- Email: [email protected]
Prospective study investigating transplacental transmission of equine piroplasmosis in thoroughbred foals in Trinidad
Veterinary Parasitology 226 (2016) 132–137
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Research paper
Prospective study investigating transplacental transmission of equine piroplasmosis in thoroughbred foals in Trinidad Candice Sant ∗ , Roger d’Abadie, Indira Pargass, Asoke K. Basu, Zinora Asgarali, Roxanne A. Charles, Karla C. Georges School of Veterinary Medicine, Faculty of Medical Sciences, University of the West Indies, St. Augustine Campus, EWMSC, Mt. Hope, Trinidad and Tobago
a r t i c l e
i n f o
Article history: Received 11 January 2016 Received in revised form 6 June 2016 Accepted 8 July 2016 Keywords: Equine piroplasmosis Transplacental transmission Neonatal piroplasmosis Trinidad
a b s t r a c t Equine piroplasmosis caused by Theileria equi and Babesia caballi is endemic in Trinidad and Tobago. Transmission occurs by ticks of the family Ixodidae. T. equi can also be transmitted transplacentally; however transplacental transmission of B. caballi is unknown. This study aims to investigate transplacental transmission of equine piroplasmosis from thoroughbred mares naturally infected via the tick vector. Whole blood and serum samples were collected from 117 mares in the fifth month of pregnancy. Blood samples were also collected from each of their foals (89 in total) within the first 36 h of birth. Additionally, all foals were observed for clinical signs within 30 days post – partum. All samples were examined microscopically for intra-erythrocytic piroplasms. Serum ELISA tests and PCR analysis on whole blood were performed to determine the presence of T. equi and B. caballi. Thirty-four (30.6%) mares and 14 (15.7%) of their foals were seropositive for T. equi. Twenty-seven (24.3%) mares were positive for T. equi by conventional (c) PCR. Real time (q) PCR analysis based on the ema – 1 gene revealed that seven (8%) foals were positive for T. equi. Eighty-nine (76.1%) mares and 38 (42.7%) foals were seropositive for B. caballi. Four (3.4%) mares were positive for B. caballi by cPCR. Three out of the four cPCR positive mares either had resorptions, or stillbirths for that pregnancy. From this study, there is strong evidence that transplacental transmission of B. caballi can occur leading to foetal losses. Six foals (7%) were positive for B. caballi by qPCR. Of these six, four were born to B. caballi seropositive mares. In this study a foal born of a T. equi seropositive mare was 55.7 times more likely to be serologically positive for T. equi than a foal born to a T. equi seronegative mare. Similarly a foal born of a B. caballi seropositive mare was 39.4 times more likely to be serologically positive for B. caballi than a foal born to a mare that was serologically negative for B. caballi at the fifth month of pregnancy. This is as a result of the ingestion of colostrum containing antibodies to these pathogens. Mares should be screened during pregnancy and their foals closely monitored at parturition for evidence of equine piroplasmosis so that treatment can be implemented earlier for a better prognosis. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Equine piroplasmosis is caused by the haemoprotozoan parasites Theileria equi and Babesia caballi (Mehlhorn and Schein, 1998). This disease is endemic in most tropical and subtropical regions of the world including Trinidad and Tobago (Asgarali et al., 2007; Georges et al., 2011). A previous study showed that out of 93 horses screened for equine piroplasmosis in Trinidad, 82.8% of the horses
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (C. Sant). http://dx.doi.org/10.1016/j.vetpar.2016.07.008 0304-4017/© 2016 Elsevier B.V. All rights reserved.
were seropositive for the parasites, of which 33.3% were seropositive for T. equi, 68.8% for B. caballi and 19.4% for both parasites (Asgarali et al., 2007). Documented hosts of this disease include horses, mules, donkeys, and zebras (Hussain et al., 2014). Transmission occurs by Ixodid tick vectors. In a study by GarciaBocanegra et al. (2013) in Spain, horses that had ticks were 1.99 times more likely to be seropositive for T. equi and 1.35 times more likely to be seropositive for B. caballi (Garcia-Bocanegra et al., 2013). A study in Brazil demonstrated that horses infested with ticks were 2.6 times more likely to be real time polymerase chain reaction (qPCR) T. equi positive than horses without ticks (Peckle et al., 2013). Mechanical transmission can occur via contaminated syringes, needles, surgical instruments and transfusion of
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
contaminated blood products (de Waal, 1992; de Waal and Heerden, 2004). Cases involving transplacental transmission of T. equi and B. caballi have been reported but foetal and neonatal infection due to B. caballi is thought to be rare (Wise et al., 2013). A previous study by Allsopp et al. (2007) revealed that transmission of T. equi occurs during days 40–150 of gestation which corresponds to the period of histiotrophic nutrition where maternal RBCs can cross the placenta to provide a source of iron to the developing foetus (Allsopp et al., 2007). Parasites in infected RBCs may be transmitted via this route to the developing foetus. Transplacental transmission of equine piroplasmosis is unlikely to occur after the fifth month of pregnancy due to establishment of haemotrophic nutrition and the fully formed structure of the placenta which prevents the transfer of the piroplams from the mare to the developing foetus (Allsopp et al., 2007). The equine foetus does not begin to produce antibody-producing cells until day 240 of gestation. It is thought that transplacental transmission occurs before the foetal immune system is developed sufficiently to recognize antigens as being foreign; parasites already in the system are likely to be recognized as self by the neonate (Allsopp et al., 2007). The placenta of the mare is epitheliochorial; therefore antibodies are unable to cross the placenta to the foetus during pregnancy (Kumar et al., 2008). Maternal antibodies ingested with colostrum as well as innate immune responses may act to control levels of parasitaemia during the foal’s first four months of life (de Waal et al., 2004; Kumar et al., 2008). The percentage of red blood cells (RBCs) parasitized in clinically affected T. equi animals usually range from one to five percent. However, in some cases parasitaemia can exceed 20% (Donnellan and Marais, 2009). The percentage of RBCs parasitized in B. caballi infections is lower (<1%) in the peripheral blood, and the levels are even lower in chronic or inapparent infections (Rothschild, 2013; Donnellan and Marais, 2009; Wise et al., 2013). Carrier mares can transmit equine piroplasms to their offspring, resulting in abortions, stillbirths, neonatal disease or death, or carrier offspring (Allsopp et al., 2007). The abortion rate of thoroughbred horses in Trinidad for the last three years ranged from 11 to 15% (unpublished data, Trinidad and Tobago Racing Authority, 2016). However no comprehensive study was performed to determine the cause of these abortions. Foals infected in-utero are generally weak at birth and rapidly develop anaemia and jaundice, or they become healthy carriers (Donnellan and Marais, 2009; Wise et al., 2013). In areas where equine piroplasmosis is endemic, severe jaundice in a post-partum foal can be easily misdiagnosed as neonatal isoerythrolysis (Georges et al., 2011). The objectives of this study were to investigate transplacental transmission of T. equi and B. caballi in thoroughbred foals from mares naturally infected by the tick vector using microscopic examination of blood smears, enzyme linked immunoassay (ELISA) and conventional (c) and real time (q) polymerase chain reaction (PCR) analysis and to look at risk indicators for the presence of infection in mares and their foals. Both cPCR and qPCR were performed in this study as qPCR is reported to be a more sensitive tool in detecting DNA than cPCR (Dagher et al., 2004). As both mares and foals were exposed to ticks and at risk for infection, this study also followed the foals up to one month after birth to detect clinical signs of disease.
