Prostaglandin F2α-PTGFR signaling promotes proliferation of endometrial epithelial cells of cattle through cell cycle regulation

Animal Reproduction Science 213 (2020) 106276

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Prostaglandin F2α-PTGFR signaling promotes proliferation of endometrial epithelial cells of cattle through cell cycle regulation

T

Changqi Fua,b, Wei Maoa,b, Ruifeng Gaoa,b, Yang Denga,b, Long Gaoa,b, Jindi Wua,b, Shuangyi Zhanga,b, Yuan Shena,b, Kun Liua,b, Qianru Lia,b, Xiaoxia Songa,b, Jinshan Caoa,b,*, Bo Liua,b,* a b

Laboratory of Veterinary Pharmacology, College of Veterinary Medicine, Inner Mongolia Agricultural University, Hohhot, China Key Laboratory of Clinical Diagnosis and Treatment Techniques for Animal Disease, Ministry of Agriculture, China

A R T IC LE I N F O

ABS TRA CT

Keywords: Prostaglandin F2α-PTGFR signaling Bovine endometrial epithelial cells Cell proliferation Cell cycle

There is production of prostaglandin F2α (PGF2α) and there is PGF2α receptor (PTGFR) mRNA transcript in endometrial epithelial cells of cattle. The aims of the present study were to (1) determine whether PGF2α-PTGFR signaling modulates the proliferation of endometrial epithelial cells and (2) increase knowledge of PGF2α-PTGFR signaling on the physiological and pharmacological processes in the endometrium of cattle. Amount of cellular proliferation was determined using real-time cell analysis and cell proliferation reagent WST-1 procedures. Abundance of cyclins, cyclin-dependent kinases (CDKs), cyclin-kinase inhibitors, proliferating cell nuclear antigen (PCNA), cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), PTGFR, epidermal growth factor (EGF) mRNA and protein abundances were evaluated using real-time RT-PCR and western blot analyses. The PGF2α-PTGFR signaling promoted the proliferation of endometrial epithelial cells by inducing changes in abundance of mRNA transcript and protein that resulted in an increase in the abundance for the cyclins (A, B1, D1, D3), CDKs (1, 2, 4, 6), and PCNA; decrease in abundance for p21; and increase in abundance for EGF, COX-1, COX-2, and PTGFR. There was a direct molecular association between PGF2α-PTGFR signaling and cell cycle regulation in endometrial epithelial cells of cattle. In addition, findings improve the understanding of PGF2α-PTGFR signaling in the physiological and pharmacological processes of the endometrium of cattle.

1. Introduction Prostaglandin F2α (PGF2α) is a prostanoid that belongs to the eicosanoid family of biologically active lipids and is synthesized as a result of a series of complex endothelial cell processes (Shuh Narumiya, 2001; Milne and Jabbour, 2003). There is a wide distribution of PGF2α in various organs and PGF2α has various biological functions (Basu, 2010; Zhang et al., 2017). In cattle, there is a close association between PGF2α concentrations, and abundance of the PGF2α receptor (PTGFR), as well as endometrial growth during the behavioral estrus or early pregnancy. Results of related studies indicate the concentration of PGF2α increased in the uterus and there was an increased in abundance of PTGFR in the endometrium of cattle during behavioral estrus (Shemesh and Hansel, 1975; Arosh et al., 2004). During the early stages of pregnancy in cattle, PGF2α concentration was markedly increased in the endometrium ⁎ Corresponding authors at: Laboratory of Veterinary Pharmacology, College of Veterinary Medicine, Inner Mongolia Agricultural University, No. 306, Zhaowuda Road, Saihan District, 010018, Hohhot, China. E-mail addresses: [email protected] (J. Cao), [email protected] (B. Liu).

https://doi.org/10.1016/j.anireprosci.2020.106276 Received 1 March 2019; Received in revised form 14 November 2019; Accepted 7 January 2020 Available online 08 January 2020 0378-4320/ © 2020 Elsevier B.V. All rights reserved.

