3 receptors results in AIF-induced death

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Prostaglandins compromise basal forebrain cholinergic neuron differentiation and survival: Action at EP1/3 receptors results in AIF-induced death G. Miller Jonakait⁎, Li Ni Federated Department of Biological Sciences, New Jersey Institute of Technology, Newark, NJ 07102, USA Rutgers University/Newark, Newark, NJ 07102, USA

A R T I C LE I N FO

AB S T R A C T

Article history:

Activated microglia produce a factor or cocktail of factors that promotes cholinergic

Accepted 12 June 2009

neuronal differentiation of undifferentiated precursors in the embryonic basal forebrain (BF)

Available online 22 June 2009

in vitro. To determine whether microglial prostaglandins mediate this action, microglia were stimulated in the presence of the cyclooxygenase inhibitor ibuprofen, and microglial

Keywords:

conditioned medium (CM) was used to culture rat BF precursors at embryonic day 15.

Apoptosis-inducing factor

Choline acetyltransferase (ChAT) activity served as a measure of cholinergic differentiation.

Autism

While inhibition of prostaglandin biosynthesis did not affect the ability of microglial CM to

Cholinergic

promote ChAT activity, treatment of microglia with prostaglandin E2 (PGE2) inhibited it.

Choline acetyltransferase

Agonists of E prostanoid receptors EP2 (butaprost) and EP1/3 (sulprostone) mimicked PGE2,

Prostaglandin

while misoprostol (E1–4) actually enhanced the action of CM. PGE2 added directly to BF

PGE2

cultures together with microglial CM also inhibited ChAT activity. While BF cultures expressed all four prostanoid receptors, direct addition of sulprostone but not butaprost mimicked PGE2, suggesting that PGE2 engaged EP1/3 receptors in the BF. Neither PKA inhibition by H89 nor cAMP induction by forskolin or dibutyrl-cAMP altered the action of sulprostone. Sulprostone severely compromised ChAT activity, dendrite number, axonal length and axonal branching, but caspase inhibition did not restore these. However, sulprostone resulted in increased staining intensity and nuclear translocation of apoptosisinducing factor (AIF) suggesting caspase-independent cell death. We have found that PGE2 action at microglial EP2 receptors inhibits the microglial production of the cholinergic differentiating cocktail, while action at neuronal EP3 receptors has a deleterious effect on cholinergic neurons causing neurite retraction and cell death. © 2009 Elsevier B.V. All rights reserved.

1.

Introduction

It is increasingly clear that maternal inflammation with attendant fetal brain inflammation may contribute to the

neurochemical, hormonal, cytoarchitectural and/or behavioral abnormalities that accompany autism, schizophrenia, cerebral palsy, blindness, and/or mental retardation (see Jonakait, 2007; Patterson, 2002). The local mediators of this inflammation are

⁎ Corresponding author. Department of Biological Sciences, 195 University Ave., Room 206, Newark, NJ 07102, USA. Fax: +1 973 353 5518. E-mail address: [email protected] (G.M. Jonakait). Abbreviations: AIF, apoptosis-inducing factor; BF, basal forebrain; ChAT, choline acetyltransferase; COX, cyclooxygenase; EP1–4, E prostanoid receptors 1–4; IL-1, interleukin-1; LPS, lipopolysaccharide; PGE2, prostaglandin E2; TNFα, tumor necrosis factor-alpha 0006-8993/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2009.06.037

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

not certain but may include inflammatory cytokines, reactive oxygen species, and/or prostaglandins (Hagberg and Mallard, 2005). While appropriately maintained prostaglandin levels are essential for normal fetal development and parturition (Thorburn, 1992), an elevation in those levels occurs during maternal trauma, disease, hypoxia or excessive alcohol consumption and can find their way to the fetal brain (Goldin et al., 1990; Kaeser et al., 1988; Randall et al., 1989; Yavin et al., 1989). Elevated levels of inflammatory cytokines interleukin-1 (IL-1), IL-6 and tumor necrosis factor-alpha (TNFα) also increase placental prostaglandins (Ishihara et al., 1992; Mitchell et al., 1991). Nevertheless, effects of excessive prostaglandin levels on the developing brain have been under-investigated. The cyclooxygenated product of arachidonic acid, prostaglandin E2 (PGE2), has been implicated in both destructive inflammatory as well as protective immunosuppressive events within the adult central nervous system. It is synthesized by the action of both cyclooxygenase 1 (COX1) and COX2. COX1 is ubiquitously and stably expressed in brain, while COX2 expression is induced following a variety of brain insults including ischemia (Collaco-Moraes et al., 1996; Miettinen et al., 1997; Nakayama et al., 1998; Nogawa et al., 1997), traumatic injury (Skold et al., 2000), Alzheimer's disease (Ho et al., 2001; Pasinetti and Aisen, 1998; Prasad et al., 1998), as well as other excitotoxic and viral attacks (Chen et al., 1995; Hirst et al., 1999; Molina-Holgado et al., 2002; Scali et al., 2000; Williams et al., 1997). Once elevated, COX2 is associated with exacerbation of excitotoxic and ischemic neuronal damage both in vivo and in vitro (Hewett et al., 2000; Kelley et al., 1999; Mirjany et al., 2002; Takadera et al., 2002). Thus COX2 inhibitors protect cortical, hippocampal and motor neurons from excitotoxic injury (Ahmad et al., 2006; Akaike et al., 1994; Carlson,2003; Cazevieille et al., 1994; Kim et al., 2001; Kim et al., 2002; Montine et al., 2002), ischemia (Iadecola et al., 2001; Nakayama et al., 1998; Nogawa et al., 1997) and amyotrophic lateral sclerosis (Drachman et al., 2002; Pompl et al., 2003), while COX2 knockouts are resistant to MPTP toxicity (Feng et al., 2002; Teismann et al., 2003), ischemia and NMDA-mediated death (Iadecola et al., 2001). The effector of COX2-mediated destruction is presumed to be PGE2, known to kill cortical (Takadera et al., 2002) and hippocampal (Takadera et al., 2004) neurons in culture. Paradoxically, PGE2 has also been shown to protect cultured cortical neurons from glutamate toxicity (Akaike et al., 1994; Cazevieille et al., 1994), NMDA (Ahmad et al., 2006; McCullough et al., 2004) and β-amyloid neurotoxicity (Echeverria et al., 2005), and to protect the brain after ischemic or excitotoxic