2. Materials and methods 2.1. Epidemiological survey and sample collection A list of all mares confirmed pregnant by ultrasonography by the attending veterinarian in 2011 was obtained from seven farms located throughout Trinidad. A questionnaire was completed for
133
each mare in this study. Questions included origin of the mare that is whether it was locally bred or imported, whether the mare was a maiden, history of resorptions, abortions and stillbirths, if the mare was previously diagnosed with equine piroplasmosis, tick exposure of the animals and the methods of tick control on the stalls and pastures. The mares in this study were monitored for clinical signs associated with abortions or stillbirths until parturition. Ten mL of blood was collected aseptically via jugular venepuncture from the study population of mares at the beginning of the fifth month of pregnancy and from their foals within the first 36 h after birth. Five mL was placed into tubes containing EDTA and into tubes without anticoagulant. Blood samples were stored at 4 ◦ C, and transported to the laboratory for analysis. The attending veterinarian also monitored the foals for failure of passive transfer using SNAP® Foal IgG Test (IDEXX Laboratories Incorporated, Maine, United States of America). Foal health was monitored from birth until one month of age for signs of illness such as icteric mucous membranes, lethargy and decreased suckling reflex. 2.2. Microscopic examination of blood smears Thin blood smears stained with Wright-Giemsa were examined using an Olympus BX41 light microscope (Olympus Corporation, Japan) at 1000X magnification and piroplasms in RBCs were measured using the CellSens Standard 1.7 programme (Olympus Corporation, Japan). 2.3. Serological testing Serum samples were screened for antibodies to T. equi and B. caballi using commercial B. equi antibody cELISA test kits and the B. caballi antibody cELISA test kits (VMRD, Inc. Pullman, WA) respectively according to the manufacturer’s instructions. Optical density (O.D) was read at a wavelength of 620 nm using a Thermo Labsystems Multiskan Ascent (Thermo Labsystems, Finland). Samples with <40% inhibition were considered negative and those >40% inhibition as positive (VMRD, Inc. Pullman, WA). 2.4. DNA extraction DNA was extracted from 100 L of EDTA blood or 10 mg of spleen from aborted foetuses if available using the Qiagen DNeasy Blood & Tissue Kit (Qiagen Maryland USA) according to the manufacturer’s instructions. 2.5. Conventional (c) PCR For cPCR the 18 S rRNA gene was amplified to detect T. equi using the primers BEC-UF2 (5 -TCGAAGACGATCAGATACCGTCG) and Equi-R (5 -TGCCTAAACTTCCTTCCTTGCGAT) (Sigma-Aldrich Inc, St. Louis, MO) which yield a product of approximately 400 base pairs (bp) (Steinman et al., 2012). Five L of target DNA was amplified in a 25 L reaction volume. The reaction conditions consisted of 25 pmol of each forward and reverse primer, 2.5 L GC enhancer, 12.5 L Amplitaq Gold 360 Master Mix (Applied Biosystems, Life Technologies, Carlsbad, CA.) and 4.5 L PCR grade water (Sigma-Aldrich Inc, St Louis, MO, USA). The PCR was performed in a Techne Flexigene Thermal Cycler (Techne, Cambridge, UK) using the following cycling parameters: an initial denaturation step at 96 ◦ C for 10 min, followed by 40 cycles of denaturation at 96 ◦ C for 60 s, annealing at 56 ◦ C for 60 s extension at 72 ◦ C for 60 s. There was a final extension step at 72 ◦ C for 10 min. The 18 S rRNA gene was again amplified to detect B. caballi using the universal forward primer BEC-UF2 (5 TCGAAGACGATCAGATACCGTCG) and a reverse primer Cab-R (5 CTCGTTCATGATTTAGAATTGCT) (Sigma-Aldrich Inc. St Louis, MO, USA). The PCR
134
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
reaction yielded a product of approximately 540 bp (Alhassan et al., 2005). The reaction conditions were the same as previously described for T. equi except that the annealing temperature used for B. caballi was 51.3 ◦ C for 60 s. Samples were held at 4 ◦ C. The PCR products were subjected to electrophoresis in 2.0% agarose in 1% TBE buffer pre-stained with ethidium bromide to visualize under uv light. Positive cPCR amplified products for T. equi and B. caballi were sequenced (Macrogen Inc, South Korea). Positive T. equi and B. caballi DNA from this study are available on GenBankTM EMBL and DDBJ databases under the accession numbers KT285377 and KU289089 to KU289096 for T. equi and KU289100 for B. caballi. 2.6. Real time (q) PCR Five serial dilutions of the positive controls for T. equi and B. caballi were done in 1:10 using RNAse/DNAse free water. 5 L of stock and each dilution were used to generate a standard curve for these equine piroplasms. DNA from the foals was subjected to qPCR analysis using PrimerDesign genesig kits (PrimerDesign Limited, United Kingdom). Quantification of T. equi and B. caballi were based on the Equi merozoite antigen 1 (ema – 1) gene and the 18 S ribosomal gene respectively. Extracted DNA from the foals was diluted 1:20 using RNAse/DNAse free water. 5 L of the diluted DNA was amplified using the following reaction conditions to give a total reaction volume of 20 L. For T. equi, 10 L of oasigTM 2X q PCR mastermix was added to 1 L of T. equi Primer/Probe mix, 1 L of internal extraction control primer/probe mix and 3 L of RNAse/DNAse free water. The reaction conditions were similar for B. caballi with the exception of 4 L of RNAse/DNAse free water used instead of 1 L of internal extraction control primer/probe mix and 3 L of RNAse/DNAse free water that were used for T. equi. Five L of RNAse/DNAse free water was used as a negative control. qPCR was conducted using an Applied Biosystems® 7500 RealTime PCR System (BioAnalytical Instruments, Puerto Rico). The thermocycling conditions were as follows for T. equi, enzyme activation at 95 ◦ C for 15 min, and 50 cycles of denaturation at 95 ◦ C for 10 s followed by data collection at 60 ◦ C for 1 min. The thermocycling conditions for B. caballi were as described for T. equi except that enzyme activation was 95 ◦ C for 10 min. Fluorogenic data were collected for both reactions through the FAM channel. Comparison of the cycle threshold (Ct) values of the extracted DNA samples to the Ct values of the serial dilutions of the positive controls were used to determine if the samples were positive or negative for the piroplasms. 2.7. Statistical analysis All data were analysed using SPSS (version 20) and STATA 12 (Statacorp LP, College Station TX) for both mares and foals. Statistical significance was set at p < 0.05 throughout the study. The risk factors that were investigated in this study included ticks on mares, local or imported mares, previous history of resoptions, abortions or stillbirths and tick fever, previous foals with medical conditions during the first month post-partum, outcome of current pregnancy as well as tick control on the pastures. The 2 test for independence with the Yates’ continuity correction was used to determine if there was an association between PCR or ELISA results of the mares or foals and the above risk factors where applicable. The Fisher’s exact test was used when cells had expected frequency <5. qPCR results was considered the gold standard for analysis of the foal data. The Kappa (K) statistic was used to measure agreement beyond chance between the cPCR and qPCR results of the foals. Interpretation of the K value was as follows: <0.20
Fig. 1. Blood smear of a four-hour old foal showing a pyriform organism in a red blood cell typical for Babesia spp (white arrow). An average of four pyriform organisms was observed in every 50 HPF (0.04% parasitaemia).
indicates poor, 0.21–0.40 fair, 0.41–0.60 moderate, 0.61–0.80 good and 0.81–1.00 very good strength of agreement (Altman, 1990). Significant risk factors of the mare were then used to create a logistic regression model for T. equi cPCR result for the mare. Significant risk factors of the foals were used to create a logistic regression model for B. caballi or T. equi serological status of the foal 3. Results One hundred and seventeen mares from seven farms were sampled at the beginning of the study, however complete data was obtained for 111 mares (two mares died and four mares were relocated to farms that were not accessible). Twenty-two mares (19.8%) had abortions and there were 89 live births. Seventy-eight foals were screened for failure of passive transfer of which five had partial failure of passive transfer. There was an average of 18 pregnant broodmares per farm with a range of 7–26. All pregnant mares on the farms sampled were included in this study. All the horses in the study were thoroughbred mares used for breeding purposes and were allowed to graze on pasture once a day. All of the farms practiced tick control and prevention. The ages of the mares in this study ranged from 4 to 17 years with a median of 8 years. Sixty-six (56%) mares were locally bred. Sixteen (14%) were maiden mares, 21 (18%) had a previous history of reproductive losses with the majority (11, 52%) being embryonic or foetal resorptions. Four (3%) mares had a previous history of stillbirths, seven (6%) experienced abortions and eleven (10%) had resorptions. The majority of mares (8, 38%) had losses that occurred during the second and third month of pregnancy with a range from the first month to the tenth month of gestation, (median 2.5). Six (5%) of the mares in this study had previous foals that developed medical complications during the first month post-partum. Some of these medical complications were foals with poor suckling reflexes (17%), conformational abnormalities (17%), pyrexia (17%), trauma (17%) and others (33%) of which the exact nature was not recorded. Sixteen (14%) mares had been previously diagnosed with piroplasmosis. 3.1. Microscopic examination of blood smears Piroplasms were detected on microscopic examination of one mare (0.9%) and one (1.1%) foal in this study. The piriform like organisms observed in these blood smears were classical or typical for Babesia spp. These inclusions were round to piriform in shape with a length of 1.5–2.0 m with a basophilic rim and a clear
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
135
cPCR positive mare that did not abort was serologically and cPCR positive for T. equi but serologically negative for B. caballi. This live foal appeared normal up to one month after parturition. All foals in this study were negative for B. caballi via cPCR. 3.4. Real time PCR (qPCR) results
Fig. 2. Atypical piriform like unidentified inclusions observed in the red blood cells of 37 foals sampled in the first 36 h of life with an average of 15 inclusions observed in 50 HPFs (0.15% parasitaemia).