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

(Ulbrich et al., 2009). Interestingly, results of further studies indicte PGF2α-PTGFR signaling promoted an increase in growth factor abundance and cell proliferation in endometrial explants of cattle (Zhang et al., 2017). In summary, PGF2α has important functions in reproduction, cytokine regulation, and cell proliferation, however, the molecular mechanism of cell proliferation induced by PGF2α has not been fully elucidated. During the development of cells in many organs of the body, the cell cycle molecular network system of cyclins, cyclin-dependent kinases (CDKs), and cyclin-dependent kinase inhibitors (CKIs), can precisely regulate the cell cycle in the G1-S-G2-M phases (Lim and Kaldis, 2013a, b; Lee et al., 2015). The PCNA protein is often used as a “marker” of newly replicated DNA, which indicates the beginning of cell proliferation during the cell cycle (Yang et al., 2004; Georgescu et al., 2015). In the present study, the question asked was: does PGF2α regulate the proliferation by regulating the cyclin-CDK-CKI network and PCNA in endometrial epithelial cells of cattle. To answer this, there was assessment of the responses of a series of cyclins, CDKs, CKIs, and PCNA on the PGF2α-PTGFR signaling pathway. The production of prostaglandins (PGs) is generally thought to be affected by the rate-limiting enzymes cyclooxygenase-1 (COX-1) or cyclooxygenase-2 (COX-2). These enzymes are encoded by two different genes and have distinct cell-specific actions, regulations, and subcellular localizations, yet these enzymes have similar structural and kinetic properties (Lim et al., 1997; Dong et al., 2015). Results of previous studies indicate targeting the destruction of COX-2, but not COX-1 (Sales and Jabbour, 2003), resulted in disruption of the ovulation, fertilization, implantation, and decidualization physiological processes (Lim et al., 1997). In the oviduct of cattle, COX-1 protein abundance is greater in the early-to mid-luteal phase and COX-2 mRNA abundance remains unchanged throughout the estrous cycle (Odau et al., 2006; Dong et al., 2015). Hence, results of all of the previously described studies that focused on COX-1 and COX-2 indicate these enzymes are essential for reproduction, however, the specific functions of COX-1 and COX-2 in proliferation are unknown in endometrial epithelial cells of cattle. Results of numerous studies indicate epidermal growth factor (EGF) promotes proliferation of a various cell types (Agaoglu et al., 2016; Chen et al., 2016; Garmanchuk et al., 2016). It, therefore, was proposed for the present study that PGF2α-PTGFR signaling would facilitate cellular proliferations by regulating the abundances of COX-1, COX-2, and EGF. The objectives of the present study were to explore the molecular mechanisms between PGF2α-PTGFR signaling and cell proliferation. Findings will help in the elucidation of the molecular mechanisms between PGF2α-PTGFR signaling and cell proliferation and improve understanding of PGF2αPTGFR signaling in the physiological and pharmacological processes affecting endometrial functions of cattle. 2. Materials and methods 2.1. Ethics statement All animal studies were conducted in accordance with the experimental practices and standards approved by the animal welfare and research ethics committee of Inner Mongolia Agricultural University (Approval ID: 20160829-1), and all efforts were made to minimize animal suffering. 2.2. Reagents, chemicals, and antibodies The reagents and consumables were purchased from the following: Fetal bovine serum (FBS; ExCell Biology, Inc, China), DMEM/ F-12 (Gibco, USA), PGF2α (CAYMAN, USA), PTGFR agonist fluprostenol (CAYMAN, USA), PTGFR antagonist AL8810 (Sigma, USA), aspirin (CAYMAN, USA), indomethacin (Sigma, USA), Cell Proliferation Reagent WST-1 (Roche, Germany), xCELLigence RTCA S16 (ACEA Biosciences, USA), penicillin and streptomycin (Gibco, USA), 6-well and 96-well culture plates (Corning, USA), protease from Streptomyces griseus (Sigma, USA), AxyPrep Multisource Total mRNA Miniprep Kit (Axygen Scientific, USA), PrimeScripT RT reagent kit (TaKaRa, Japan), SYBR Premix Ex TaqTM (TaKaRa, Japan), M-PER Mammalian Protein Extraction Reagent (Thermo Fisher, USA), Halt Protease Inhibitor (Thermo Fisher Scientific, USA), Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA), centrifugal filter units (Millipore, USA), Trizma base (Sigma, USA), PVDF transfer membranes (Millipore, USA), anti-PTGFR antibody (101802, CAYMAN, USA), anti−COX-1 antibody (ab39351, Abcam, UK), anti−COX-2 antibody (ab102005, Abcam, UK), anti-cytokeratin 18 antibody (ab668, Abcam, UK), anti-cyclin A antibody (ab38, Abcam, UK), anti-cyclin B1 antibody (ab138572, Abcam, UK), anticyclin D1 antibody (ab6152, Abcam, UK), anti-cyclin D3 antibody (ab28283, Abcam, UK), anti-cyclin E2 antibody (ab94724, Abcam, UK), CDK1 antibody (NBP2-34331, Novus, USA), CDK2 antibody (NBP2-15841, Novus, USA), CDK4 antibody (NBP1-31308, Novus, USA), CDK6 antibody (NBP2-15846, Novus, USA), anti-proliferating cell nuclear antigen (PCNA) antibody (ab29, Abcam, UK), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (ab9482, Abcam, UK), goat anti-rabbit IgG horseradish peroxidase (HRP)-linked (7074, Cell Signaling Technology, USA), goat anti-mouse IgG HRP-linked (7076, Cell Signaling Technology, USA), and SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, USA). Primers were synthesized by Invitrogen, China. 2.3. Isolation and culture of endometrial epithelial cells Uterine tissues (approximately 6-year-old Holstein non-pregnant cows, n = 8) were obtained from a local slaughterhouse and transported to the laboratory in sterile glass containers, in an ice bath. Enzymatic digestion and mechanical separation methods were used to separate primary endometrial epithelial cells from other uterine tissues/cells. Uteri were washed three times with phosphatebuffered saline (PBS), 500 U/mL penicillin, and 500 μg/mL streptomycin. To expose the endometrial tissue, there was a longitudinal 2

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

incision made into each uterine horn (< 2 cm in length) and the uterine luminal tissues were washed three times using Dulbecco's phosphate-buffered saline (DPBS) supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin. The exposed endometrial tissue was then placed in 1 % protease from Streptomyces griseus for enzymatic digestion overnight at 4 °C. For the collection of epithelial cells of the endometrium, the endometrial tissue was gently scraped from the underlying uterine tissues and the cells were washed three times with PBS supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin using centrifugation (300 g for 5 min). Cells were seeded into cell culture flasks with a medium (DMEM/F12 with 15 % FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin) and incubated at 37 °C in a 5 % CO2 atmosphere. Media were changed once every 48 h until cells were dispersed across the bottom of the culture flask. The cells were digested using trypsin (0.25 %) supplemented with 0.1 % EDTA-2Na. Subsequently, the purified endometrial epithelial cells were isolated after four serial passages for subsequent analysis. Immunofluorescence staining was conducted to verify the epithelial origin and purity of the isolated epithelial cells. 2.4. Identification of endometrial epithelial cells using immunofluorescence Epithelial cells were seeded into 35 mm glass-bottom dishes (n = 3) with a medium (DMEM/F12 with 15 % FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin) and incubated at 37 °C with 5 % CO2. After 24 h, the cells were fixed with 4 % paraformaldehyde and blocked with 5 % FBS. The cells were incubated with an anti-bovine cytokeratin 18 antibody (1:1000), followed by addition of an Alexa Fluor 647-conjugated anti-mouse IgG (H + L) secondary antibody (1:750). All samples were counter-stained with the blue-fluorescent DNA stain, DAPI (4´,6-diamidino-2-phenylindole), to visualize the nuclei. A Nikon A1R laser scanning confocal system was used to obtain the images for subsequent analyses. 2.5. Real-time cell analysis (RTCA) The system of xCELLigence RTCA S16 consists of three main modules: an RTCA S16 Analyzer, an RTCA Control Unit, and an EPlate16. The RTCA S16 analyzer and E-Plate16 were placed in an incubator with a humidified atmosphere of 5 % CO2 at 37 °C. An iPad equipped with RTCA S16 software was used to control the operation of the whole system and analyze the data wirelessly. The electronic impedance of the sensor electrodes was determined to evaluate the physiological changes in the cells (Urcan et al., 2010; Malkoc et al., 2012, 2015). The shift of the electrical impedance is expressed as the cell index (CI), which is an indication of cell viability. The CI is a non-dimensional factor that reflects the number of cells and the adhesive actions of cells (Durr et al., 2012). Epithelial cells (1 × 104 cells/well) were seeded in E-Plate16 with a medium (DMEM/F12 with 15 % FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin) and there was assessment of the shifts in CI, which indication that there is ongoing cell proliferations. Cell proliferation was estimated at 12 and 24 h. Data were expressed as means ± SEM for the three independent experiments conducted in duplicate. 2.6. Cell viability assay Epithelial cells (1 × 104 cells/well) of the endometrium were cultured in 96-well plates with a medium (DMEM/F12 with 15 % FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin) and incubated at 37 °C with 5 % CO2. Cell viability was determined after 24 h using a cell proliferation assay kit, WST-1, according to the manufacturer’s instructions. Data were expressed as means ± SEM for the three independent experiments conducted in duplicate. 2.7. Real-time RT-PCR analysis Total RNA was isolated from epithelial cells after treatment for 24 h, and reverse transcription and real-time RT-PCR were conducted according to the manufacturer’s instructions for the PrimeScript RT reagent Kit, for total cDNA preparation, and SYBR Premix ExTaq II, for real-time PCR. The cDNA was amplified by initially using the denaturation procedures for 30 s at 95 °C, followed by 38 cycles of amplification and the annealing temperature was 60 °C. The concentration of cDNA was 500 ng and primers were 400 nM. Some primers used in the real-time RT-PCR are listed in Table 1, while others for the EP receptors were previously described (Weems et al., 2012). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Results are presented as 2−△△Ct (where, △△Ct = △Ct – △Ctcontrol and △Ct = △Cttarget – △CtGAPDH). 2.8. Western blot analysis Total protein was extracted from the epithelial cells after 24 h of treatment using M-PER with Halt Protease Inhibitor. The concentrations of the protein samples were determined using the Pierce BCA Protein Assay Kit, and the amount of denaturation was assessed according to the manufacturer’s instructions. Denatured protein samples were stored at −80 °C. For immunoblot analysis, 30 μg of total protein per lane was resolved on 12 % SDS-PAGE gel and blotted onto a PVDF membrane. The membrane was blocked using 3 % BSA for 2 h at 20–25 °C (room temperature) and incubated overnight with the corresponding primary antibody at 4 °C. The primary antibodies were diluted as follows: PTGFR 1:200, COX-1 1:1000, COX-2 1:1000, cyclin A 1:500, cyclin B1 1:1000, cyclin D1 1:500, cyclin D3 1:1000, cyclin E2 1:1000, CDK1 1:2000, CDK2 1:3000, CDK4 1:3000, CDK6 1:3000, and GAPDH 1:5000. Proteins were visualized by incubation with secondary HRP-conjugated antibodies for 1 h and treatment with Pierce Supersignal West Femto Chemiluminescent Substrate and a high-performance chemiluminescence film. Band density was quantified using ImageJ software. 3

