
215
216 Table 3. Kinetic parameters of β-lactam substrates with TEM-type β-lactamases Substrate
Penicillin G Cephalothin Cefotaxime Ceftazidime Cefmetazole Panipenem R-95867
TEM-1 (RTEM)
TEM-3 (CTX-1)
TEM-5 (CAZ-1)
TEM-9 (RHH-1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
kcat (s1)
Km (µM)
kcat/Km (µM1s1)
2200 270 –b NDc ND ND ND
31 240 – ND ND ND ND
71 1.1 – ND ND ND ND
18 9.3 0.77 – – 9.3 103d 9.1 103d
29a 5.4 120 5600a 660a – –
0.64 1.7 6.3 103 – – 3.2 104e 4.7 104e
8.7 16 – 14 4.1 103d 1 103d 2.4 103
8.7a 110a 140a 100 – 0.56f 0.96a
1.0 0.15 – 0.13 2.4 104e 0.044e 2.5 103
27 12 2.6 27 5 103d 9 103d 6 103d
45a 90 13 110 280f 1.4f 1.9f
0.60 0.13 0.21 0.24 1.1 104e 4.3 103e 9.9 103e
See text for definitions of kinetic parameters a Km was obtained as Ki, using nitrocefin as the reporter substrate b –, Not measurable c ND, Not determined d kcat was obtained as k3 e kcat/Km was obtained as k2/K f Km was obtained as K
showing Km (Ki) values of more than 660 µM, the saturating concentrations of the substrates were too high to determine the maximal rate of degradation of the substrates spectrophotometrically. The kcat values for TEM-3 with the carbapenems panipenem and R-95867 were less than 1/1000, compared with the value with penicillin G. In contrast, ceftazidime was moderately hydrolyzed by TEM-5, with a kcat value similar to that with cephalothin. The kcat values with the cephamycin, cefmetazole, and carbapenems were in the order of 103 s1 and this result suggested that these substrates were stable to hydrolysis by the enzyme. Panipenem showed inactivation of this enzyme. Cefotaxime and ceftazidime were relatively good substrates for TEM-9, with kcat/Km ratios being greater than a third of that for penicillin G. Cefmetazole, panipenem, and R-95867 were, again, scarcely hydrolyzed by this enzyme, thus showing quite low efficiencies, and they behaved as inactivators of the enzyme.
Discussion Comparative activities of currently available β-lactam antibiotics against five ESBL producers were tested. The results were in good accordance with previous reports in the respect that the MICs against TEM- and SHV-type ESBL producers were higher with ceftazidime than with cefotaxime, and vice versa against a Toho-1 producer.3,4,6 It is noteworthy that the MICs of penicillins, cefoperazone, and β-lactam/β-lactamase inhibitors against parent TEM-type β-lactamase producers containing pTEM-1 and pTEM-2 were comparable to, or higher than, those against the TEMtype ESBL producers tested. According to the standards of the NCCLS,23 all β-lactamase producers were interpreted as being nonsusceptible to the penicillins tested; however, this was apparently reversed in combination with β-lactamase inhibitors. The TEM- and SHV-type ESBL producers were
susceptible to the parenteral cephalosporins, other than cefoperazone and ceftazidime, although the MICs were increased more than eight times compared with those against the host strain and the parental RTEM producer. In contrast, the ESBL producers appeared not to be susceptible to oral cephalosporins, except for cefcapene. The Toho-1 producer was seemingly resistant to both parenteral and oral cephalosporins tested; however, cefpirome was the exception. On the other hand, the present results show that the activities of carbapenems, a cephamycin (cefmetazole), and a penem were virtually unchanged against the ESBL producers tested against. This property is one of the advantages of these groups of β-lactam compounds over cephalosporins and penicillins. The activity of R-95867 was only slightly affected by the ESBLs; this was probably due to the differences in chemical profiles among the carbapenems. R-95867 is an anionic compound, while imipenem, meropenem, and panipenem are zwitterionic compounds. An inappropriate selection or dosage regimen of antimicrobial agents that is not fully effective against ESBL producers will not only lead to clinical failure in an individual patient but will also provide these epidemic producers with a breeding ground and result in a serious outbreak of nosocomial infections by them. Peña et al.24 reported that the restricted use of oxyiminocephalosporins was effective for the eradication of ESBL producers. Furthermore, some class A β-lactamases are resistant to β-lactamase inhibitors,22,25 and many ESBL producers showed multidrug resistance to aminoglycosides, fluoroquinolones and so forth.3,4 Prudent use of antimicrobial agents is required to prevent an increase in the prevalence of ESBL producers. The development of many new ESBLs has been caused by spontaneous mutations in wild-type β-lactamases. In this study, each ESBL gene was subcloned into a plasmid and the plasmid was introduced into the same host strain. Therefore, the contribution of other resistance mechanisms and of differences in β-lactamase expression levels could be excluded, at least among the TEM-type β-lactamase producers. The results of the susceptibility test and kinetic analysis reinforced the idea that the behavior of TEM-type
217
β-lactamases derived from mutant plasmids constructed by site-directed mutagenesis was consistent with the behavior of those of natural origin.3,4 This strategy will accelerate the development of study in this field, especially in a country such as Japan, where ESBL producers are rarely isolated. However, the fact that ESBL producers are frequently found in countries in which there are high levels of travel and transport interchange with Japan could increase the incidence of these producers here in Japan in the near future. Furthermore, this possibility is increasing as the levels of β-lactamase producers are rising rapidly worldwide, so it is never too early to start preventive measures. Acknowledgments We thank Dr. Yoshichika Arakawa, National Institute of Infectious Diseases, for generously providing plasmid pSHV12. This study was presented in part at the 48th General Meeting of the West Japan Branch of the Japanese Society of Chemotherapy, Kyoto, 7 and 8 December 2000, and was recommended by the chairman to be submitted to this journal. We are grateful to many members of the committee of the society who participated in this matter.