centre (Fig. 1). The levels of parasitaemia of the mare and foal were 0.00625% and 0.15% respectively. Atypical piriform-like inclusions were observed in the RBCs of twenty eight (31%) foals in this study (Fig. 2). The inclusions were small, oval in shape with a basophilic rim and a clear centre. There were two different sizes of the piriform-like inclusions observed, 1.119 × 1.053 m and 0.840 × 0.827 m. These dimensions were smaller than those reported for both T. equi and B. caballi. The average level of parasitaemia was 0.04%. T. equi piroplasms in RBCs are round, oval, amoeboid or piriform in shape with an average length of 1.5–2 m (Mehlhorn and Schein, 1998). B. caballi piroplasms in the RBCs are large, usually pear shaped with a length of 2.5–6 m (Mehlhorn and Schein, 1998; Kumar et al., 2008). 3.2. Serological results Thirty-four (30.6%) mares and 14 (15.7%) of their foals were seropositive for T. equi. Eighty nine (76.1%) mares and 38 (42.7%) of their foals were seropositive for B. caballi. However one and two seropositive foals were born to mares that were negative serologically for T. equi and B. caballi respectively. Twenty one of the mares (18%) were serologically positive for both T. equi and B. caballi at the fifth month of pregnancy. Of the 89 foals, seven (8%) were serologically positive for both piroplasms. 3.3. Conventional PCR (cPCR) results 3.3.1. Theileria equi Twenty-seven (24.3%) mares were positive for T. equi by cPCR. Four (4.5%) foals were cPCR positive for T. equi. These cPCR T. equi positive foals had piroplasm-like organism in their RBCs (Fig. 2) but were serologically negative for T. equi. These foals appeared clinically normal at birth and did not have failure of passive transfer of immunoglobulins. Of the four cPCR T. equi positive foals, two were born to mares that were both serologically and cPCR negative for T. equi at the time of sampling. 3.3.2. Babesia caballi Four (3.4%) mares were positive for B. caballi by cPCR. Only one of these mares gave birth to a live foal and neither piroplasms nor B. caballi DNA was detected in the blood of this live foal. The B. caballi
The fifth serial dilution of the positive control for T. equi and B. caballi gave Ct values of 32.31 and 39.5 respectively. These values were therefore used as the positive cut off values for T. equi and B. caballi. Of the 91 foals’ DNA (89 whole blood and 2 spleen samples) samples tested by qPCR, seven (8%) of the whole blood samples were positive for T. equi and six (7%) (5 whole blood and 1 spleen from an 8.5 month old aborted foetus) were positive for B. caballi. Three of the samples were both qPCR and cPCR positive for T. equi. Only one foal in this study was positive for both T. equi and B. caballi by qPCR. Eight (6.8%) mares were tested for T. equi by qPCR and of which all were negative. Eight of the 29 mares (28%) that were tested by qPCR were positive for B. caballi. The Kappa statistic for agreement between cPCR and qPCR results for foals in this study was k = 0.513 (95% CI 0.15–0.88), (p < 0.001) indicating moderate agreement (Altman, 1990). 3.5. Abortions Twenty-two (19.8%) mares aborted in this study. These abortions occurred between the second and eleventh month of gestation with a median of four months. Five mares that were seropositive for T. equi aborted during months 3–8 of gestation. Three mares that were cPCR positive for T. equi aborted at months 5, 6 and 8 respectively. Twenty mares that aborted were serologically positive for B. caballi. Of the three mares that were cPCR B. caballi positive, two resorbed at the third month and the third had a stillbirth at 10.5 month of gestation. Microscopic examination of the blood smear of the mare that aborted at the 10.5 month of gestation revealed rare piriform piroplasms with an average length of 1.70 m. This mare was also serologically positive for B. caballi. Necropsy examination was conducted on an 8.5 month old aborted foetus and placenta. Mild to moderate placentitis and septicaemia were determined as the cause of the abortion. DNA extracted from the spleen was positive for B. caballi by qPCR. Blood from this mare was serologically positive for B. caballi and cPCR negative for B. caballi when samples at the fifth month of pregnancy. The relationship between a mare being seropositive for T. equi or B. caballi and the outcome of that pregnancy (i.e. whether it aborted or gave birth to a live foal) was not significant in this study. 3.6. Risk factors All significant variables were entered into logistic regression models for T. equi seropositive foal, T. equi cPCR positive foal and a B. caballi seropositive foal and the following results were obtained. Mares that were serologically positive for T. equi were 1147 times more likely to be cPCR positive for T. equi, (OR = 1147, (95% CI = 59.89–21972.71), (p < 0.001)), (Table 1). Mares that were serologically positive for T. equi were 55.7 times more likely to have a T. equi seropositive foal (OR = 55.7, (95% CI = 6.6–468.2),
Table 1 Logistic regression model for a positive T. equi conventional PCR result of the mare. PCR T. equi results mare
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
T. equi ELISA mare cons
1147.16 0.004
1728.1 0.006
4.68 −3.9
<0.001 <0.001
59.89–21972.71 0.0003–0.066
136
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
Table 2 Logistic regression model for a positive T. equi ELISA result of the foal. T. equi ELISA results foal
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
T. equi ELISA mare cons
55.72 0.016
60.51 0.018
3.7 −3.76
<0.001 <0.001
6.63–468.16 0.002–0.139
Table 3 Logistic regression model for a positive B. caballi ELISA result of the foal. B. caballi ELISA results foal
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
B. caballi ELISA mare cons
39.42 0.049
38.9 0.045
3.72 −3.27
<0.001 0.001
5.70–272.71 0.008–0.300
(p < 0.001)) (Table 2). A B. caballi seropositive mare was 39.4 times more likely to have a B. caballi seropositive foal (OR = 39.42, (95% CI = 5.70–272.71), (p < 0.001)) (Table 3). There were no significant risk factors observed for B. caballi cPCR positive results of the mares or B. caballi qPCR results of the foals. 3.7. Follow up of foals Of the seven qPCR T. equi positive foals, two remained clinically normal up to one month post-partum, four developed complications of diarrhoea and one foal had typical RBCs inclusions and clinical signs associated with equine piroplasmosis. The foal that had typical babesial – like inclusions in its red blood cells at four hours after birth developed clinical signs of lethargy and icterus four days post-partum. This foal was positive for T. equi by both cPCR and qPCR. The foal was treated with a combination of oxytetracycline (10 mg/kg SID), imidocarb dipropionate (2.2 mg/kg), ceftiofur (4.4 mg/kg SID), chloramphenicol (25 mg/kg TID) and trimethoprim-sulfa (30 mg/kg BID) for approximately two months. The foal recovered and appeared clinically normal despite a persistent leucocytosis during the treatment period. However this foal remained serologically negative for T. equi up to one month of age. The five foals that were positive for B. caballi by qPCR did not show any clinical abnormalities within the first month postpartum. 4. Discussion This study is the first report of a field investigation of transplacental transmission of equine piroplasmosis in thoroughbred foals. Other articles on transplacental transmission of equine piroplasmosis included experimental studies as well as case reports of transplacental transmission in countries such as United Kingdom (Phipps and Otter, 2004); India (Sudan et al., 2015; Chhabra et al., 2012); South Africa (Allsopp et al., 2007) and Trinidad (Georges et al., 2011). This study used several diagnostic techniques to detect DNA of the equine piroplasms or exposure to these agents in both mares and foals. This study also followed the foals up to one month of age. Of 267 thoroughbred mares that were bred in Trinidad for that year, the average abortion rate was 15%. The majority of mares (76.1%) and foals (44.9%) in this study were serologically positive for B. caballi and T. equi antibodies were only found in 34 (30.6%) mares in this study. These findings are consistent with those of Asgarali et al. (2007) which revealed a seroprevalence of 33.3% for T. equi and 68.8% for B. caballi in Trinidad in 2007. A new-born foal will only become serologically positive for these piroplasms after ingestion and absorption of colostrum that contains antibodies to T. equi and or B. caballi. In this study, 14 of the 34 T. equi seropositive mares had foals that were serologically positive for T. equi and 38 of the 89 B. caballi seropositive mares had foals