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Table 1 Primers used for gene amplification, sequencing, and Accession Number. Gene symbol

Accession Number

Primer sequence

GAPDH

NM_001034034.2

Cyclin A

X68321.1

Cyclin B1

BC116011.1

Cyclin D1

BC112798.1

Cyclin D3

BC105236.1

Cyclin E2

BT020913.1

CDK1

L26547.1

CDK2

BC150026.1

CDK4

BC109858.1

CDK6

NM_001192301.1

P15

NM_001075894.1

P21

NM_001098958.2

PCNA

NM_001034494.1

COX-1

NM_001105323.1

COX-2

NM_174445.2

EGF

XM_015463717.1

PTGFR

NM_181025.3

Forward: CCTGCCAAGTATGATGAGAT Reverse: AGTGTCGCTGTTGAAGTC Forward: AAGTATTTGCCGTCAGTTATCG Reverse: TGTTGTGCGTGCTGTGGTG Forward: TTGAGGAAGAGCAAGCAGTC Reverse: GCATCTTCTTGGGCACATAG Forward: CTGGTCCTGGTGAACAAACTC Reverse: CACAGAGGGCAACGAAGGT Forward: GCATCTACACCGACCACTCTG Reverse: TCTGGGCGTGCTTCTTGAC Forward: AACACCCCACAAAGAAATAGG Reverse: GAACATCCCCAGCTTAAATCA Forward: ATCCCTCCTGGTCAGTTCAT Reverse: TGAGGTTTTAAGTCCCTGTGG Forward: GCCAGGAGTTACTTCTATGCC Reverse: GCTCCGTCCATCTTCATCC Forward: AGCGTTGGCTGTATCTTTGC Reverse: GGGCAGTCCAATCAGGTCA Forward: GTGCCCACTGAAACCATAAA Reverse: GACCACTGAGGTAAGAGCCAT Forward: CTACTGGAAGCCTTGGAGCC Reverse: GGAATCTCGCCGTAACAACA Forward: CATCTGCTGGGTGTTACGAA Reverse: AGGACAGAGGTGGGAATCAA Forward: TGGAGAACTTGGAAATGGAA Reverse: GGAGACAGTGGAGTGGCTTT Forward: TGCCATCCGAACTCCATCTT Reverse: AATGTGCTTGCCTTCCAGTAC Forward: GGTGCCTGGTCTGATGATGT Reverse: GATTAGCCTGCTTGTCTGGAAC Forward: TCACCTTGGGAAGAATGGAC Reverse: GGACAGTGGCAGGAGAACAG Forward: TTGGTGTTCTGTGAGCTGAAGT Reverse: CATGACCAGAGCGACATCAT

The target-protein band density was normalized based on the detected abundance of GAPDH, as indicated by band density, in the same sample. 2.9. Experimental treatments Epithelial cells were plated in 6- or 96-well dishes with a medium (DMEM/F12 with 15 % FBS, 100 U/mL penicillin, and 100 μg/ mL streptomycin) and incubated at 37 °C with 5 % CO2 and separated into six groups to evaluate the effects of PGF2α-PTGFR signaling. After four serial passages, the cultured cells were grouped as follows: (1) control, (2) PGF2α, (3) PGF2α combined with AL8810, (4) fluprostenol, (5) fluprostenol combined with AL8810, or (6) AL8810. After 12 h in culture, the supernatant was replaced with serum-free and phenol red-free medium for 8 h. The cells of the control group were treated with absolute ethanol (PGF2α, fluprostenol, and AL8810 were dissolved in absolute ethanol) and other groups were treated with different concentrations of PGF2α (10−6 M), fluprostenol (10−6 M), and AL8810 (10-5 M). In groups previously treated with PGF2α or fluprostenol combined with PTGFR antagonist, the cells were initially treated with the PTGFR antagonist AL8810 for 1 h. 2.10. Statistical analysis Statistical analyses were performed using ImageJ, GraphPad Prism 6, and SPSS 18.0 software. All data represent means ± SEM (n = 3). Differences among groups were determined using a one-way ANOVA or two-way ANOVA followed by use of a post-hoc test. Significance was considered when P < 0.05 (*) and P < 0.01 (**). 3. Results 3.1. Cytokeratin 18 and prostaglandin receptors and relative abundance mRNA in cultured cells The cytokeratin 18 and prostaglandin receptor mRNA transcripts were detected in cultured cells (Fig. 1). Cells were isolated after four serial passages and identified by detecting the cytokeratin 18 and prostaglandin receptor, cytokeratin 18 mRNA transcript that is specific for epithelial cells (Fig. 1A). There was detection of the isotype control for cytokeratin in cultured cells (Fig. 1B). The 4

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 1. (A) Immunofluorescence of keratin in cultured cells; (B) IgG isotype control; and (C) relative abundance of PTGER1, PTGER2, PTGER3, PTGER4, and PTGFR in cultured endometrial epithelial cells of cattle.