31

lesions in vivo (Ahmad et al., 2006; Liu et al., 2005; McCullough et al., 2004). The action of PGE2 at four different prostanoid receptors (EP1–4) may explain its variable actions: Ligation of EP2 and/or EP4 receptor appears to mediate neuroprotection both in vivo and in vitro (Ahmad et al., 2005; Ahmad et al., 2006; McCullough et al., 2004) while neuroprotection by PGE2 can be reversed with EP1 or EP3 agonists (Carlson, 2003). In previous studies investigating the development of cholinergic neurons in the basal forebrain (BF), we found that a factor or cocktail of factors from inflamed microglia promotes excessive cholinergic differentiation from undifferentiated neural precursors in this region (Jonakait et al., 1996; Jonakait et al., 1999; Ni et al., 2007). Activated microglia produce prostaglandins (Ajmone-Cat et al., 2003; Bauer et al., 1997; Caggiano and Kraig, 1999; Fiebich et al., 2003; Hoozemans et al., 2001; Levi et al., 1998), but they also possess PGE2 receptors (Caggiano and Kraig, 1999; Kitanaka et al., 1996; Slawik et al., 2004). PGE2 quells microglial inflammatory responses by downregulating microglial production of nitric oxide, IL-1, IL-12, and TNFα (Aloisi et al., 1997; Aloisi et al., 1999; Caggiano and Kraig, 1999; Kim et al., 2002; Levi et al., 1998; Minghetti et al., 1997; Minghetti et al., 2003; Rozenfeld et al., 2003) and/or by upregulating the anti-inflammatory cytokine IL-10 (Aloisi et al., 1999; Levi et al., 1998). We were interested in knowing how elevated levels of PGE2 might affect the microglial production of the cholinergic differentiation factor(s) and/or the development of nascent cholinergic neurons. We have found that PGE2 action at microglial EP2 receptors inhibits the microglial production of the cholinergic differentiating cocktail, while action at neuronal EP3 receptors has a deleterious effect on cholinergic neurons causing neurite retraction and cell death.

2.

Results

2.1. Microglial-derived prostaglandins do not affect cholinergic differentiation Our previous studies showed that microglia activated by lipopolysaccharide (LPS) produce a factor or cocktail of factors that promotes excess cholinergic differentiation from undifferentiated precursors in vitro (Jonakait et al., 1996; Jonakait et al., 1999; Ni et al., 2007). This cocktail results in 98% of neurons becoming cholinergic (Fig. 1). Therefore, the preparation provides an excellent model of cholinergic neurobiology.

Fig. 1 – Microglial conditioned medium promotes cholinergic differentiation. Five days after plating in medium from LPS-activated microglia, basal forebrain cultures contain an almost pure population of cholinergic neurons. Cell counts (see Experimental procedures) show that 98% of MAP2+ cells also express ChAT.

32

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

Because products of activated microglia include prostaglandins (Ajmone-Cat et al., 2003; Bauer et al., 1997; Fiebich et al., 2003; Levi et al., 1998), we sought to determine whether microglial-derived prostaglandins would affect the induction of the cholinergic phenotype. Enriched microglial cultures were treated with and without LPS (100 ng/ml) for 24 h in the presence or absence of the COX inhibitor ibuprofen (10 μM) (Vassiliou et al., 2004). This dose of LPS is used by many to activate microglia and used by us routinely to generate the microglial conditioned medium (CM) (Jonakait et al., 1996; Jonakait et al., 1999; Ni et al., 2007). CM from these LPStreated microglia (LPS-CM) was used as medium for BF cultures prepared at E15. Six days later, choline actyltransferase (ChAT) activity was measured as an indicator of cholinergic differentiation. Media obtained from microglia exposed to ibuprofen alone had no effect on ChAT activity; moreover, inhibition of prostaglandin synthesis by ibuprofen did not affect the ability of LPS to produce an effective cholinergic differentiating cocktail (Fig. 2A). These findings suggested that microglial-derived prostaglandins were not necessary for the development of the excess cholinergic phenotype in culture.

2.2. High levels of PGE2 inhibit the ability of microglia to affect cholinergic differentiation While microglia produce prostaglandins, prostaglandins in turn down-regulate many aspects of microglial activation. In order to determine whether exogenous levels of PGE2 could inhibit the induction of cholinergic-inducing factors from LPS-treated microglia, enriched microglial cultures were treated with LPS in the presence of increasing concentrations of PGE2. LPS-CM remained capable of inducing cholinergic differentiation until added PGE2 concentrations in the microglial cultures reached 1 μM (Fig. 2B). These data suggest that PGE2 is able to inhibit the production of the cholinergic differentiating cocktail, but only if concentrations are sufficiently elevated.

2.3.

PGE2 acts at EP1, 2 and 3, but not EP4 receptors

PGE2 makes use of 4 receptors, E prostanoid1 (EP1) through EP4. In order to determine which of these receptors was involved in mediating the action of PGE2 on LPS-treated microglia, agonists to the various receptors were added to enriched microglia together with LPS. These included sulprostone (EP1- and EP3-specific agonist); butaprost (EP2-specific agonist); and misoprostol (EP1–4). Butaprost added to microglial cultures reversed the ability of the LPS-CM to raise cholinergic activity while sulprostone had a more modest inhibitory effect (Fig. 3A). Concentrations of agonists were chosen for being maximally effective doses in a variety of culture settings (Hillock and Crankshaw, 1999; Meisdalen et al., 2007; Norel et al., 1999; Wang et al., in press). At low concentrations (100 nM) misoprostol actually enhanced the ability of LPS-CM to elicit ChAT activity, but had no apparent effect at higher concentrations. Moreover, the addition of misoprostol to microglia even in the absence of LPS was enough to generate medium capable of eliciting elevated ChAT activity (Fig. 3B). These data suggest that action at EP1/3

Fig. 2 – Exogenous but not endogenous prostaglandins inhibit the production of the microglial-derived cholinergic differentiation cocktail. (A) Enriched microglia were treated for 24 h with LPS (100 ng/ml), ibuprofen (Ibu;10 μM), or the two together. Conditioned medium (CM) from treated microglia was used for culturing E15 basal forebrain. ChAT activity was assessed after 6 days in vitro (see Experimental procedures). Cultures with no microglial CM were used as controls (CT). Data are presented as the mean ± SEM of three independent cultures. This experiment was repeated three times with similar results. (B) Microglial CM was prepared in the presence of LPS (100 ng/ml) with increasing concentrations of PGE2 as indicated. Medium was used to culture E15 basal forebrain for 6 days. Data were compared using an ANOVA with a post-hoc Student–Newman–Keuls test for significance at the 95% confidence level. The columns marked with an asterisk differ from LPS-CM without added PGE2. This experiment was repeated three times with similar results.