serologically positive for B. caballi. A foal born of a T. equi seropositive mare was 56 times (95% CI 6.63–468.16) more likely to be serologically positive for T. equi than a foal born to a T. equi seronegative mare and similarly a foal born of a B. caballi seropositive mare was 39.4 times (95% CI 5.70–272.21) more likely to be serologically positive for B. caballi than a foal born to a mare that was serologically negative for B. caballi at the fifth month of pregnancy. This study indicates that being born of a serologically positive mare appears to be a significant determinant of the foals’ seropositive status It was interesting to note that 14 T. equi serologically positive mares and 25 B. caballi seropositive mares had foals that were serologically negative for T. equi and B. caballi respectively. This can be explained by waning levels of specific antibodies during pregnancy. The low levels of antibodies that can be passed from the mare to the foal may not be of sufficient quantity to result in a positive serological result in the foal after the ingestion of colostrum. As transplacental transmission by nourishment through histiotroph is believed to occur before the foals begin to make antibody producing cells, foals will thus be serologically negative before the ingestion of colostrum. As all blood samples in this study were obtained after colostrum was ingested, the serologically negative foals may not have ingested sufficient colostral antibodies. One mare that was serologically negative for T. equi during the fifth month of pregnancy had a foal that was seropositive for T. equi and two B. caballi seronegative mares had foals that were serologically positive for B. caballi. As mares were sampled once at the fifth month of pregnancy, it is possible that these mares seroconverted at a later date, thereby passing on these antibodies to the foal via colostrum. Although the majority of mares were serologically positive for B. caballi (76.1% vs 30.6% for B. caballi and T. equi respectively), T. equi DNA was most frequently detected in this study (24.3% vs 3.4%). An extremely significant finding in this study was that all 27 of the mares that were cPCR positive for T. equi were also serologically positive for T. equi. Three of the four (75%) B. caballi mares that were cPCR positive for B. caballi were also seropositive for this piroplasm. Previous studies have reported that once an animal is infected with T. equi it remains infected for life (Wise et al., 2013). There is controversy about the status of B. caballi infections. It has been reported that horses may take up to four years to clear B. caballi infections, while other studies using more sensitive diagnostic tests have reported that this piroplasm is not readily cleared by the immune system and that the animal remains infected for life (Wise et al., 2013). The fact that a lower prevalence of B. caballi infections were detected in this study using cPCR could be explained by the fact that <1% of peripheral RBCs are parasitized by B. caballi, and <0.01% in chronic infections. In contrast to B. caballi, the number of T. equi infected RBCs may range from 1% to 5% under field conditions (Wise et al., 2013). In this study seven (8%) and six (7%) foals were detected by qPCR to have possible transplacental infections of T. equi and B. caballi respectively. Three foals were cPCR positive for T. equi and all were
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
cPCR negative for B. caballi. This result confirms that qPCR is more sensitive than cPCR in the detection of both T. equi and B. caballi. There was moderate agreement for T. equi when comparing qPCR and cPCR. All possible combinations of infections and serological status for mare and foals were detected in this study. Three of the seven foals in this study that were qPCR positive for T. equi were born to mares that were serologically and cPCR positive for T. equi, hence four of these foals were born to mares that were cPCR negative for T. equi at the fifth month of gestation. A reason for this occurrence could be that the piroplasms may have been transmitted to the neonatal foal via umbilical cord blood during parturition assuming that the mare was infected with T. equi after the fifth month of gestation. Unfortunately qPCR was not performed on the mares of these three foals and the mares were not resampled at the time of parturition. Another possible explanation could be the fact that piroplasms are known to sequester to the bone marrow resulting in an extremely low parasitaemia which may be undetectable via cPCR analysis of DNA extracted from blood. Latent infections or sequestered piroplasms may also manifest as a result of the hormonal changes associated with parturition which may result in a decrease level of immunity of the mare (Kaneko et al., 2008). A large number of factors can contribute to in utero transmission of equine piroplasms. Some of these include transmission by infected RBCs as maternal RBCs cross the placenta providing a source of iron to the developing foetus. This is the first reported field study of both mares and foals to investigate transplacental transmission of both T. equi and B. caballi. Further research is needed to investigate transmission via umbilical cord blood and the role of colostral antibodies in reducing parasitaemia and to identify and quantify the immunoglobulins that are present in the colostrum which act against piroplasms. 5. Conclusions In this study neonatal piroplasmosis was confirmed in seven (7.8%) foals by qPCR for T. equi. Also, five (5.6%) live births and one DNA extracted sample from the spleen of an 8.5 month aborted foetus were positive for B. caballi by qPCR. Infection with T. equi was an important risk factor in abortions of three (2.7%) mares and B. caballi infections appear likely to contribute to three abortions. For horses living in endemic areas for equine piroplasmosis, this study indicates that transplacental transmission is in fact a common occurrence. Sensitive diagnostic techniques should be used to screen mares during pregnancy so that their foals can be closely monitored at parturition and screened for equine piroplasmosis so treatment of positive foals can be implemented earlier for a better prognosis. Further studies are needed to determine if the rate of disease transmission to foals may be reduced through therapeutic interventions. Acknowledgements The authors would like to thank Siann Baldeo, Nalini Kalloo, Lemar Blake and Fatima Mohammed for their technical support. In
137
addition we thank the veterinarians, Drs Michelle Branday, Clive Ali and Rossi Bridgelal who assisted with this study and all racehorse owners and managers of the farms involved who supplied data and monitored the mares and foals for this study. This project could not have been possible without the financial support of The University of the West Indies Campus Research and Publication Fund (grant number 26600-457889). References Alhassan, A., Pumidonming, W., Okamura, M., Hirata, H., Battsetseg, B., Fujisaki, K., Yokoyama, N., Igarashi, I., 2005. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 129, 43–49. Allsopp, M.T., Lewis, B.D., Penzhorn, B.L., 2007. Molecular evidence for transplacental transmission of Theileria equi from carrier mares to their apparently healthy foals. Vet. Parasitol. 148, 130–136. Altman, D.G., 1990. Practical Statistics for Medical Research. CRC Press London. Asgarali, Z., Coombs, D.K., Mohammed, F., Campbell, M.D., Caesar, E., 2007. A serological study of Babesia caballi and Theileria equi in Thoroughbreds in Trinidad. Vet. Parasitol. 144, 167–171. Chhabra, S., Ranjan, R., Uppal, S.K., Singla, L.D., 2012. Transplacental transmission of Babesia equi (Theileria equi) from carrier mares to foals. J. Parasit. Dis. 36, 31–33. Dagher, H., Donninger, H., Hutchinson, P., Ghildyal, R., Bardin, P., 2004. Rhinovirus detection: comparison of real-time and conventional PCR. J. Virol. Methods 117, 113–121. de Waal, D.T., 1992. Equine piroplasmosis: a review. Br. Vet. J. 148, 6–14. de Waal, D.T., Heerden, J.V., Coetzer, J.A., Tustin, R.C., 2004. Equine piroplasmosis. Infectious diseases of livestock, Vol. 1, 2 ed. pp. 425–434. Donnellan, C., Marais, H., 2009. Equine piroplasmosis. infectious diseases of the horse. Equine Vet. J. Ltd., 333–339. Garcia-Bocanegra, I., Arenas-Montes, A., Hernandez, E., Adaszek, L., Carbonero, A., Almeria, S., Jaen-Tellez, J.A., Gutierrez-Palomino, P., Arenas, A., 2013. Seroprevalence and risk factors associated with Babesia caballi and Theileria equi infection in equids. Vet. J. 195, 172–178. Georges, K.C., Ezeokoli, C.D., Sparagano, O., Pargass, I., Campbell, M., D’Abadie, R., Yabsley, M.J., 2011. A case of transplacental transmission of Theileria equi in a foal in Trinidad. Vet. Parasitol. 175, 363–366. Hussain, M.H., Saqib, M., Raza, F., Muhammad, G., Asi, M.N., Mansoor, M.K., Saleem, M., Jabbar, A., 2014. Seroprevalence of Babesia caballi and Theileria equi in five draught equine populated metropolises of Punjab, Pakistan. Vet. Parasitol. 202, 248–256. Kaneko, J.J., Harvey, J.W., Bruss, M.L., 2008. Clinical biochemistry of domestic animals. Elsevier Sci. 2008, 612–613. Kumar, S., Kumar, R., Gupta, A.K., Dwivedi, S.K., 2008. Passive transfer of Theileria equi antibodies to neonate foals of immune tolerant mares. Vet. Parasitol. 151, 80–85. Mehlhorn, H., Schein, E., 1998. Redescription of Babesia equi laveran, 1901 as Theileria equi. Parasitol. Res. 84, 467–475. Peckle, M., Pires, M.S., Dos Santos, T.M., Roier, E.C., da Silva, C.B., Vilela, J.A., Santos, H.A., Massard, C.L., 2013. Molecular epidemiology of Theileria equi in horses and their association with possible tick vectors in the state of Rio de Janeiro, Brazil. Parasitol. Res. 112, 2017–2025. Phipps, L.P., Otter, A., 2004. Transplacental transmission of Theileria equi in two foals born and reared in the United Kingdom. Vet. Rec. 154, 406–408. Rothschild, C.M., 2013. Equine piroplasmosis. J. Equine Vet. Sci. 33, 497–508. Steinman, A., Zimmerman, T., Klement, E., Lensky, I.M., Berlin, D., Gottlieb, Y., Baneth, G., 2012. Demographic and environmental risk factors for infection by Theileria equi in 590 horses in Israel. Vet. Parasitol. 187, 558–562. Sudan, V., Jaiswal, A.K., Srivastava, A., Saxena, A., Shanker, D., 2015. A rare clinical presentation of transplacental transmission and subsequent abortion by Babesia (Theileria) equi in a mare. J Parasit. Dis. 39, 336–338. Wise, L., Kappmeyer, L., Mealey, R., Knowles, D., 2013. Review of equine piroplasmosis. J. Vet. Intern. Med. 27, 1334–1346.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Research paper