References 1. Knothe H, Shah P, Krcmery V, Antal M, Mitsuhashi S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 1983;11:315–7. 2. Jacoby GA. Epidemiology of extended-spectrum β-lactamases. Clin Infect Dis 1998;27:81–3. 3. Philippon A, Labia R, Jacoby G. Extended-spectrum β-lactamases. Antimicrob Agents Chemother 1989;33:1131–6. 4. Jacoby GA, Medeiros AA. More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991;35:1697–704. 5. Kurokawa H, Oguro K, Nagata A, Suzuki K, Arakawa Y. A report of ceftazidime-resistant Klebsiella pneumoniae (in Japanese). Jpn J Chemother 1995;43:462–3. 6. Ishii Y, Ohno A, Taguchi H, Imajo S, Ishiguro M, Matsuzawa H. Cloning and sequence of the gene encoding a cefotaximehydrolyzing class A β-lactamase isolated from Escherichia coli. Antimicrob Agents Chemother 1995;39:2269–75. 7. Yagi T, Kurokawa H, Senda K, Ichiyama S, Ito H, Ohsuka S, et al. Nosocomial spread of cephem-resistant Escherichia coli strains carrying multiple Toho-1-like β-lactamase genes. Antimicrob Agents Chemother 1997;41:2606–11. 8. Ma L, Ishii Y, Ishiguro M, Matsuzawa H, Yamaguchi K. Cloning and sequencing of the gene encoding Toho-2, a class A β-lactamase preferentially inhibited by tazobactam. Antimicrob Agents Chemother 1998;42:1181–6. 9. Matsumoto Y, Inoue M. Characterization of SFO-1, a plasmidmediated inducible class A β-lactamase from Enterobacter cloacae. Antimicrob Agents Chemother 1999;43:307–13.
10. Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 1995;39:1211–33. 11. Yagi T, Kurokawa H, Shibata N, Shibayama K, Arakawa Y. A preliminary survey of extended-spectrum β-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. FEMS Microbiol Lett 2000;184:53–6. 12. Kuga A, Yano H, Okamoto R, Sato Y, Miyata A, Inoue M. Antibacterial activity of β-lactam antibiotics against extendedspectrum β-lactamase producing bacteria (in Japanese). Jpn J Antibiot 1999;52:585–94. 13. Fukuoka T, Ohya S, Utsui Y, Domon H, Takenouchi T, Koga T, et al. In vitro and in vivo antibacterial activities of CS-834, a novel oral carbapenem. Antimicrob Agents Chemother 1997;41:2652–63. 14. National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 5th Ed. Approved standard M7-A5. Wayne, PA: National Committee for Clinical Laboratory Standards; 2000. 15. Deng WP, Nickoloff JA. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal Biochem 1992;200:81–8. 16. Nakamura T, Uchida S, Heijyo H, Masuda M, Takahashi H, Komatsu M, et al. An SHV-derived extended-spectrum βlactamase (SHV-12) produced by an Escherichia coli recovered from wound abscess in post-operative case with rectal carcinoma (in Japanese). Kansenshogaku Zasshi (J Jpn Assoc Infect Dis) 2000;74:112–9. 17. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd Ed. New York: Cold Spring Harbor Laboratory Press; 1989. 18. Raquet X, Lamotte-Brasseur J, Fonzé E, Goussard S, Courvalin P, Frère JM. TEM β-lactamase mutants hydrolysing third-generation cephalosporins. A kinetic and molecular modeling analysis. J Mol Biol 1994;244:625–39. 19. De Meester F, Joris B, Reckinger G, Bellefroid-Bourguignon C, Frère JM. Automated analysis of enzyme inactivation phenomena. Application to β-lactamases and dd-peptidases. Biochem Pharmacol 1987;36:2393–403. 20. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, Boyer HW. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 1977;2:95– 113. 21. Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985;33:103–19. 22. Knox JR. Extended-spectrum and inhibitor-resistant TEM-type βlactamases: mutations, specificity, and three-dimensional structure. Antimicrob Agents Chemother 1995;39:2593–601. 23. National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial susceptibility testing. Eleventh informational supplement M100-S11. Wayne, PA: National Committee for Clinical Laboratory Standards; 2001. 24. Peña C, Pujol M, Ardanuy C, Ricart A, Pallares R, Liñares J, et al. Epidemiology and successful control of a large outbreak due to Klebsiella pneumoniae producing extended-spectrum βlactamases. Antimicrob Agents Chemother 1998;42:53–8. 25. Chaïbi EB, Sirot D, Paul G, Labia R. Inhibitor-resistant TEM βlactamases: phenotypic, genetic and biochemical characteristics. J Antimicrob Chemother 1999;43:447–58.