(sulprostone) and EP2 (butaprost) but not EP4 (misoprostol) receptors is able to compromise the generation of and/or response to LPS-CM.

2.4.

PGE2 acts directly on the basal forebrain cultures

Because exogenously added prostaglandins were not removed from the microglial CM prior to its addition to BF cultures, the possibility existed that the prostaglandin agonists acted not solely on microglia, but directly on the BF cultures themselves. Indeed, when PGE2 was added directly to BF cultures together with LPS-CM, ChAT activity was compromised suggesting that

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

33

added together with LPS-CM. The EP2 agonist butaprost, which had had such a profoundly negative effect on the generation of microglial CM, had no effect when added directly to the BF cultures at the same concentration (Fig. 5B). This suggested that ligation of microglial EP2 receptors was able to downregulate production of the cholinergic differentiating factor(s) from microglia, but ligation of EP2 receptors within the BF did not have a direct effect there. Misoprostol again had a slight but significant augmenting effect on ChAT activity suggesting that it may have a slight salutary action on cells within the embryonic BF itself. By contrast, sulprostone, when added directly to the BF cultures, exerted a dose-dependent inhibitory effect (Fig. 5C). This suggested that action at an EP1/3 receptor within the BF itself compromised the full expression of the cholinergic phenotype.

2.6.

Fig. 3 – (A) EP1, 2, and 4 activation inhibits LPS induction of the cholinergic-inducing cocktail. Enriched microglia were treated with LPS in the presence or absence of sulprostone (Sulpro; 1 μM) or butaprost (Buta; 10 μM). Microglia treated with the PGE agonists in the absence of LPS served as controls. (B) Misoprostol alone stimulates microglia to produce the cholinergic differentiation cocktail. Misoprostol at various concentrations was added to enriched microglial cultures in the presence or absence of LPS (100 ng/ml). Media from the cultures was used on E15 basal forebrain cultures as before. Data were compared using an ANOVA with a post-hoc Student–Newman–Keuls test for significance at the 95% confidence level. *denotes a difference from LPS alone; **denotes a difference between all other treatments. In (B) all treatments were significantly different from CT.

The action of sulprostone is not mediated by cAMP

Action at EP2 and EP4 receptors is cAMP mediated, while action at EP3 routinely down-regulates cAMP, but in rare instances increases its activity. In order to determine whether PGE2-mediated loss of cholinergic activity was dependent on cAMP, PGE2 or sulprostone was added to LPS-CM-treated BF cultures in the presence and absence of the PKA inhibitor H89 (Fig. 6A). Addition of H89 did not affect basal levels of ChAT activity, nor did it reverse the inhibitory actions of either PGE2 or sulprostone suggesting that their actions were not mediated by an increase in cAMP. This tended to further exclude EP2 and EP4 receptors as being involved with the PGE-induced loss of ChAT activity in the BF itself. In order to determine whether a reduction in cAMP was responsible for the adverse effect on BF cultures, sulprostone was added to LPS-CM-treated cultures in the presence and absence of dibutyrl-cAMP or forskolin. Neither dibutyrlcAMP (Fig. 6B) nor forskolin (Fig. 6C) was able to restore the loss of ChAT activity that occurred in the presence of sulprostone.

action at prostaglandin receptors within the BF could be deleterious to the cultures (Fig. 4).

2.5. EP2 receptors mediate the inhibitory effect of PGE2 on microglia while EP1/3 receptors mediate inhibition within the basal forebrain cultures In order to test the specificity of the receptors involved, we first assessed the presence of EP receptors in BF cultures by RT-PCR (Fig. 5A). This analysis confirmed that all four receptors were expressed by cells within the BF cultures. Moreover, increases in EP3 and EP4 receptor expression correlated with the increase in cholinergic neuronal differentiation (Jonakait et al., 1996). In order to determine which EP receptor was involved in inhibiting the action of LPS-CM, EP receptor agonists were

Fig. 4 – PGE2 inhibits ChAT activity when added directly to BF cultures. PGE2 was added to E15 BF cultures together with LPS-CM at plating. Six days later ChAT activity was assessed. An asterisk indicates columns that are different from LPS alone as determined by ANOVA with a post-hoc Student–Newman–Keuls test for significance at the 95% confidence level. N.D. = Not detectable.

34

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

BF cultures treated with LPS-CM in the presence and absence of sulprostone. Analysis of survival after 5 days in culture was assessed using Alamar Blue™ staining in the presence and absence of pan-caspase inhibitors. Total cell survival was unaffected by the inclusion of sulprostone (Fig. 7A) and caspase inhibition did not change the total cell survival in the cultures (Fig. 7B). However, selective death of cholinergic neurons with a concomitant overgrowth of astrocytes in the culture could account for such a finding. Therefore, in order to determine whether cholinergic neurons

Fig. 5 – Effects of prostaglandin agonists on basal forebrain cholinergic neurons. (A) EP3 and EP4 receptor expression assessed by RT-PCR increase in the basal forebrain over time in culture. (B,C) PGE2 and sulprostone inhibit while misoprostol enhances the ability of LPS-CM to promote the cholinergic phenotype. Cultures were treated with LPS-CM+ added prostaglandins as indicated. Concentrations in (B) are the same as those in Fig. 2. Concentrations of sulprostone and PGE2 in (C) are as indicated. Data were compared to cultures treated with LPS-CM (Control) and were compared using an ANOVA with a post-hoc Student–Newman–Keuls test for significance at the 95% confidence level. *denotes a difference from LPS-CM alone. N.D. = not detectable.

2.7. EP1/3 does not cause caspase-dependent cell death in mixed cultures In order to determine whether the loss of ChAT activity was due to caspase-dependent cell death, we assessed survival in

Fig. 6 – The effect of sulprostone is not mediated by cAMP. (A) PKA inhibition does not reverse the inhibitory effect of PGE2 or sulprostone on ChAT activity. H89 (10 μM) was included at plating of E15 basal forebrain together with PGE2 (1 μM) or sulprostone (1 μM). ChAT activity was assessed after 6 days in culture. This experiment was performed three times with equivalent results. Asterisks represent treatments that differ from LPS-CM alone. Neither dibutyrl-cAMP (B; 200 μM) nor forskolin (C; 30 μM) added with sulprostone at plating reverses the inhibitory action of sulprostone.