Prospective study investigating transplacental transmission of equine piroplasmosis in thoroughbred foals in Trinidad Candice Sant ∗ , Roger d’Abadie, Indira Pargass, Asoke K. Basu, Zinora Asgarali, Roxanne A. Charles, Karla C. Georges School of Veterinary Medicine, Faculty of Medical Sciences, University of the West Indies, St. Augustine Campus, EWMSC, Mt. Hope, Trinidad and Tobago
a r t i c l e
i n f o
Article history: Received 11 January 2016 Received in revised form 6 June 2016 Accepted 8 July 2016 Keywords: Equine piroplasmosis Transplacental transmission Neonatal piroplasmosis Trinidad
a b s t r a c t Equine piroplasmosis caused by Theileria equi and Babesia caballi is endemic in Trinidad and Tobago. Transmission occurs by ticks of the family Ixodidae. T. equi can also be transmitted transplacentally; however transplacental transmission of B. caballi is unknown. This study aims to investigate transplacental transmission of equine piroplasmosis from thoroughbred mares naturally infected via the tick vector. Whole blood and serum samples were collected from 117 mares in the fifth month of pregnancy. Blood samples were also collected from each of their foals (89 in total) within the first 36 h of birth. Additionally, all foals were observed for clinical signs within 30 days post – partum. All samples were examined microscopically for intra-erythrocytic piroplasms. Serum ELISA tests and PCR analysis on whole blood were performed to determine the presence of T. equi and B. caballi. Thirty-four (30.6%) mares and 14 (15.7%) of their foals were seropositive for T. equi. Twenty-seven (24.3%) mares were positive for T. equi by conventional (c) PCR. Real time (q) PCR analysis based on the ema – 1 gene revealed that seven (8%) foals were positive for T. equi. Eighty-nine (76.1%) mares and 38 (42.7%) foals were seropositive for B. caballi. Four (3.4%) mares were positive for B. caballi by cPCR. Three out of the four cPCR positive mares either had resorptions, or stillbirths for that pregnancy. From this study, there is strong evidence that transplacental transmission of B. caballi can occur leading to foetal losses. Six foals (7%) were positive for B. caballi by qPCR. Of these six, four were born to B. caballi seropositive mares. In this study a foal born of a T. equi seropositive mare was 55.7 times more likely to be serologically positive for T. equi than a foal born to a T. equi seronegative mare. Similarly a foal born of a B. caballi seropositive mare was 39.4 times more likely to be serologically positive for B. caballi than a foal born to a mare that was serologically negative for B. caballi at the fifth month of pregnancy. This is as a result of the ingestion of colostrum containing antibodies to these pathogens. Mares should be screened during pregnancy and their foals closely monitored at parturition for evidence of equine piroplasmosis so that treatment can be implemented earlier for a better prognosis. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Equine piroplasmosis is caused by the haemoprotozoan parasites Theileria equi and Babesia caballi (Mehlhorn and Schein, 1998). This disease is endemic in most tropical and subtropical regions of the world including Trinidad and Tobago (Asgarali et al., 2007; Georges et al., 2011). A previous study showed that out of 93 horses screened for equine piroplasmosis in Trinidad, 82.8% of the horses
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (C. Sant). http://dx.doi.org/10.1016/j.vetpar.2016.07.008 0304-4017/© 2016 Elsevier B.V. All rights reserved.
were seropositive for the parasites, of which 33.3% were seropositive for T. equi, 68.8% for B. caballi and 19.4% for both parasites (Asgarali et al., 2007). Documented hosts of this disease include horses, mules, donkeys, and zebras (Hussain et al., 2014). Transmission occurs by Ixodid tick vectors. In a study by GarciaBocanegra et al. (2013) in Spain, horses that had ticks were 1.99 times more likely to be seropositive for T. equi and 1.35 times more likely to be seropositive for B. caballi (Garcia-Bocanegra et al., 2013). A study in Brazil demonstrated that horses infested with ticks were 2.6 times more likely to be real time polymerase chain reaction (qPCR) T. equi positive than horses without ticks (Peckle et al., 2013). Mechanical transmission can occur via contaminated syringes, needles, surgical instruments and transfusion of
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
contaminated blood products (de Waal, 1992; de Waal and Heerden, 2004). Cases involving transplacental transmission of T. equi and B. caballi have been reported but foetal and neonatal infection due to B. caballi is thought to be rare (Wise et al., 2013). A previous study by Allsopp et al. (2007) revealed that transmission of T. equi occurs during days 40–150 of gestation which corresponds to the period of histiotrophic nutrition where maternal RBCs can cross the placenta to provide a source of iron to the developing foetus (Allsopp et al., 2007). Parasites in infected RBCs may be transmitted via this route to the developing foetus. Transplacental transmission of equine piroplasmosis is unlikely to occur after the fifth month of pregnancy due to establishment of haemotrophic nutrition and the fully formed structure of the placenta which prevents the transfer of the piroplams from the mare to the developing foetus (Allsopp et al., 2007). The equine foetus does not begin to produce antibody-producing cells until day 240 of gestation. It is thought that transplacental transmission occurs before the foetal immune system is developed sufficiently to recognize antigens as being foreign; parasites already in the system are likely to be recognized as self by the neonate (Allsopp et al., 2007). The placenta of the mare is epitheliochorial; therefore antibodies are unable to cross the placenta to the foetus during pregnancy (Kumar et al., 2008). Maternal antibodies ingested with colostrum as well as innate immune responses may act to control levels of parasitaemia during the foal’s first four months of life (de Waal et al., 2004; Kumar et al., 2008). The percentage of red blood cells (RBCs) parasitized in clinically affected T. equi animals usually range from one to five percent. However, in some cases parasitaemia can exceed 20% (Donnellan and Marais, 2009). The percentage of RBCs parasitized in B. caballi infections is lower (<1%) in the peripheral blood, and the levels are even lower in chronic or inapparent infections (Rothschild, 2013; Donnellan and Marais, 2009; Wise et al., 2013). Carrier mares can transmit equine piroplasms to their offspring, resulting in abortions, stillbirths, neonatal disease or death, or carrier offspring (Allsopp et al., 2007). The abortion rate of thoroughbred horses in Trinidad for the last three years ranged from 11 to 15% (unpublished data, Trinidad and Tobago Racing Authority, 2016). However no comprehensive study was performed to determine the cause of these abortions. Foals infected in-utero are generally weak at birth and rapidly develop anaemia and jaundice, or they become healthy carriers (Donnellan and Marais, 2009; Wise et al., 2013). In areas where equine piroplasmosis is endemic, severe jaundice in a post-partum foal can be easily misdiagnosed as neonatal isoerythrolysis (Georges et al., 2011). The objectives of this study were to investigate transplacental transmission of T. equi and B. caballi in thoroughbred foals from mares naturally infected by the tick vector using microscopic examination of blood smears, enzyme linked immunoassay (ELISA) and conventional (c) and real time (q) polymerase chain reaction (PCR) analysis and to look at risk indicators for the presence of infection in mares and their foals. Both cPCR and qPCR were performed in this study as qPCR is reported to be a more sensitive tool in detecting DNA than cPCR (Dagher et al., 2004). As both mares and foals were exposed to ticks and at risk for infection, this study also followed the foals up to one month after birth to detect clinical signs of disease.