prostaglandin receptor mRNA transcript was detected in cultured cells (Fig. 1C). 3.2. Prostaglandin F2α-PTGFR signaling effects The concentration-related effects of PGF2α, fluprostenol, and AL8810 were determined using dose-response experiments utilizing 5

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 2. Effects of various concentrations of PGF2α (A, B, C), fluprostenol (D, E, F), and AL8810 (G, H, I) on the cell index (CI) and cell viability of endometrial epithelial cells of cattle; Cell index was determined using real-time cell analysis and cell viability was determined by optical density at 450 nm in a WST-1 assay; Cell viability values are expressed as a percentage of the control (con); Cell index values are defined in the Materials and methods; All values represent means ± SEM of three separate experiments; Differences between groups were examined using one-way ANOVA or two-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

concentrations of 10−8, 10-7, 10-6, and 10-5 M, then, an optimal concentration was selected based on the effects on proliferation of the epithelial cells. Treatment with fluprostenol and PGF2α at 10-6 M increased the CI (P < 0.01; Fig. 2A, B, D, E) and cell viability (P < 0.01; Fig. 2C, F). There was a decrease in cell viability as a result of treatment with AL8810 (10-5 M) (P < 0.05, Fig. 2I) but there was no effect on CI (Fig. 2G, H). In addition, compared with the control values, the results (Fig. 3B; C, E, F) indicated that treatment with either PGF2α or fluprostenol increased (P < 0.01 or P < 0.05) cell proliferation as indicated by cell viability and the CI. Treatment with PGF2α and fluprostenol, however, induced an increase in cell viability but the CI decreased in response to the simultaneous treatment with the PTGFR antagonist, AL8810 (P < 0.01; Fig. 3B, C, E, F). 3.3. Effects of PGF2α-PTGFR signaling on cell cycle regulation To understand the cell proliferation mechanism, there was an evaluation of the association between PGF2α-PTGFR signaling and cell cycle regulatory proteins. Findings indicated that PGF2α and fluprostenol treatments increased cyclin D1, D3, CDK4, CDK6 mRNA transcript and protein abundances (Fig. 4A, B, C, D; P < 0.01 or P < 0.05; G1 phase). Furthermore, these treatments increased cyclin E2, CDK2 (Fig. 5A, B; P < 0.01 or P < 0.05; G1-S check point), cyclin A, B1, CDK1 (Fig. 6A, B, C; P < 0.01 or P < 0.05; S-G2-M) mRNA transcript and protein abundances. In addition, treatment with PGF2α and fluprostenol induced an increase in cell cycle 6

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 3. Effects of PGF2α-PTGFR (A, B, C) and fluprostenol-PTGFR (D, E, F) signaling on the cell index (CI) and cell viability of endometrial epithelial cells of cattle; Cells were treated with PGF2α (10−6 M) or fluprostenol (10−6 M), with or without inclusion of AL8810 (10-5 M); Cell index was determined using real-time cell analysis and cell viability was determined by optical density at 450 nm in a WST-1 assay; Cell viability values are expressed as a percentage of the control (con); Cell index values are defined in Materials and methods; All values represent means ± SEM of three separate experiments; Differences between groups were examined using one-way ANOVA or two-way ANOVA, followed by a post-hoc test where applicable, P < 0.05 (*), P < 0.01 (**).

Fig. 4. Effects of PGF2α-PTGFR signaling on the abundance of cyclins D1 and D3 (A, B), cyclin-dependent kinases (CDKs) 4 and 6 (C, D) mRNA transcript and protein during the G1 phase in endometrial epithelial cells of cattle, as determined by real-time reverse transcription-polymerase chain reaction and western blot analysis; Representative western blots are also shown; Relative mRNA abundances were calculated using the 2−△△ct method with GAPDH as the internal control (con); protein abundance is depicted when normalized against that of GAPDH; All values represent means ± SEM of three separate experiments; Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

7

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 5. Effects of PGF2α-PTGFR signaling on the abundance of cyclin E2 (A) and cyclin-dependent kinase (CDK) 2 (B) mRNA transcript and protein of the G1-S phase in endometrial epithelial cells of cattle, as determined by real-time reverse transcription-polymerase chain reaction and western blot analysis; Representative western blots are also shown; Relative mRNA abundances were calculated using the 2−△△ct method with GAPDH as the internal control (con); protein abundance is depicted as normalized against that of GAPDH; All values represent means ± SEM of three separate experiments; Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

regulatory protein abundance that was negated when there was simultaneous treatment with AL8810 (Figs. 4–6).

3.4. Effects of PGF2α-PTGFR signaling on p15 and p21 abundance The p15 and p21 mRNA transcripts were only detected for 24 h in culture. Treatment with PGF2α decreased the abundances of p21 mRNA transcript (Fig. 7B, P < 0.05). There was no effect of treatment with either fluprostenol or PGF2α on p15 mRNA transcript (Fig. 7A, B).

3.5. Effects of PGF2α-PTGFR signaling on PCNA mRNA transcript and protein abundance Both PCNA mRNA transcript and protein were detected in the cultured endometrial epithelial cells. The abundance of PCNA mRNA transcript increased (P < 0.05) after treatment with PGF2α and fluprostenol (Fig. 8). In addition, the abundance of PCNA protein increased after treatment with PGF2α (Fig. 8, P < 0.01) and fluprostenol (Fig. 8, P < 0.05). 8

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 6. Effects of PGF2α-PTGFR signaling on the abundance of cyclin A and B1 (A, B), cyclin-dependent kinase (CDK) 1 (C) mRNA transcript and protein during the S-G2-M phase in endometrial epithelial cells of cattle, as determined using real-time reverse transcription-polymerase chain reaction and western blot analysis; Representative western blots are also shown; Relative mRNA abundances were calculated using the 2−△△ct method with GAPDH as the internal control (con); protein abundance is shown normalized against that of GAPDH; All values represent means ± SEM of three separate experiments; Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

Fig. 7. Effects of PGF2α-PTGFR signaling on the abundance of p15 and p21 mRNA transcript in the endometrial epithelial cells of cattle, as determined by real-time reverse transcription-polymerase chain reaction; Relative mRNA abundances were calculated using the 2−△△ct method with GAPDH as the internal control (con); All values represent means ± SEM of three separate experiments; Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

3.6. Effects of PGF2α-PTGFR signaling on COX-1, COX-2, PTGFR, and EGF abundance The COX-1, COX-2, and PTGFR mRNA transcripts and proteins were detected in the cultured endometrial epithelial cells using real-time RT-PCR and western blot procedures. Treatment with PGF2α resulted in an increase in the abundance of COX-1 and COX-2 mRNA transcript and protein (P < 0.01; Fig. 9A, B). There was no effect of treatment with fluprostenol on abundance of COX-1 mRNA and protein and COX-2 protein (P < 0.05 or P < 0.01; Fig. 9A, B). Treatment with PGF2α and fluprostenol increased the abundance of PTGFR mRNA and protein (P < 0.01 or P < 0.05; Fig. 9C). The EGF mRNA transcript was detected in the cultured endothelial cells. There was an increase in EGF mRNA abundance (P < 0.01 or P < 0.05) after PGF2α and fluprostenol treatment (Fig. 9D). In addition, the stimulatory effect of PGF2α and fluprostenol was negated when there was also treatment with AL8810 (P < 0.01 or P < 0.05; Fig. 9D).