35

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

2.8.

EP1/3 causes neurite retraction

Action at the EP3 receptor has been shown to result in a rhokinase-dependent neurite retraction (Aoki et al., 1999; Katoh et al., 1996). In order to determine whether sulprostone acted similarly on cholinergic neurons, cells were grown with LPSCM in the presence and absence of sulprostone and neurons were assessed morphologically for cell body size, number of dendrites, axonal length and the number of axonal branch points. Sulprostone did not affect neuron cell body size, but had a profound effect on the neuritic arbor, severely truncating the number of dendrites, axonal length and the number of axonal branch points (Table 1).

2.9.

EP1/3 causes the nuclear translocation of AIF

One caspase-independent pathway for cell death is mediated by apoptosis-inducing factor (AIF). Released from mitochondria, AIF translocates to the nucleus in injury-induced neuronal cell death (Cregan et al., 2002). Untreated cultures after five days showed healthy ChAT-positive cells with faint AIF in the axon hillock region of the cell (Fig. 8A). However, treatment of cultures with sulprostone for as little as 6 h resulted in the profound increase in the intensity of AIF both cytoplasmic staining and an increased incidence of nuclear AIF (Figs. 8B and C). The loss of ChAT activity, the truncation of neurites and dendrites, the disappearance of neurons and the early increase in nuclear translocation of AIF suggests that the EP3 activation results in cholinergic cell death.

3.

Fig. 7 – Total cell survival as assessed by Alamar Blue™ is not compromised by addition of sulprostone (A), nor increased by the inclusion of caspase inhibitors (all inhibitors were added at 2 mM) (B). Cells were cultured in LPS-CM with and without sulprostone. Cell survival was assessed at the end of 6 days (see Experimental procedures). (C) Caspase inhibition does not reverse the effects of sulprostone on cholinergic expression. Data were compared by an ANOVA with a post-hoc Student–Newman–Keuls test for significance at the 95% confidence level. An asterisk denotes differences from LPS-CM alone. No differences were noted between other groups.

were specifically targeted by sulprostone, ChAT activity was assessed in both the presence and absence of caspase inhibition (Fig. 7C). However, the sulprostone-induced decline in ChAT activity was not reversed by caspase inhibition. This suggested that caspase-dependent cell death was not the reason for a lowering of ChAT activity.

Discussion

While a great deal is known about the role of prostaglandins during inflammatory events in the adult brain, less is known about its effects on developing neurons. In the few venues in which it has been studied, mice overexpressing COX2 have been shown to express abnormal behavior (Andreasson et al., 2001) and are more susceptible to cerebral infarction in adulthood (Dore et al., 2003). The absence of literature on this issue is unfortunate since maternal inflammation with an attendant rise in prostaglandins may have important ramifications for brain development (see review by Jonakait, 2007). Recent studies have suggested that treatment of pregnant dams with interleukin-6 (IL-6) results in behavioral anomalies

Table 1 – Cholinergic neurons are compromised by addition of sulprostone. Measurement Cell body (μM) No. dendrites No. axonal branch pts. Axon length (μM)

CT (n = 54)

+ Sulprostone (n = 53)

7.81 ± 0.19 1.74 ± 0.96 1.09 ± 0.14 46.00 ± 3.92

7.55 ± 0.17 1.05 ± 0.87 0.53 ± 0.09 22.90 ± 2.56

p = 0.327 p < 0.0009 p < 0.0009 p < 0.0009

BF cultures were treated with LPS-CM together with sulprostone at plating. Cells were stained for ChAT and MAP2. Measurements were taken on a Zeiss Axiovert™ 200 M using AxioVision™ software.

36

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

Fig. 8 – AIF undergoes nuclear translocation after sulprostone treatment. E15 basal forebrain cultures were grown in LPS-CM for 5 days, followed by the addition of PBS (A) or sulprostone (1 μM; B) for 6 h. Cultures were fixed and stained with goat anti-ChAT (1), rabbit anti-AIF (2) and bisbenzimide (3) for nuclear staining. The merged picture is in (4). (B) AIF staining becomes brighter and moves into nuclei. Arrows point to dead or dying cells with residual AIF staining. (C) PBS- (1) and sulprostone- (2) treated cultures after 6 h showing distinct nuclear AIF staining.

in offspring (Smith et al., 2007). IL-6 elevates placental prostaglandins (Mitchell et al., 1991), giving further urgency to an understanding of elevated prostaglandins on brain development.

We have sought to examine effects of prostaglandins on the development of cholinergic neurons in the BF. In previous work, we found that inflamed microglia produce a factor or cocktail of factors that promotes excessive cholinergic differentiation from undifferentiated precursors in this brain region. Cultured embryonic basal forebrain cells differentiate into an almost pure population of cholinergic neurons with this cocktail. Because the identity of the microglia factor or factors remains unknown, however, one of the questions of this study was to determine whether LPS-induced PGE2 was responsible for producing the excess of cholinergic neurons. The inhibition of PGE2 synthesis in LPS-treated microglia failed to alter the efficacy of the LPS-induced microglial cocktail suggesting that prostaglandins were not essential for the excess production of cholinergic neurons in our system. On the other hand, PGE2 levels produced by activated microglia did not adversely affect cholinergic differention either. If they had, the addition of the COX inhibitor ibuprofen should have resulted in an increase in ChAT activity. This did not occur. In light of the subsequent finding that exogenous PGE2 did affect the cultures, it seems likely that bath concentrations of PGE2 from stimulated microglia did not reach levels high enough to have an effect. The addition of elevated levels (1–10 μM) of PGE2 to the microglial cultures was required before inhibitory effects on the production of conditioned medium were evident. Because only submicromolar levels are necessary for the inhibition of pro-inflammatory cytokines and NO (Aloisi et al., 1997; Aloisi et al., 1999; Caggiano and Kraig, 1999; Kim et al., 2002; Levi et al., 1998; Minghetti et al., 1997; Minghetti et al., 2003; Rozenfeld et al., 2003), this suggested that molecules other than these are mediators of the cocktail. Butaprost and sulprostone inhibited the ability of microglia to produce the cholinergic-inducing cocktail suggesting that action at EP2 (and possibly EP1/3) receptors inhibited the ability of microglia to promote excess differentiation of cholinergic neurons. An inhibitory action of PGE2 at EP2 receptors on cultured microglia has been previously reported (Caggiano and Kraig, 1999). Misoprostol had the effect of actually increasing the efficacy of microglial CM. This may explain why high concentrations of PGE2 were needed to inhibit the production of the cocktail: The “positive” action at EP4 receptors (misoprostol) had to be offset by robust activation at the inhibitory receptors (EP2 and possibly EP1/3). Effects of misoprostol on microglia or on developing neurons have gone unexamined. Our data raise several mechanistic possibilities: 1) misoprostol acts directly on microglia to produce a cocktail that is similar to the one elicited by LPS — at least insofar as cholinergic differentiation is concerned; 2) misoprostol acts directly on microglia to produce a cocktail that is additive with the one elicited by LPS— at least insofar as cholinergic differentiation is concerned; or 3) misoprostol acts directly on basal forebrain cultures to promote precursor proliferation, neuronal survival, and/or cholinergic differentiation. While misoprostol acts at all EP receptors, it has a higher affinity for EP3 and EP4 receptors than for EP1 and EP2 (Abramovitz et al., 2000). Thus, the salutary effect of misoprostol is likely to be mediated by EP4 receptors since butaprost (EP2) inhibits the production of microglial CM and, as subsequent experiments show, the EP1/