2. Materials and methods 2.1. Epidemiological survey and sample collection A list of all mares confirmed pregnant by ultrasonography by the attending veterinarian in 2011 was obtained from seven farms located throughout Trinidad. A questionnaire was completed for
133
each mare in this study. Questions included origin of the mare that is whether it was locally bred or imported, whether the mare was a maiden, history of resorptions, abortions and stillbirths, if the mare was previously diagnosed with equine piroplasmosis, tick exposure of the animals and the methods of tick control on the stalls and pastures. The mares in this study were monitored for clinical signs associated with abortions or stillbirths until parturition. Ten mL of blood was collected aseptically via jugular venepuncture from the study population of mares at the beginning of the fifth month of pregnancy and from their foals within the first 36 h after birth. Five mL was placed into tubes containing EDTA and into tubes without anticoagulant. Blood samples were stored at 4 ◦ C, and transported to the laboratory for analysis. The attending veterinarian also monitored the foals for failure of passive transfer using SNAP® Foal IgG Test (IDEXX Laboratories Incorporated, Maine, United States of America). Foal health was monitored from birth until one month of age for signs of illness such as icteric mucous membranes, lethargy and decreased suckling reflex. 2.2. Microscopic examination of blood smears Thin blood smears stained with Wright-Giemsa were examined using an Olympus BX41 light microscope (Olympus Corporation, Japan) at 1000X magnification and piroplasms in RBCs were measured using the CellSens Standard 1.7 programme (Olympus Corporation, Japan). 2.3. Serological testing Serum samples were screened for antibodies to T. equi and B. caballi using commercial B. equi antibody cELISA test kits and the B. caballi antibody cELISA test kits (VMRD, Inc. Pullman, WA) respectively according to the manufacturer’s instructions. Optical density (O.D) was read at a wavelength of 620 nm using a Thermo Labsystems Multiskan Ascent (Thermo Labsystems, Finland). Samples with <40% inhibition were considered negative and those >40% inhibition as positive (VMRD, Inc. Pullman, WA). 2.4. DNA extraction DNA was extracted from 100 L of EDTA blood or 10 mg of spleen from aborted foetuses if available using the Qiagen DNeasy Blood & Tissue Kit (Qiagen Maryland USA) according to the manufacturer’s instructions. 2.5. Conventional (c) PCR For cPCR the 18 S rRNA gene was amplified to detect T. equi using the primers BEC-UF2 (5 -TCGAAGACGATCAGATACCGTCG) and Equi-R (5 -TGCCTAAACTTCCTTCCTTGCGAT) (Sigma-Aldrich Inc, St. Louis, MO) which yield a product of approximately 400 base pairs (bp) (Steinman et al., 2012). Five L of target DNA was amplified in a 25 L reaction volume. The reaction conditions consisted of 25 pmol of each forward and reverse primer, 2.5 L GC enhancer, 12.5 L Amplitaq Gold 360 Master Mix (Applied Biosystems, Life Technologies, Carlsbad, CA.) and 4.5 L PCR grade water (Sigma-Aldrich Inc, St Louis, MO, USA). The PCR was performed in a Techne Flexigene Thermal Cycler (Techne, Cambridge, UK) using the following cycling parameters: an initial denaturation step at 96 ◦ C for 10 min, followed by 40 cycles of denaturation at 96 ◦ C for 60 s, annealing at 56 ◦ C for 60 s extension at 72 ◦ C for 60 s. There was a final extension step at 72 ◦ C for 10 min. The 18 S rRNA gene was again amplified to detect B. caballi using the universal forward primer BEC-UF2 (5 TCGAAGACGATCAGATACCGTCG) and a reverse primer Cab-R (5 CTCGTTCATGATTTAGAATTGCT) (Sigma-Aldrich Inc. St Louis, MO, USA). The PCR
134
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
reaction yielded a product of approximately 540 bp (Alhassan et al., 2005). The reaction conditions were the same as previously described for T. equi except that the annealing temperature used for B. caballi was 51.3 ◦ C for 60 s. Samples were held at 4 ◦ C. The PCR products were subjected to electrophoresis in 2.0% agarose in 1% TBE buffer pre-stained with ethidium bromide to visualize under uv light. Positive cPCR amplified products for T. equi and B. caballi were sequenced (Macrogen Inc, South Korea). Positive T. equi and B. caballi DNA from this study are available on GenBankTM EMBL and DDBJ databases under the accession numbers KT285377 and KU289089 to KU289096 for T. equi and KU289100 for B. caballi. 2.6. Real time (q) PCR Five serial dilutions of the positive controls for T. equi and B. caballi were done in 1:10 using RNAse/DNAse free water. 5 L of stock and each dilution were used to generate a standard curve for these equine piroplasms. DNA from the foals was subjected to qPCR analysis using PrimerDesign genesig kits (PrimerDesign Limited, United Kingdom). Quantification of T. equi and B. caballi were based on the Equi merozoite antigen 1 (ema – 1) gene and the 18 S ribosomal gene respectively. Extracted DNA from the foals was diluted 1:20 using RNAse/DNAse free water. 5 L of the diluted DNA was amplified using the following reaction conditions to give a total reaction volume of 20 L. For T. equi, 10 L of oasigTM 2X q PCR mastermix was added to 1 L of T. equi Primer/Probe mix, 1 L of internal extraction control primer/probe mix and 3 L of RNAse/DNAse free water. The reaction conditions were similar for B. caballi with the exception of 4 L of RNAse/DNAse free water used instead of 1 L of internal extraction control primer/probe mix and 3 L of RNAse/DNAse free water that were used for T. equi. Five L of RNAse/DNAse free water was used as a negative control. qPCR was conducted using an Applied Biosystems® 7500 RealTime PCR System (BioAnalytical Instruments, Puerto Rico). The thermocycling conditions were as follows for T. equi, enzyme activation at 95 ◦ C for 15 min, and 50 cycles of denaturation at 95 ◦ C for 10 s followed by data collection at 60 ◦ C for 1 min. The thermocycling conditions for B. caballi were as described for T. equi except that enzyme activation was 95 ◦ C for 10 min. Fluorogenic data were collected for both reactions through the FAM channel. Comparison of the cycle threshold (Ct) values of the extracted DNA samples to the Ct values of the serial dilutions of the positive controls were used to determine if the samples were positive or negative for the piroplasms. 2.7. Statistical analysis All data were analysed using SPSS (version 20) and STATA 12 (Statacorp LP, College Station TX) for both mares and foals. Statistical significance was set at p < 0.05 throughout the study. The risk factors that were investigated in this study included ticks on mares, local or imported mares, previous history of resoptions, abortions or stillbirths and tick fever, previous foals with medical conditions during the first month post-partum, outcome of current pregnancy as well as tick control on the pastures. The 2 test for independence with the Yates’ continuity correction was used to determine if there was an association between PCR or ELISA results of the mares or foals and the above risk factors where applicable. The Fisher’s exact test was used when cells had expected frequency <5. qPCR results was considered the gold standard for analysis of the foal data. The Kappa (K) statistic was used to measure agreement beyond chance between the cPCR and qPCR results of the foals. Interpretation of the K value was as follows: <0.20
Fig. 1. Blood smear of a four-hour old foal showing a pyriform organism in a red blood cell typical for Babesia spp (white arrow). An average of four pyriform organisms was observed in every 50 HPF (0.04% parasitaemia).
indicates poor, 0.21–0.40 fair, 0.41–0.60 moderate, 0.61–0.80 good and 0.81–1.00 very good strength of agreement (Altman, 1990). Significant risk factors of the mare were then used to create a logistic regression model for T. equi cPCR result for the mare. Significant risk factors of the foals were used to create a logistic regression model for B. caballi or T. equi serological status of the foal 3. Results One hundred and seventeen mares from seven farms were sampled at the beginning of the study, however complete data was obtained for 111 mares (two mares died and four mares were relocated to farms that were not accessible). Twenty-two mares (19.8%) had abortions and there were 89 live births. Seventy-eight foals were screened for failure of passive transfer of which five had partial failure of passive transfer. There was an average of 18 pregnant broodmares per farm with a range of 7–26. All pregnant mares on the farms sampled were included in this study. All the horses in the study were thoroughbred mares used for breeding purposes and were allowed to graze on pasture once a day. All of the farms practiced tick control and prevention. The ages of the mares in this study ranged from 4 to 17 years with a median of 8 years. Sixty-six (56%) mares were locally bred. Sixteen (14%) were maiden mares, 21 (18%) had a previous history of reproductive losses with the majority (11, 52%) being embryonic or foetal resorptions. Four (3%) mares had a previous history of stillbirths, seven (6%) experienced abortions and eleven (10%) had resorptions. The majority of mares (8, 38%) had losses that occurred during the second and third month of pregnancy with a range from the first month to the tenth month of gestation, (median 2.5). Six (5%) of the mares in this study had previous foals that developed medical complications during the first month post-partum. Some of these medical complications were foals with poor suckling reflexes (17%), conformational abnormalities (17%), pyrexia (17%), trauma (17%) and others (33%) of which the exact nature was not recorded. Sixteen (14%) mares had been previously diagnosed with piroplasmosis. 3.1. Microscopic examination of blood smears Piroplasms were detected on microscopic examination of one mare (0.9%) and one (1.1%) foal in this study. The piriform like organisms observed in these blood smears were classical or typical for Babesia spp. These inclusions were round to piriform in shape with a length of 1.5–2.0 m with a basophilic rim and a clear
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
135
cPCR positive mare that did not abort was serologically and cPCR positive for T. equi but serologically negative for B. caballi. This live foal appeared normal up to one month after parturition. All foals in this study were negative for B. caballi via cPCR. 3.4. Real time PCR (qPCR) results
Fig. 2. Atypical piriform like unidentified inclusions observed in the red blood cells of 37 foals sampled in the first 36 h of life with an average of 15 inclusions observed in 50 HPFs (0.15% parasitaemia).