9

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 8. Effects of PGF2α-PTGFR signaling on the abundance of proliferating cell nuclear antigen (PCNA) mRNA transcript and protein in the endometrial epithelial cells of cattle at 24 h, as determined by real-time reverse transcription-polymerase chain reaction and western blot analysis; Representative western blots are also shown’ Relative mRNA abundances were calculated using the 2−△△ct method with GAPDH as the internal control (con); protein abundance is shown normalized against that of GAPDH; All values represent means ± SEM of three separate experiments’ Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

Fig. 9. Effects of PGF2α-PTGFR signaling on the abundance of COX-1 (B), COX-2 (A), PTGFR (C), and epidermal growth factor (EGF) (D) mRNA transcript and protein in the endometrial epithelial cells of cattle, as determined using real-time reverse transcription-polymerase chain reaction and western blot analysis; Representative western blots are also shown; Relative abundance of mRNA were calculated using the 2−△△ct method with GAPDH as the internal control (con); protein abundance is shown normalized against that of GAPDH; All values represent means ± SEM of three separate experiments; Differences between groups were examined using a one-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

3.7. Effects of aspirin and indomethacin on cell proliferation To further elucidate the relationship between COX enzymes and cell proliferation, there was examination of the effect of treatments with COX inhibitors (aspirin and indomethacin) on cell proliferation using RTCA and WST-1. The results (Fig. 10A, B) indicate that: (1) Treatment with aspirin (10−6, 10-5, and 10-4 M) and indomethacin (10-5 and 10-4 M) resulted in a decreased (P < 0.01 or P < 0.05) CI (at 24 and 36 h); and (2) Treatment with aspirin (10-4 M) and indomethacin (10-4 M) resulted in a decreased (P < 0.01) cell viability (at 36 h).

4. Discussion In the present study, there was clarification of the molecular mechanisms through which PGF2α-PTGFR signaling regulates proliferation of endometrial epithelial cells of cattle. Findings in the present study indicate that when there is PGF2α-PTGFR signaling there is an increase in cell proliferation and regulation of the abundance of cell cycle regulatory proteins. In normal cells, when there is activation of the cyclin-CDK-CKI cell cycle molecular network system, there is precise regulation of the cell cycle at the G1-S-G2-M phases (Hochegger et al., 2008; Lim and Kaldis, 2013a; Lee et al., 2015). Cyclin-dependent kinases have important functions in the 10

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 10. Effects of different concentrations of aspirin (A) and indomethacin (B) on the cell index (CI) and cell viability of endometrial epithelial cells of cattle; Cells were treated with aspirin (10−7-10-4 M) and indomethacin (10−7-10-4 M); Cell index was determined by real-time cell analysis and cell viability was determined by optical density at 450 nm in a WST-1 assay; Cell viability values are expressed as a percentage of the control (con); Cell index values are defined in Materials and methods; All values represent means ± SEM of three separate experiments; Differences between groups were examined using one-way ANOVA or two-way ANOVA, followed by a post-hoc test where applicable; P < 0.05 (*), P < 0.01 (**).

regulation of the cell cycle in the cyclin-CDK-CKI network. At different stages of the cell cycle, different cyclins combine with different CDKs to form cyclin/CDK complexes that in turn activate the function and promote the precise transformation of cells from one cell cycle phase to another. Cell cycle phase transitions are inhibited when there is binding of different CKIs with CDKs or cyclin/ CDK complexes (Soták et al., 2014; Fu et al., 2016). It is evident that cyclin D/CDK4/6 complexes were activated in the early to midG1 phase, and that cyclin E/CDK2 complexes were required for the G1/S transition. Furthermore, the cyclin A/CDK2 complex was essential for the progression of S-phase/DNA synthesis, and cyclin A–B/CDK1 was necessary for G2-M transition (Fig. 11) (Johnson and Walker, 1999; Malumbres and Barbacid, 2005; Sánchez and Dynlacht, 2005; Schwartz and Shah, 2005; Lee et al., 2010). In the present study, the abundances of cyclin D1, cyclin D3, CDK4, CDK6, cyclin E2, CDK2, cyclin A, cyclin B1, and CDK1 were increased as a result of treatment with PGF2α and fluprostenol. There, however, was a lesser abundance in cell cycle regulatory proteins when there was the combined treatment with the PTGFR antagonist, AL8810, PGF2α and fluprostenol in the present study (Figs. 4–6). As depicted in Fig. 11, there was an increase in cyclin D1, D3/CDK4, 6, cyclin E2/CDK2, cyclin A/CDK2, and cyclin B/CDK1 complexes that might be responsible for the regulated progression of cells through the G1-S and G2-M stages of the epithelial cell cycles of the endometrium in cattle. All the findings in the present study further indicate that PGF2α-PTGFR signaling most likely promotes cell proliferation by increasing the abundance of cell cycle regulatory proteins in endometrial epithelial cells of cattle. Furthermore, the CDK inhibitors, p15 and p21, are abundant in human immortalized endometriotic epithelial cells (Lee et al., 2010). In the present study, there was only detection of p15 and p21 mRNA transcripts, however, not protein. As reported, the increase in CDK inhibitors can lead to inhibition of CDK activity in numerous cancer cells when there are various conditions (Johnson and Walker, 1999; Malumbres and Barbacid, 2005; Sánchez and Dynlacht, 2005; Schwartz and Shah, 2005; Lee et al., 2010). Interestingly, data from the present study indicate treatment with PGF2α led to a decrease in abundance of p21. Based on the previously described results, PGF2α-PTGFR signaling can lead to proliferation of endometrial epithelial cells of cattle by regulating the cyclin-CDK-CKI cell cycle molecular network system. Epidermal growth factor is an important cytokine that promotes mitosis, and which can promote proliferation of a variety of cells (Schenk et al., 2003; Levea et al., 2004; Banerjee et al., 2011; Fatimah et al., 2012; Agaoglu et al., 2016; Chen et al., 2016; Garmanchuk et al., 2016). Several studies have been conducted to focus on the association between EGF and cell cycle regulatory proteins. Results from one study indicate EGF was a potent mitogen that promoted the proliferation of human amnion epithelial cells through cell cycle regulation (Fatimah et al., 2012). Results of another study indicated EGF could induce the proliferation of rabbit corneal epithelial cells as a result of the induced increase in cyclin D1 and CDK4 and decrease in p27 (Wang and Wang, 2008). There is also a regulatory effect of EGF on cell cycle progression in human cancer cells (Lui and Grandis, 2002). In addition, EGF is also required for the G1 and S phases of the cell cycle (Walker et al., 2007). In the present study, the transcription processes involved EGF mRNA transcript synthesis that was induced as a result of treatment with PGF2α and fluprostenol and was reduced after treatment with the PTGFR antagonist, AL8810, which indicated that the abundance of EGF can be regulated by PGF2α-PTGFR signaling. Accordingly, PGF2α and fluprostenol may regulate the abundance of EGF to regulate the cell cycle. To further understand the underlying mechanisms of PGF2α-PTGFR signaling in cell proliferation in the present study, there was 11