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

3 agonist sulprostone adversely affects the cultures. Action at EP4 receptors is consistent with the data of others who have indicated a neuroprotective role for EP4 agonists in vitro (Ahmad et al., 2005). As the above analysis confirms, we recognized that the actions of EP agonists designed to affect LPS-induced microglial CM could have been due either to direct inhibition of LPStreated microglia and/or direct effects of residual agonists on the BF cultures. In order to examine the direct action of EP agonists on BF cultures, these were added together with conditioned medium. PGE2 itself as well as the EP1/3 agonist sulprostone, but not the EP2 agonist butaprost, inhibited ChAT expression. Misoprostol had a slightly enhancing effect on cholinergic expression. Thus, while EP2 agonists acted directly on microglia, EP1/3 agonists inhibited and EP4 agonists enhanced cholinergic expression within the BF itself. Sulprostone did not result in a total loss of cells in the culture, but specifically compromised cholinergic neuron expression. Total cell survival in sulprostone-treated cultures did not change either because undifferentiated precursors were encouraged to go down a glial differentiation pathway as opposed to a neuronal one or – what was more likely – differentiated glia were stimulated to proliferate. An EP1/3dependent stimulation of proliferation has been reported for both fibroblasts and hepatocytes (Meisdalen et al., 2007; White et al., 2008). Thus, while total cell survival was unaffected by sulprostone, it caused neurite retraction and disappearance of cholinergic neurons in the cultures. The inability of caspase inhibitors to prevent this disappearance prompted us to exam caspase-independent cell death (recently termed parthanatos; Wang et al., in press) induced by AIF. Indeed, AIF staining intensity increased and nuclear translocation occurred within hours following exposure of cholinergic neurons to sulprostone. Our data are the first report of AIF involvement in EP1/3induced cholinergic cell death. How sulprostone induces AIF activation is unclear. While EP3 receptors are normally considered to be linked to Gi and the inhibition cAMP, EP1 receptors are linked to Gq receptors with subsequent activation of PKC. Action of sulprostone appeared to be cAMP-independent; neither inhibition of PKA by H89 nor upregulation of cAMP by forskolin or by the addition of dibutyrl-cAMP affected its action. This may indicate that a cAMP-independent action mediated via EP1 receptors was acting here. Others have shown cAMP-independent actions of prostaglandins (Refsnes et al., 1995), though this is rare. Ligation of EP3 receptors upregulates neuronal nitric oxide synthase (nNOS) in the perinatal brain (Dumont et al., 1998) possibly by increasing the influx of calcium or impairing Na+/Ca2+ exchange (Kawano et al., 2006; Saleem et al., 2007; Zhang et al., 2007). Should such an upregulation occur in cultured neurons, this would lead to NO- or Ca2+-induced cell death. Reports that mitochondrial release and nuclear translocation of AIF accompanies neuronal death following traumatic brain injury or oxidative stress (Cao et al., 2003; Cregan et al., 2002; Fonfria et al., 2002; Plesnila et al., 2004; Slagsvold et al., 2003; Slemmer et al., 2008; Zhu et al., 2003; Zhu et al., 2007) makes this a likely mechanism. Further experiments will be necessary to determine mechanisms involved here.

37

Elevated levels of PGE2 can occur in fetal brain if microglia become activated as a result of maternal inflammation. Whether these are detrimental or not could depend completely on when such an elevation occurs. Action at EP4 receptors – as seen with misoprostol – could have an enhancing effect on early cholinergic differentiation either through action of microglia, or more likely through an action on cholinergic precursors. However, once cholinergic neurons have differentiated, they become susceptible to EP1/3induced death.

4.

Experimental procedures

4.1.

Materials

Lipopolysaccharide (LPS; from E. coli 026:B6) is from SigmaAldrich. Goat polyclonal antibody against ChAT is from Chemicon. Rabbit polyclonal antibody against AIF is from Cell Signaling. Prostaglandin E2, sulprostone, butaprost and misoprostol are from Cayman Biologicals. Bisbenzimide is from Calbiochem. 4.2.

Microglial cultures

Enriched microglial cultures were prepared from neonatal Sprague–Dawley rat cortices as described by us previously (Jonakait et al., 1996; Jonakait et al., 1999). Final treatment of the microglia occurs in serum-free Opti-MEM™ with an N2 supplement (N2 medium; Invitrogen). Conditioned medium (CM) is collected after 24 h and filtered through 22 μm filters prior to use on BF cultures. 4.3.

Basal forebrain cultures

The septal region with tissue immediately ventral to it is dissected from rat embryos at embryonic day 15 (E15). Dissociated cells are plated onto poly-lysine coated 35 mm tissue culture dishes at a density of 1.2–1.6 × 105 cells per cm2. Cultures are grown in low serum-containing N2 medium with penicillin (25 U/ml) and streptomycin (25 μg/ ml). Microglial CM is added at plating and remains in the cultures for the full 5–6 days unless otherwise indicated. N2 medium alone and CM from unstimulated microglia were included as controls. 4.4.