centre (Fig. 1). The levels of parasitaemia of the mare and foal were 0.00625% and 0.15% respectively. Atypical piriform-like inclusions were observed in the RBCs of twenty eight (31%) foals in this study (Fig. 2). The inclusions were small, oval in shape with a basophilic rim and a clear centre. There were two different sizes of the piriform-like inclusions observed, 1.119 × 1.053 m and 0.840 × 0.827 m. These dimensions were smaller than those reported for both T. equi and B. caballi. The average level of parasitaemia was 0.04%. T. equi piroplasms in RBCs are round, oval, amoeboid or piriform in shape with an average length of 1.5–2 m (Mehlhorn and Schein, 1998). B. caballi piroplasms in the RBCs are large, usually pear shaped with a length of 2.5–6 m (Mehlhorn and Schein, 1998; Kumar et al., 2008). 3.2. Serological results Thirty-four (30.6%) mares and 14 (15.7%) of their foals were seropositive for T. equi. Eighty nine (76.1%) mares and 38 (42.7%) of their foals were seropositive for B. caballi. However one and two seropositive foals were born to mares that were negative serologically for T. equi and B. caballi respectively. Twenty one of the mares (18%) were serologically positive for both T. equi and B. caballi at the fifth month of pregnancy. Of the 89 foals, seven (8%) were serologically positive for both piroplasms. 3.3. Conventional PCR (cPCR) results 3.3.1. Theileria equi Twenty-seven (24.3%) mares were positive for T. equi by cPCR. Four (4.5%) foals were cPCR positive for T. equi. These cPCR T. equi positive foals had piroplasm-like organism in their RBCs (Fig. 2) but were serologically negative for T. equi. These foals appeared clinically normal at birth and did not have failure of passive transfer of immunoglobulins. Of the four cPCR T. equi positive foals, two were born to mares that were both serologically and cPCR negative for T. equi at the time of sampling. 3.3.2. Babesia caballi Four (3.4%) mares were positive for B. caballi by cPCR. Only one of these mares gave birth to a live foal and neither piroplasms nor B. caballi DNA was detected in the blood of this live foal. The B. caballi
The fifth serial dilution of the positive control for T. equi and B. caballi gave Ct values of 32.31 and 39.5 respectively. These values were therefore used as the positive cut off values for T. equi and B. caballi. Of the 91 foals’ DNA (89 whole blood and 2 spleen samples) samples tested by qPCR, seven (8%) of the whole blood samples were positive for T. equi and six (7%) (5 whole blood and 1 spleen from an 8.5 month old aborted foetus) were positive for B. caballi. Three of the samples were both qPCR and cPCR positive for T. equi. Only one foal in this study was positive for both T. equi and B. caballi by qPCR. Eight (6.8%) mares were tested for T. equi by qPCR and of which all were negative. Eight of the 29 mares (28%) that were tested by qPCR were positive for B. caballi. The Kappa statistic for agreement between cPCR and qPCR results for foals in this study was k = 0.513 (95% CI 0.15–0.88), (p < 0.001) indicating moderate agreement (Altman, 1990). 3.5. Abortions Twenty-two (19.8%) mares aborted in this study. These abortions occurred between the second and eleventh month of gestation with a median of four months. Five mares that were seropositive for T. equi aborted during months 3–8 of gestation. Three mares that were cPCR positive for T. equi aborted at months 5, 6 and 8 respectively. Twenty mares that aborted were serologically positive for B. caballi. Of the three mares that were cPCR B. caballi positive, two resorbed at the third month and the third had a stillbirth at 10.5 month of gestation. Microscopic examination of the blood smear of the mare that aborted at the 10.5 month of gestation revealed rare piriform piroplasms with an average length of 1.70 m. This mare was also serologically positive for B. caballi. Necropsy examination was conducted on an 8.5 month old aborted foetus and placenta. Mild to moderate placentitis and septicaemia were determined as the cause of the abortion. DNA extracted from the spleen was positive for B. caballi by qPCR. Blood from this mare was serologically positive for B. caballi and cPCR negative for B. caballi when samples at the fifth month of pregnancy. The relationship between a mare being seropositive for T. equi or B. caballi and the outcome of that pregnancy (i.e. whether it aborted or gave birth to a live foal) was not significant in this study. 3.6. Risk factors All significant variables were entered into logistic regression models for T. equi seropositive foal, T. equi cPCR positive foal and a B. caballi seropositive foal and the following results were obtained. Mares that were serologically positive for T. equi were 1147 times more likely to be cPCR positive for T. equi, (OR = 1147, (95% CI = 59.89–21972.71), (p < 0.001)), (Table 1). Mares that were serologically positive for T. equi were 55.7 times more likely to have a T. equi seropositive foal (OR = 55.7, (95% CI = 6.6–468.2),
Table 1 Logistic regression model for a positive T. equi conventional PCR result of the mare. PCR T. equi results mare
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
T. equi ELISA mare cons
1147.16 0.004
1728.1 0.006
4.68 −3.9
<0.001 <0.001
59.89–21972.71 0.0003–0.066
136
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
Table 2 Logistic regression model for a positive T. equi ELISA result of the foal. T. equi ELISA results foal
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
T. equi ELISA mare cons
55.72 0.016
60.51 0.018
3.7 −3.76
<0.001 <0.001
6.63–468.16 0.002–0.139
Table 3 Logistic regression model for a positive B. caballi ELISA result of the foal. B. caballi ELISA results foal
Odds Ratio
Std. Err.
Z
P > [z]
95% CI
B. caballi ELISA mare cons
39.42 0.049
38.9 0.045
3.72 −3.27
<0.001 0.001
5.70–272.71 0.008–0.300
(p < 0.001)) (Table 2). A B. caballi seropositive mare was 39.4 times more likely to have a B. caballi seropositive foal (OR = 39.42, (95% CI = 5.70–272.71), (p < 0.001)) (Table 3). There were no significant risk factors observed for B. caballi cPCR positive results of the mares or B. caballi qPCR results of the foals. 3.7. Follow up of foals Of the seven qPCR T. equi positive foals, two remained clinically normal up to one month post-partum, four developed complications of diarrhoea and one foal had typical RBCs inclusions and clinical signs associated with equine piroplasmosis. The foal that had typical babesial – like inclusions in its red blood cells at four hours after birth developed clinical signs of lethargy and icterus four days post-partum. This foal was positive for T. equi by both cPCR and qPCR. The foal was treated with a combination of oxytetracycline (10 mg/kg SID), imidocarb dipropionate (2.2 mg/kg), ceftiofur (4.4 mg/kg SID), chloramphenicol (25 mg/kg TID) and trimethoprim-sulfa (30 mg/kg BID) for approximately two months. The foal recovered and appeared clinically normal despite a persistent leucocytosis during the treatment period. However this foal remained serologically negative for T. equi up to one month of age. The five foals that were positive for B. caballi by qPCR did not show any clinical abnormalities within the first month postpartum. 4. Discussion This study is the first report of a field investigation of transplacental transmission of equine piroplasmosis in thoroughbred foals. Other articles on transplacental transmission of equine piroplasmosis included experimental studies as well as case reports of transplacental transmission in countries such as United Kingdom (Phipps and Otter, 2004); India (Sudan et al., 2015; Chhabra et al., 2012); South Africa (Allsopp et al., 2007) and Trinidad (Georges et al., 2011). This study used several diagnostic techniques to detect DNA of the equine piroplasms or exposure to these agents in both mares and foals. This study also followed the foals up to one month of age. Of 267 thoroughbred mares that were bred in Trinidad for that year, the average abortion rate was 15%. The majority of mares (76.1%) and foals (44.9%) in this study were serologically positive for B. caballi and T. equi antibodies were only found in 34 (30.6%) mares in this study. These findings are consistent with those of Asgarali et al. (2007) which revealed a seroprevalence of 33.3% for T. equi and 68.8% for B. caballi in Trinidad in 2007. A new-born foal will only become serologically positive for these piroplasms after ingestion and absorption of colostrum that contains antibodies to T. equi and or B. caballi. In this study, 14 of the 34 T. equi seropositive mares had foals that were serologically positive for T. equi and 38 of the 89 B. caballi seropositive mares had foals