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

Fig. 11. Proposed regulation of the cell cycle by PGF2α-PTGFR signaling in endometrial epithelial cells of cattle; Prostaglandin F2α-PTGFR signaling increased the proliferation of endometrial epithelial cells of cattle through the increase in abundance of (A) G1-specific cyclin D and cyclindependent kinase (CDK) 4/6, (B) G1-S transition specific cyclin E2 and CDK2, (C) S-specific cyclin A and CDK2, (D) G2-specific cyclin A and CDK1, and (E) G2-specific cyclin B1 and CDK1; Prostaglandin F2α-PTGFR signaling also increased the proliferation of endometrial epithelial cells of cattle through the increased in abundance of epidermal growth factor (EGF) (F), PTGFR (H), COX-1, and COX-2 (I), which can indirectly affect the regulation of the cell cycle (G and. J).

assessment of the abundance of PCNA to examine cell proliferation in endometrial epithelial cells of cattle following PGF2α and fluprostenol treatment. Proliferating cell nuclear antigen is a “marker” of newly replicated DNA, which indicates the beginning of cell proliferation (Andraos et al., 2004; Yang et al., 2004; Georgescu et al., 2015). There has also been confirmation that fluprostenol can promote the synthesis of PCNA in endometrial explants (Zhang et al., 2017). The abundance of PCNA increased in the PGF2α and fluprostenol-treated endometrial epithelial cells compared to that in the control group and this indicates there was induction of the proliferation of these epithelial cells. Cyclooxygenase is considered to be an enzyme that initiates the conversion of AA to prostanoids (Adelizzi, 1999). There are two distinct, but similar isozymes: COX-1 and COX-2 (Smith et al., 2000). Results from relevant studies confirmed that COX-1 is an enzyme affecting cell structure, with the activity of this enzyme generally being induced in tissues and cells when there are typical biological conditions (Radi and Khan, 2006) and COX-2 is an induced enzyme, which is in large abundance in inflammatory and tumor cells (Kang et al., 2007). Results of numerous studies indicate COX-1 and COX-2 are involved in the pathological process of various cancers and tumorigenesis (Dubois et al., 1996; Hwang et al., 1998; Dimberg et al., 1999; Bauer et al., 2000; Kirschenbaum et al., 2000; Sung et al., 2000; Sales et al., 2002; Seno et al., 2002; Daikoku et al., 2006; Kim et al., 2013; Li et al., 2014). Although there has been a focus in many studies on the pathological aspects of COX, the fact that COX is widely distributed in tissues and cells when there are typical biological conditions cannot be discounted. Results of the present study indicate the abundance of COX-1 and COX-2 increased after treatment with PGF2α and fluprostenol. This indicates that the increased abundance of COX led to the increased synthesis of endogenous PGs (including PGF2α), which ultimately led to the stimulatory effects of PGF2α-PTGFR signaling (Fig. 11I). Results from another study indicated EGF could induce an increased abundance of COX-2 in papillomas as a result of the enhanced activity of the EGFR-phosphatidylinositol 3-kinase signaling (Wu et al., 2005). In the present study, the induction of EGF by PGF2αPTGFR signaling could have induced the increase in COX-2 abundance, which contributed to the conversion of AA to endogenous PGs (including PGF2α). This would have also led to the promoting effect on PGF2α-PTGFR signaling (Fig. 11K). Aspirin and indomethacin can inhibit the synthesis and release of PGs by acting on the COX enzyme (Vane and Botting, 1998). In the present study, cell proliferation was reduced in endometrial epithelial cells of cattle after treatment with aspirin and indomethacin. Based on the findings and conclusions from the present and previous studies, it is inferred that PGF2α and fluprostenol may regulate cell proliferation by affecting the abundance of COX. 12