Choline acetyltransferase (ChAT) assay

ChAT activity was assayed using the method of Fonnum (1975) as modified by Martinez et al. (1987) and used by us previously (Jonakait et al., 1996; Jonakait et al., 1999; Ni et al., 2007). In this assay, cultured cells are homogenized in 10 mM EDTA containing 0.5% Triton X-100. 2 μl of the supernatant is transferred to a fresh microtube to which 5 μl of incubation medium is added. The incubation medium contains EDTA (17 mM), sodium phosphate (50 mM), sodium chloride (0.3 M), choline bromide (8 mM), eserine (0.06 mM), and acetyl CoA+ 14C acetyl CoA (0.2 mM). After a 60-min incubation at 37 °C 14Cacetylcholine is extracted into a solution containing 5 mg/

38

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

ml tetraphenylboron in acetonitrile and counted in Ecoscint O® (National Diagnostics, Atlanta, GA) scintillation fluid. Protein determination was assessed using the Bio-Rad protein asssay. 4.5. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted using Ultraspec™ RNA Isolation Reagent (Biotecx Laboratories, Inc., Houston, TX). cDNA is produced from one μg of RNA by using random hexamers and MMLV reverse transcriptase (Promega, Madison, WI) according to the manufacturer's instruction. For real-time PCR, cDNA was amplified using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) according to manufacturer's instructions. After amplification, one additional cycle was used for a dissociation curve to verify that the signal was generated from a single target amplicon and not from primer dimers or contaminating DNA. Serially diluted cDNA of each sample was amplified to measure the efficiencies of PCR and to draw the standard curve for each sample to calculate relative concentration of target message. The PCR products and their dissociation curves were detected using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). GAPDH mRNA was used as an internal control. Rat-specific primers for the EP receptors were EP1: (F) TTAGTGCCAAGGGTGGTCCA (1118–1137), (R)CCCAGGCACTCTTGGTTAGG(1168–1149); EP2: (F) TCCAGGAGCTTCCTGTTCG (1064–1083), (R) ACAACTGTCCGCAGAGGTCC (1114–1095); EP3: (F)GCAAGACGCAGATGGGAAAG (960–979), (R) CGGCGATTAGG AAGGAATTG (1010–991); EP4: (F) CGCACCCCACCCTACAGATA (108–127), (R) CTTTGGAGCTCACGGTTCG(158–140). 4.6.

Cell survival

Cell survival was assessed using Alamar Blue™, a nontoxic dye that fluoresces during the innate metabolic activity of cells. When cells die, this innate metabolic activity ceases. Thus, the intensity of the fluorescence is proportional to the living cells in the culture. BF cultures were plated in 96 well plates in LPS-CM with and without additives. After 1 or 5 days, 20 μl of Alamar Blue™ was added into each well. The next day the plate was read on a Fusion Universal Microplate Analyzer (Packard BioScience Co.) with excitation at 550 and emission at 610 nm. 4.7.

Immunohistochemistry

For immunohistochemical detection of MAP2 and ChAT cells were grown in LabTek™ slide chambers. At the end of the culture period, cells were fixed in 4% paraformaldehyde for 20 min, dehydrated and rehydrated through a graduated series of alcohols, blocked in 5% serum and exposed to mouse or rabbit anti-MAP2 (1:1000; Sigma) or goat anti-ChAT (1:750; Chemicon) in PBS containing 0.1% Triton X-100 and 1% serum overnight in the cold. Cells were washed and exposed to AlexaFluor® 594-labeled anti-mouse or rabbit and/or AlexaFluor® 488-labeled anti-

goat antibodies (1:750) for 1 h at room temperature. Morphological measurements were made using the 20× objective on a Zeiss Axiovert™ 200 M using AxioVision software. For immunohistochemical detection of AIF and ChAT, cells were treated as above and labeled overnight with goat anti-ChAT and rabbit anti-AIF (1:100, Cell Signaling) followed by secondary antibodies as described above. Nuclei were stained with bisbenzamide (10 μg/ml) for 30 min at room temperature. Cholinergic cell counts were made in cultures stained for both MAP2 and ChAT. Ten individual fields were counted for a total of 387 MAP2+ cells, of which 381 were also ChAT+.

Acknowledgments We thank Maxine Rusbasan for technical work on this project. This work was supported by grants to GMJ from the National Science Foundation, the NJ Commission on Autism and Cure Autism Now.

REFERENCES

Abramovitz, M., Adam, M., Boie, Y., Carriere, M., Denis, D., Godbout, C., Lamontagne, S., Rochette, C., Sawyer, N., Tremblay, N.M., Belley, M., Gallant, M., Dufresne, C., Gareau, Y., Ruel, R., Juteau, H., Labelle, M., Ouimet, N., Metters, K.M., 2000. The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim. Biophys. Acta 1483, 285–293. Ahmad, A.S., Ahmad, M., Brum-Fernandes, A.J., Dore, S., 2005. Prostaglandin EP4 receptor agonist protects against acute neurotoxicity. Brain Res. 1066, 71–77. Ahmad, A.S., Zhuang, H., Echeverria, V., Dore, S., 2006. Stimulation of prostaglandin EP2 receptors prevents NMDA-induced excitotoxicity. J. Neurotrauma 23, 1895–1903. Ajmone-Cat, M.A., Nicolini, A., Minghetti, L., 2003. Prolonged exposure of microglia to lipopolysaccharide modified the intracellular signaling pathways and selectively promotes prostaglandin E2 synthesis. J. Neurochem. 87, 1193–1203. Akaike, A., Kaneko, S., Tamura, Y., Nakata, N., Shiomi, H., Ushikubi, F., Narumiya, S., 1994. Prostaglandin E2 protects cultured cortical neurons against N-methyl-D-aspartate receptor-mediated glutamate cytotoxicity. Brain Res. 663, 237–243. Aloisi, F., Penna, G., Cerase, J., Iglesias, B.M., Adorini, L., 1997. IL-12 production by central nervous system microglia is inhibited by astrocytes. J. Immunol. 159, 1604–1612. Aloisi, F., De Simone, R., Columba-Cabezas, S., Levi, G., 1999. Opposite effects of interferon-gamma and prostaglandin E2 on tumor necrosis factor and interleukin-10 production in microglia: a regulatory loop controlling microglia pro- and anti-inflammatory activities. J. Neurosci. Res. 56, 571–580. Andreasson, K.I., Savonenko, A., Vidensky, S., Goellner, J.J., Zhang, Y., Shaffer, A., Kaufmann, W.E., Worley, P.F., Isakson, P., Markowska, A.L., 2001. Age-dependent cognitive deficits and neuronal apoptosis in cyclooxygenase-2 transgenic mice. J. Neurosci. 21, 8198–8209. Aoki, J., Katoh, H., Yasui, H., Yamaguchi, Y., Nakamura, K., Hasegawa, H., Ichikawa, A., Negishi, M., 1999. Signal transduction pathway regulating prostaglandin EP3