serologically positive for B. caballi. A foal born of a T. equi seropositive mare was 56 times (95% CI 6.63–468.16) more likely to be serologically positive for T. equi than a foal born to a T. equi seronegative mare and similarly a foal born of a B. caballi seropositive mare was 39.4 times (95% CI 5.70–272.21) more likely to be serologically positive for B. caballi than a foal born to a mare that was serologically negative for B. caballi at the fifth month of pregnancy. This study indicates that being born of a serologically positive mare appears to be a significant determinant of the foals’ seropositive status It was interesting to note that 14 T. equi serologically positive mares and 25 B. caballi seropositive mares had foals that were serologically negative for T. equi and B. caballi respectively. This can be explained by waning levels of specific antibodies during pregnancy. The low levels of antibodies that can be passed from the mare to the foal may not be of sufficient quantity to result in a positive serological result in the foal after the ingestion of colostrum. As transplacental transmission by nourishment through histiotroph is believed to occur before the foals begin to make antibody producing cells, foals will thus be serologically negative before the ingestion of colostrum. As all blood samples in this study were obtained after colostrum was ingested, the serologically negative foals may not have ingested sufficient colostral antibodies. One mare that was serologically negative for T. equi during the fifth month of pregnancy had a foal that was seropositive for T. equi and two B. caballi seronegative mares had foals that were serologically positive for B. caballi. As mares were sampled once at the fifth month of pregnancy, it is possible that these mares seroconverted at a later date, thereby passing on these antibodies to the foal via colostrum. Although the majority of mares were serologically positive for B. caballi (76.1% vs 30.6% for B. caballi and T. equi respectively), T. equi DNA was most frequently detected in this study (24.3% vs 3.4%). An extremely significant finding in this study was that all 27 of the mares that were cPCR positive for T. equi were also serologically positive for T. equi. Three of the four (75%) B. caballi mares that were cPCR positive for B. caballi were also seropositive for this piroplasm. Previous studies have reported that once an animal is infected with T. equi it remains infected for life (Wise et al., 2013). There is controversy about the status of B. caballi infections. It has been reported that horses may take up to four years to clear B. caballi infections, while other studies using more sensitive diagnostic tests have reported that this piroplasm is not readily cleared by the immune system and that the animal remains infected for life (Wise et al., 2013). The fact that a lower prevalence of B. caballi infections were detected in this study using cPCR could be explained by the fact that <1% of peripheral RBCs are parasitized by B. caballi, and <0.01% in chronic infections. In contrast to B. caballi, the number of T. equi infected RBCs may range from 1% to 5% under field conditions (Wise et al., 2013). In this study seven (8%) and six (7%) foals were detected by qPCR to have possible transplacental infections of T. equi and B. caballi respectively. Three foals were cPCR positive for T. equi and all were
C. Sant et al. / Veterinary Parasitology 226 (2016) 132–137
cPCR negative for B. caballi. This result confirms that qPCR is more sensitive than cPCR in the detection of both T. equi and B. caballi. There was moderate agreement for T. equi when comparing qPCR and cPCR. All possible combinations of infections and serological status for mare and foals were detected in this study. Three of the seven foals in this study that were qPCR positive for T. equi were born to mares that were serologically and cPCR positive for T. equi, hence four of these foals were born to mares that were cPCR negative for T. equi at the fifth month of gestation. A reason for this occurrence could be that the piroplasms may have been transmitted to the neonatal foal via umbilical cord blood during parturition assuming that the mare was infected with T. equi after the fifth month of gestation. Unfortunately qPCR was not performed on the mares of these three foals and the mares were not resampled at the time of parturition. Another possible explanation could be the fact that piroplasms are known to sequester to the bone marrow resulting in an extremely low parasitaemia which may be undetectable via cPCR analysis of DNA extracted from blood. Latent infections or sequestered piroplasms may also manifest as a result of the hormonal changes associated with parturition which may result in a decrease level of immunity of the mare (Kaneko et al., 2008). A large number of factors can contribute to in utero transmission of equine piroplasms. Some of these include transmission by infected RBCs as maternal RBCs cross the placenta providing a source of iron to the developing foetus. This is the first reported field study of both mares and foals to investigate transplacental transmission of both T. equi and B. caballi. Further research is needed to investigate transmission via umbilical cord blood and the role of colostral antibodies in reducing parasitaemia and to identify and quantify the immunoglobulins that are present in the colostrum which act against piroplasms. 5. Conclusions In this study neonatal piroplasmosis was confirmed in seven (7.8%) foals by qPCR for T. equi. Also, five (5.6%) live births and one DNA extracted sample from the spleen of an 8.5 month aborted foetus were positive for B. caballi by qPCR. Infection with T. equi was an important risk factor in abortions of three (2.7%) mares and B. caballi infections appear likely to contribute to three abortions. For horses living in endemic areas for equine piroplasmosis, this study indicates that transplacental transmission is in fact a common occurrence. Sensitive diagnostic techniques should be used to screen mares during pregnancy so that their foals can be closely monitored at parturition and screened for equine piroplasmosis so treatment of positive foals can be implemented earlier for a better prognosis. Further studies are needed to determine if the rate of disease transmission to foals may be reduced through therapeutic interventions. Acknowledgements The authors would like to thank Siann Baldeo, Nalini Kalloo, Lemar Blake and Fatima Mohammed for their technical support. In
137
addition we thank the veterinarians, Drs Michelle Branday, Clive Ali and Rossi Bridgelal who assisted with this study and all racehorse owners and managers of the farms involved who supplied data and monitored the mares and foals for this study. This project could not have been possible without the financial support of The University of the West Indies Campus Research and Publication Fund (grant number 26600-457889). References Alhassan, A., Pumidonming, W., Okamura, M., Hirata, H., Battsetseg, B., Fujisaki, K., Yokoyama, N., Igarashi, I., 2005. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 129, 43–49. Allsopp, M.T., Lewis, B.D., Penzhorn, B.L., 2007. Molecular evidence for transplacental transmission of Theileria equi from carrier mares to their apparently healthy foals. Vet. Parasitol. 148, 130–136. Altman, D.G., 1990. Practical Statistics for Medical Research. CRC Press London. Asgarali, Z., Coombs, D.K., Mohammed, F., Campbell, M.D., Caesar, E., 2007. A serological study of Babesia caballi and Theileria equi in Thoroughbreds in Trinidad. Vet. Parasitol. 144, 167–171. Chhabra, S., Ranjan, R., Uppal, S.K., Singla, L.D., 2012. Transplacental transmission of Babesia equi (Theileria equi) from carrier mares to foals. J. Parasit. Dis. 36, 31–33. Dagher, H., Donninger, H., Hutchinson, P., Ghildyal, R., Bardin, P., 2004. Rhinovirus detection: comparison of real-time and conventional PCR. J. Virol. Methods 117, 113–121. de Waal, D.T., 1992. Equine piroplasmosis: a review. Br. Vet. J. 148, 6–14. de Waal, D.T., Heerden, J.V., Coetzer, J.A., Tustin, R.C., 2004. Equine piroplasmosis. Infectious diseases of livestock, Vol. 1, 2 ed. pp. 425–434. Donnellan, C., Marais, H., 2009. Equine piroplasmosis. infectious diseases of the horse. Equine Vet. J. Ltd., 333–339. Garcia-Bocanegra, I., Arenas-Montes, A., Hernandez, E., Adaszek, L., Carbonero, A., Almeria, S., Jaen-Tellez, J.A., Gutierrez-Palomino, P., Arenas, A., 2013. Seroprevalence and risk factors associated with Babesia caballi and Theileria equi infection in equids. Vet. J. 195, 172–178. Georges, K.C., Ezeokoli, C.D., Sparagano, O., Pargass, I., Campbell, M., D’Abadie, R., Yabsley, M.J., 2011. A case of transplacental transmission of Theileria equi in a foal in Trinidad. Vet. Parasitol. 175, 363–366. Hussain, M.H., Saqib, M., Raza, F., Muhammad, G., Asi, M.N., Mansoor, M.K., Saleem, M., Jabbar, A., 2014. Seroprevalence of Babesia caballi and Theileria equi in five draught equine populated metropolises of Punjab, Pakistan. Vet. Parasitol. 202, 248–256. Kaneko, J.J., Harvey, J.W., Bruss, M.L., 2008. Clinical biochemistry of domestic animals. Elsevier Sci. 2008, 612–613. Kumar, S., Kumar, R., Gupta, A.K., Dwivedi, S.K., 2008. Passive transfer of Theileria equi antibodies to neonate foals of immune tolerant mares. Vet. Parasitol. 151, 80–85. Mehlhorn, H., Schein, E., 1998. Redescription of Babesia equi laveran, 1901 as Theileria equi. Parasitol. Res. 84, 467–475. Peckle, M., Pires, M.S., Dos Santos, T.M., Roier, E.C., da Silva, C.B., Vilela, J.A., Santos, H.A., Massard, C.L., 2013. Molecular epidemiology of Theileria equi in horses and their association with possible tick vectors in the state of Rio de Janeiro, Brazil. Parasitol. Res. 112, 2017–2025. Phipps, L.P., Otter, A., 2004. Transplacental transmission of Theileria equi in two foals born and reared in the United Kingdom. Vet. Rec. 154, 406–408. Rothschild, C.M., 2013. Equine piroplasmosis. J. Equine Vet. Sci. 33, 497–508. Steinman, A., Zimmerman, T., Klement, E., Lensky, I.M., Berlin, D., Gottlieb, Y., Baneth, G., 2012. Demographic and environmental risk factors for infection by Theileria equi in 590 horses in Israel. Vet. Parasitol. 187, 558–562. Sudan, V., Jaiswal, A.K., Srivastava, A., Saxena, A., Shanker, D., 2015. A rare clinical presentation of transplacental transmission and subsequent abortion by Babesia (Theileria) equi in a mare. J Parasit. Dis. 39, 336–338. Wise, L., Kappmeyer, L., Mealey, R., Knowles, D., 2013. Review of equine piroplasmosis. J. Vet. Intern. Med. 27, 1334–1346.