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

In summary, it is proposed PGF2α-PTGFR signaling can lead to regulation of the proliferation through actions on the cyclin-CDKCKI network in endometrial epithelial cells of cattle. A related series of cyclins, CDKs, and CKIs were evaluated in the present study to evaluate the response to PGF2α-PTGFR signaling. Treatment with PGF2α and fluprostenol induced an increase in the abundance of cyclins (A, B1, D1, D3), CDKs (1, 2, 4, 6), and PCNA, and resulted in a reduced abundance of p15 and p21. Results of the present study also confirmed that the abundance of EGF mRNA was regulated by PGF2α-PTGFR signaling. In addition, PGF2α and fluprostenol treatments induced an increase in abundance of COX-1 and COX-2, while treatment with aspirin and indomethacin resulted in a reduced abundance of the COX enzymes, which inhibited proliferation of the endometrial epithelial cells of cattle. These findings provide strong evidence that PGF2α-PTGFR signaling can regulate proliferation through the regulation of the cyclin-CDK-CKI network, PCNA, EGF, COX-1, and COX-2 in endometrial epithelial cells of cattle. Funding Funding statement: This research was supported by the National Natural Science Foundation of China (No.31860722; 31672603) and Science Foundation for Distinguished and Outstanding Young Scholars of Inner Mongolia Agricultural University (2017XYQ-2). Declaration of Competing Interest None. Acknowledgement We would like to thank Editage [www.editage.cn] for English language editing. References Adelizzi, R.A., 1999. COX-1 and COX-2 in health and disease. J. Am. Osteopath. Assoc. 99, S7–12. Agaoglu, O.K., Agaoglu, A.R., Guzeloglu, A., Aslan, S., Kurar, E., Kayis, S.A., Schäfer-Somi, S., 2016. Gene expression profiles of some cytokines, growth factors, receptors and enzymes (GM-CSF, IFNγ, MMP2, IGF-II, EGF, TGF- β, IGF-IIR) during pregnancy in cat uterus. Theriogenology 85, 638–644. Andraos, N., Tabor, S., Richardson, C.C., 2004. The highly processive DNA polymerase of bacteriophage T5. Role of the unique N and C termini. J. Biol. Chem. 279, 50609–50618. Arosh, J.A., Banu, S.K., Kimmins, S., Chapdelaine, P., MacLaren, L.A., Fortier, M.A., 2004. Effect of interferon-pi on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: Evidence of polycrine actions of prostaglandin E2. Endocrinology 145, 5280–5293. Banerjee, S., Paik, R., Mino, R.E., Blauth, K., Fisher, E.S., Madden, V.J., Fanning, A.S., Bhat, M.A., 2011. A laminin G-EGF-Laminin g module in Neurexin IV is essential for the apico-lateral localization of contactin and organization of septate junctions. PLoS One 6, e25926. Basu, S., 2010. Novel cyclooxygenase‐catalyzed bioactive prostaglandin F2α from physiology to new principles in inflammation. Med. Res. Rev. 27, 435–468. Bauer, A.K., Dwyer-Nield, L.D., Malkinson, A.M., 2000. High cyclooxygenase 1 (COX-1) and cyclooxygenase 2 (COX-2) contents in mouse lung tumors. Carcinogenesis 21, 543–550. Chen, Y.J., Lee, Y.C., Huang, C.H., Chang, L.S., 2016. Gallic acid-capped gold nanoparticles inhibit EGF-induced MMP-9 expression through suppression of p300 stabilization and NFκB/c-Jun activation in breast cancer MDA-MB-231 cells. Toxicol. Appl. Pharm. 310, 98–107. Daikoku, T., Tranguch, S., Trofimova, I.N., Dinulescu, D.M., Jacks, T., Nikitin, A.Y., Connolly, D.C., Dey, S.K., 2006. Cyclooxygenase-1 is overexpressed in multiple genetically engineered mouse models of epithelial ovarian cancer. Cancer Res. 66, 2527. Dimberg, J., Samuelsson, A., Hugander, A., Söderkvist, P., 1999. Differential expression of cyclooxygenase 2 in human colorectal cancer. Gut 45, 730–732. Dong, Z., Zhang, N., Mao, W., Liu, B., Huang, N., Li, P., Li, C., Cao, J., 2015. Kinetic effect of oestrogen on secretion of prostaglandins E2 and F2? In bovine oviduct epithelial cells. Reprod. Fert. Develop. 29, 482–489. Dubois, R.N., Giardiello, F.M., Smalley, W.E., 1996. Nonsteroidal anti-inflammatory drugs, eicosanoids, and colorectal cancer prevention. Gastroenterol. Clin. North Am. 25, 773–791. Durr, S., Lyer, S., Mann, J., Janko, C., Tietze, R., Schreiber, E., Herrmann, M., Alexiou, C., 2012. Real-time cell analysis of human Cancer cell lines after chemotherapy with functionalized magnetic nanoparticles. Anticancer Res. 32, 1983–1989. Fatimah, S.S., Tan, G.C., Chua, K.H., Tan, A.E., Hayati, A.R., 2012. Effects of epidermal growth factor on the proliferation and cell cycle regulation of cultured human amnion epithelial cells. J. Biosci. Bioeng. 114, 220–227. Fu, X.J., Li, H.X., Kai, Y., Dan, C., Hong, T., 2016. The important tumor suppressor role ofPER1in regulating the cyclin–CDK–CKI network in SCC15 human oral squamous cell carcinoma cells. Oncotargets. Ther. 9, 2237–2245. Garmanchuk, L., Dzhus, O., Nikulina, V., Nikolaienko, T., Shelest, D., 2016. The Influence of Nimotuzumab in Combination With EGF on the Cell Cycle and Apoptotic Level of Tumor Cells. Georgescu, R., Langston, L., O’Donnell, M., 2015. A proposal: evolution of PCNA’s role as a marker of newly replicated DNA. DNA Repair 29, 4–15. Hochegger, H., Takeda, S., Hunt, T., 2008. Cyclin-dependent kinases and cell-cycle transitions: does one fit all? J. Cell Biol. 161, 111–118. Hwang, D., Byrne, J., Scollard, D., Levine, E., 1998. Expression of Cyclooxygenase-1 and Cyclooxygenase-2 in human breast Cancer. J. Natl. Cancer Inst. Monographs 90, 455–460. Johnson, D.G., Walker, C.L., 1999. Cyclins and cell cycle checkpoints. Annu. Rev. Pharmacol. 39, 295–312. Kang, Y.J., Mbonye, U.R., Delong, C.J., Wada, M., Smith, W.L., 2007. Regulation of intracellular cyclooxygenase levels by gene transcription and protein degradation. Prog. Lipid Res. 46, 108–125. Kim, H.S., Kim, T., Kim, M.K., Dong, H.S., Chung, H.H., Yong, S.S., 2013. Cyclooxygenase-1 and -2: molecular targets for cervical neoplasia. J. Cancer Prev. 18, 123–134. Kirschenbaum, A., Klausner, A.P., Lee, R., Unger, P., Yao, S., Liu, X.H., Levine, A.C., 2000. Expression of cyclooxygenase-1 and cyclooxygenase-2 in the human prostate. Urology 56, 671–676. Lee, B., Sandhu, S., Mcarthur, G., 2015. Cell cycle control as a promising target in melanoma. Curr. Opin. Oncol. 27, 141–150. Lee, J., Banu, S.K., Rodriguez, R., Starzinski-Powitz, A., Arosh, J.A., 2010. Selective blockade of prostaglandin E(2) receptors EP2 and EP4 signaling inhibits proliferation of human endometriotic epithelial cells and stromal cells through distinct cell cycle arrest. Fertil. Steril. 93, 2498–2506. Levea, C.M., Reeder, J.E., Mooney, R.A., 2004. EGF-dependent cell cycle progression is controlled by density-dependent regulation of Akt activation. Exp. Cell Res. 297, 272–284. Li, H., Zhu, F., Chen, H., Cheng, K.W., Zykova, T., Oi, N., Lubet, R.A., Bode, A.M., Wang, M., Dong, Z., 2014. 6-C-(E-phenylethenyl)-naringenin suppresses colorectal