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

receptor-induced neurite retraction: requirement for two different tyrosine kinases. Biochem. J. 340 (Pt 2), 365–369. Bauer, M.K., Lieb, K., Schulze-Osthoff, K., Berger, M., Gebicke-Haerter, P.J., Bauer, J., Fiebich, B.L., 1997. Expression and regulation of cyclooxygenase-2 in rat microglia. Eur. J. Biochem. 243, 726–731. Caggiano, A.O., Kraig, R.P., 1999. Prostaglandin E receptor subtypes in cultured rat microglia and their role in reducing lipopolysaccharide-induced interleukin-1beta production. J. Neurochem. 72, 565–575. Cao, G., Clark, R.S., Pei, W., Yin, W., Zhang, F., Sun, F.Y., Graham, S.H., Chen, J., 2003. Translocation of apoptosis-inducing factor in vulnerable neurons after transient cerebral ischemia and in neuronal cultures after oxygen-glucose deprivation. J Cereb. Blood Flow Metab. 23, 1137–1150. Carlson, N.G., 2003. Neuroprotection of cultured cortical neurons mediated by the cyclooxygenase-2 inhibitor APHS can be reversed by a prostanoid. J. Neurosci. Res. 71, 79–88. Cazevieille, C., Muller, A., Meynier, F., Dutrait, N., Bonne, C., 1994. Protection by prostaglandins from glutamate toxicity in cortical neurons. Neurochem. Int. 24, 395–398. Chen, J., Marsh, T., Zhang, J.S., Graham, S.H., 1995. Expression of cyclo-oxygenase 2 in rat brain following kainate treatment. NeuroReport 6, 245–248. Collaco-Moraes, Y., Aspey, B., Harrison, M., de Belleroche, J., 1996. Cyclo-oxygenase-2 messenger RNA induction in focal cerebral ischemia. J. Cereb. Blood Flow Metab. 16, 1366–1372. Cregan, S.P., Fortin, A., MacLaurin, J.G., Callaghan, S.M., Cecconi, F., Yu, S.W., Dawson, T.M., Dawson, V.L., Park, D.S., Kroemer, G., Slack, R.S., 2002. Apoptosis-inducing factor is involved in the regulation of caspase-independent neuronal cell death. J. Cell Biol. 158, 507–517. Dore, S., Otsuka, T., Mito, T., Sugo, N., Hand, T., Wu, L., Hurn, P.D., Traystman, R.J., Andreasson, K., 2003. Neuronal overexpression of cyclooxygenase-2 increases cerebral infarction. Ann. Neurol. 54, 155–162. Drachman, D.B., Frank, K., Dykes-Hoberg, M., Teismann, P., Almer, G., Przedborski, S., Rothstein, J.D., 2002. Cyclooxygenase 2 inhibition protects motor neurons and prolongs survival in a transgenic mouse model of ALS. Ann. Neurol. 52, 771–778. Dumont, I., Peri, K.G., Hardy, P., Hou, X., Martinez-Bermudez, A.K., Molotchnikoff, S., Varma, D.R., Chemtob, S., 1998. PGE2, via EP3 receptors, regulates brain nitric oxide synthase in the perinatal period. Am. J. Physiol. 275, R1812–R1821. Echeverria, V., Clerman, A., Dore, S., 2005. Stimulation of PGE receptors EP2 and EP4 protects cultured neurons against oxidative stress and cell death following beta-amyloid exposure. Eur. J. Neurosci. 22, 2199–2206. Feng, Z.H., Wang, T.G., Li, D.D., Fung, P., Wilson, B.C., Liu, B., Ali, S.F., Langenbach, R., Hong, J.S., 2002. Cyclooxygenase-2deficient mice are resistant to 1-methyl-4-phenyl1, 2, 3, 6-tetrahydropyridine-induced damage of dopaminergic neurons in the substantia nigra. Neurosci. Lett. 329, 354–358. Fiebich, B.L., Lieb, K., Kammerer, N., Hull, M., 2003. Synergistic inhibitory effect of ascorbic acid and acetylsalicylic acid on prostaglandin E2 release in primary rat microglia. J. Neurochem. 86, 173–178. Fonfria, E., Dare, E., Benelli, M., Sunol, C., Ceccatelli, S., 2002. Translocation of apoptosis-inducing factor in cerebellar granule cells exposed to neurotoxic agents inducing oxidative stress. Eur. J. Neurosci. 16, 2013–2016. Fonnum, F., 1975. Rapid radiochemical method for the determination of choline acetyltransferase. J. Neurochem. 24, 403–407. Goldin, E., Harel, S., Tomer, A., Yavin, E., 1990. Thromboxane and prostacyclin levels in fetal rabbit brain and placenta after intrauterine partial ischemic episodes. J. Neurochem. 54, 587–591.