13

Animal Reproduction Science 213 (2020) 106276

C. Fu, et al.

cancer growth by inhibiting cyclooxygenase-1. Cancer Res. 74, 243–252. Lim, H., Paria, B.C., Das, S.K., Dinchuk, J.E., Langenbach, R., Trzaskos, J.M., Dey, S.K., 1997. Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91, 197–208. Lim, S., Kaldis, P., 2013a. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development 140, 3079–3093. Lim, S.H., Kaldis, P., 2013b. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development 140, 3079–3093. Lui, V.W., Grandis, J.R., 2002. EGFR-mediated cell cycle regulation. Anticancer Res. 22, 1–11. Malkoc, M.A., Demir, N., Sengun, A., Bozkurt, S.B., Hakki, S.S., 2015. Cytotoxicity of temporary cements on bovine dental pulp-derived cells (bDPCs) using real-time cell analysis. J. Adv. Prosthodont. 7, 21–26. Malkoc, S., Ozturk, F., Corekci, B., Bozkurt, B.S., Hakki, S.S., 2012. Real-time cell analysis of the cytotoxicity of orthodontic mini-implants on human gingival fibroblasts and mouse osteoblasts. Am. J. Orthod. Dentofacial Orthop. 141, 419–426. Malumbres, M., Barbacid, M., 2005. Mammalian cyclin-dependent kinases. Trends Biochem. Sci. 30, 630–641. Milne, S.A., Jabbour, H.N., 2003. Prostaglandin (PG) F(2alpha) receptor expression and signaling in human endometrium: role of PGF(2alpha) in epithelial cell proliferation. J. Clin. Endocr. Metab. 88, 1825–1832. Odau, S., Gabler, C., Holder, C., Einspanier, R., 2006. Differential expression of cyclooxygenase 1 and cyclooxygenase 2 in the bovine oviduct. J. Endocrinol. 191, 263–274. Radi, Z.A., Khan, N.K., 2006. Effects of cyclooxygenase inhibition on the gastrointestinal tract. Exp. Toxicol. Pathol. 58, 163–173. Sales, K.J., Jabbour, H.N., 2003. Cyclooxygenase enzymes and prostaglandins in reproductive tract physiology and pathology. Prostaglandins Other Lipid Mediat. 71, 97–117. Sales, K.J., Katz, A.A., Howard, B., Soeters, R.P., Millar, R.P., Jabbour, H.N., 2002. Cyclooxygenase-1 is up-regulated in cervical carcinomas: Autocrine/paracrine regulation of cyclooxygenase-2, prostaglandin E receptors, and angiogenic factors by cyclooxygenase-1. Cancer Res. 62, 424–432. Sánchez, I., Dynlacht, B.D., 2005. New insights into cyclins, CDKs, and cell cycle control. Semin. Cell Dev. Biol. 16, 311–321. Schenk, S., Hintermann, E., Bilban, M., Koshikawa, N., Hojilla, C., Khokha, R., Quaranta, V., 2003. Binding to EGF receptor of a Laminin-5 EGF-like fragment liberated during MMP-Dependent mammary gland involution. J. Cell Biol. 161, 197–209. Schwartz, G.K., Shah, M.A., 2005. Targeting the cell cycle: a new approach to cancer therapy. J. Clin. Oncol. 23, 9408–9421. Seno, H., Oshima, M., Ishikawa, T.O., Oshima, H., Takaku, K., Chiba, T., Narumiya, S., Taketo, M.M., 2002. Cyclooxygenase 2- and prostaglandin E(2) receptor EP(2)dependent angiogenesis in Apc(Delta716) mouse intestinal polyps. Cancer Res. 62, 506–511. Shemesh, M., Hansel, W., 1975. Levels of prostaglandin F (PGF) in bovine endometrium uterine venous, ovarian arterial and jugular plasma during the estrous cycle (38789). Proc. Soc. Exp. Biol. Med. 148, 123–126. Shuh Narumiya, G.A.F., 2001. Genetic and pharmacological analysis of prostanoid receptor function. J. Clin. Invest. 108, 25–30. Smith, W.L., DeWitt, D.L., Garavito, R.M., 2000. Cyclooxygenases: structural, cellular, and molecular cellular, and molecular biology. Annu. Rev. Biochem. 69, 145–182. Soták, M., Sumová, A., Pácha, J., 2014. Cross-talk between the circadian clock and the cell cycle in cancer. Ann. Med. 46, 221–232. Sung, J.J.Y., Leung, W.K., Go, M.Y.Y., To, K.F., Cheng, A.S.L., 2000. Cyclooxygenase-2 expression in Helicobacter pylori-associated premalignant and malignant gastric lesions. Am. J. Pathol. 157, 729–735. Ulbrich, S.E., Schulke, K., Groebner, A.E., Reichenbach, H.D., Angioni, C., Geisslinger, G., Meyer, H.H.D., 2009. Quantitative characterization of prostaglandins in the uterus of early pregnant cattle. Reproduction 138, 371–382. Urcan, E., Haertel, U., Styllou, M., Hickel, R., Scherthan, H., Reichl, F.X., 2010. Real-time xCELLigence impedance analysis of the cytotoxicity of dental composite components on human gingival fibroblasts. Dent. Mater. 26, 51–58. Vane, J.R., Botting, R.M., 1998. Anti-inflammatory drugs and their mechanism of action. Inflamm. Res. 47, 78–87. Walker, F., Zhang, H.H., Burgess, A.W., 2007. Identification of a novel EGF-sensitive cell cycle checkpoint. Exp. Cell Res. 313, 511–526. Wang, Y., Wang, Y., 2008. The effect of EGF on the proliferation of rabbit corneal epithelial cells and the expression of the cell cycle-regulatory proteins invest. Ophth. Vis. Sci. 49 (2953). Wu, R., Abramson, A.L., Shikowitz, M.J., Dannenberg, A.J., Steinberg, B.M., 2005. Epidermal growth factor-induced cyclooxygenase-2 expression is mediated through phosphatidylinositol-3 kinase, not mitogen-activated protein/extracellular signal-regulated kinase kinase, in recurrent respiratory papillomas. Clin. Cancer Res. 11, 6155–6161. Yang, J., Zhuang, Z., Roccasecca, R.M., Trakselis, M.A., Benkovic, S.J., 2004. The dynamic processivity of the T4 DNA polymerase during replication. P. Natl. Acad. Sci. USA. 101, 8289–8294. Weems, Y.S., Bridges, P.J., Jeoung, M., Arreguin-Arevalo, J.A., Nett, T.M., Vann, R.C., Ford, S.P., Lewis, A.W., Neuendorff, D.A., Welsh Jr, T.H., Randel, R.D., Weems, C.W., 2012. In vivo intra-luteal implants of prostaglandin (PG) E1 or E2 (PGE1, PGE2) prevent luteolysis in cows. II: mRNA for PGF2α, EP1, EP2, EP3 (A-D), EP3A, EP3B, EP3C, EP3D, and EP4 prostanoid receptors in luteal tissue. Prostag. Oth. Lipid. M. 97, 60–65. Zhang, S., Liu, B., Gao, L., Mao, W., Fu, C., Zhang, N., Zhang, Y., Shen, Y., Cao, J., 2017. Prostaglandin F2α-PTGFR signalling activation, growth factor expression and cell proliferation in bovine endometrial explants. Reprod. Fert. Develop 29.

14