39

Hagberg, H., Mallard, C., 2005. Effect of inflammation on central nervous system development and vulnerability. Curr. Opin. Neurol. 18, 117–123. Hewett, S.J., Uliasz, T.F., Vidwans, A.S., Hewett, J.A., 2000. Cyclooxygenase-2 contributes to N-methyl-D-aspartatemediated neuronal cell death in primary cortical cell culture. J. Pharmacol. Exp. Ther. 293, 417–425. Hillock, C.J., Crankshaw, D.J., 1999. Inhibitory prostanoid EP receptors in human non-pregnant myometrium. Eur. J. Pharmacol. 378, 99–108. Hirst, W.D., Young, K.A., Newton, R., Allport, V.C., Marriott, D.R., Wilkin, G.P., 1999. Expression of COX-2 by normal and reactive astrocytes in the adult rat central nervous system. Mol. Cell. Neurosci. 13, 57–68. Ho, L., Purohit, D., Haroutunian, V., Luterman, J.D., Willis, F., Naslund, J., Buxbaum, J.D., Mohs, R.C., Aisen, P.S., Pasinetti, G.M., 2001. Neuronal cyclooxygenase 2 expression in the hippocampal formation as a function of the clinical progression of Alzheimer disease. Arch. Neurol. 58, 487–492. Hoozemans, J.J., Rozemuller, A.J., Janssen, I., de Groot, C.J., Veerhuis, R., Eikelenboom, P., 2001. Cyclooxygenase expression in microglia and neurons in Alzheimer's disease and control brain. Acta Neuropathol. (Berl) 101, 2–8. Iadecola, C., Niwa, K., Nogawa, S., Zhao, X., Nagayama, M., Araki, E., Morham, S., Ross, M.E., 2001. Reduced susceptibility to ischemic brain injury and N-methyl-D-aspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 98, 1294–1299. Ishihara, O., Khan, H., Sullivan, M.H., Elder, M.G., 1992. Interleukin-1 beta stimulates decidual stromal cell cyclo-oxygenase enzyme and prostaglandin production. Prostaglandins. 44, 43–52. Jonakait, G.M., 2007. The effects of maternal inflammation on neuronal development: possible mechanisms. Int. J. Dev. Neurosci. 25, 415–425. Jonakait, G.M., Luskin, M.B., Wei, R., Tian, X.-F., Ni, L., 1996. Conditioned medium from activated microglia promotes cholinergic differentiation in the basal forebrain in vitro. Dev. Biol. 177, 85–95. Jonakait, G.M., Wen, Y., Wan, Y., Ni, L., 1999. Macrophage cell-conditioned medium promotes cholinergic differentiation of undifferentiated progenitors and synergizes with nerve growth factor action in the developing basal forebrain. Exp. Neurol. 1–13. Kaeser, F., Luthy, C., Herschkowitz, N., Oetliker, O., 1988. The effect of temporary hypoxia on prostaglandin synthesis in mouse brain cell cultures during development. Prostaglandins Leukot. Essent. Fatty Acids 32, 75–81. Katoh, H., Negishi, M., Ichikawa, A., 1996. Prostaglandin E receptor EP3 subtype induces neurite retraction via small GTPase Rho. J. Biol. Chem. 271, 29780–29784. Kawano, T., Anrather, J., Zhou, P., Park, L., Wang, G., Frys, K.A., Kunz, A., Cho, S., Orio, M., Iadecola, C., 2006. Prostaglandin E2 EP1 receptors: downstream effectors of COX-2 neurotoxicity. Nat. Med. 12, 225–229. Kelley, K.A., Ho, L., Winger, D., Freire-Moar, J., Borelli, C.B., Aisen, P.S., Pasinetti, G.M., 1999. Potentiation of excitotoxicity in transgenic mice overexpressing neuronal cyclooxygenase-2. Am. J. Pathol. 155, 995–1004. Kim, E.J., Lee, J.E., Kwon, K.J., Lee, S.H., Moon, C.H., Baik, E.J., 2001. Differential roles of cyclooxygenase isoforms after kainic acid-induced prostaglandin E(2) production and neurodegeneration in cortical and hippocampal cell cultures. Brain Res. 908, 1–9. Kim, E.J., Kwon, K.J., Park, J.Y., Lee, S.H., Moon, C.H., Baik, E.J., 2002. Neuroprotective effects of prostaglandin E2 or cAMP against microglial and neuronal free radical mediated toxicity associated with inflammation. J. Neurosci. Res. 70, 97–107.

40

BR A IN RE S EA RCH 1 2 85 ( 20 0 9 ) 3 0 – 41

Kitanaka, J., Hashimoto, H., Gotoh, M., Kondo, K., Sakata, K., Hirasawa, Y., Sawada, M., Suzumura, A., Marunouchi, T., Matsuda, T., Baba, A., 1996. Expression pattern of messenger RNAs for prostanoid receptors in glial cell cultures. Brain Res. 707, 282–287. Levi, G., Minghetti, L., Aloisi, F., 1998. Regulation of prostanoid synthesis in microglial cells and effects of prostaglandin E2 on microglial functions. Biochimie 80, 899–904. Liu, D., Wu, L., Breyer, R., Mattson, M.P., Andreasson, K., 2005. Neuroprotection by the PGE2 EP2 receptor in permanent focal cerebral ischemia. Ann. Neurol. 57, 758–761. Martinez, H.J., Dreyfus, C.F., Jonakait, G.M., Black, I.B., 1987. Nerve growth factor selectively increases cholinergic markers but not neuropeptides in rat basal forebrain in culture. Brain Res. 412, 295–301. McCullough, L., Wu, L., Haughey, N., Liang, X., Hand, T., Wang, Q., Breyer, R.M., Andreasson, K., 2004. Neuroprotective function of the PGE2 EP2 receptor in cerebral ischemia. J. Neurosci. 24, 257–268. Meisdalen, K., Dajani, O.F., Christoffersen, T., Sandnes, D., 2007. Prostaglandins enhance epidermal growth factor-induced DNA synthesis in hepatocytes by stimulation of E prostanoid 3 and F prostanoid receptors. J. Pharmacol. Exp. Ther. 322, 1044–1050. Miettinen, S., Fusco, F.R., Yrjanheikki, J., Keinanen, R., Hirvonen, T., Roivainen, R., Narhi, M., Hokfelt, T., Koistinaho, J., 1997. Spreading depression and focal brain ischemia induce cyclooxygenase-2 in cortical neurons through N-methyl-Daspartic acid-receptors and phospholipase A2. Proc. Natl. Acad. Sci. U. S. A. 94, 6500–6505. Minghetti, L., Nicolini, A., Polazzi, E., Creminon, C., Maclouf, J., Levi, G., 1997. Prostaglandin E2 downregulates inducible nitric oxide synthase expression in microglia by increasing cAMP levels. Adv. Exp. Med. Biol. 433, 181–184. Minghetti, L., Nicolini, A., Polazzi, E., Creminon, C., Maclouf, J., Levi, G., 2003. Inducible nitric oxide synthase expression in activated rat microglial cultures is downregulated by exogenous prostaglandin E2 and by cyclooxygenase inhibitors. Glia 19, 152–160. Mirjany, M., Ho, L., Pasinetti, G.M., 2002. Role of cyclooxygenase-2 in neuronal cell cycle activity and glutamate-mediated excitotoxicity. J. Pharmacol. Exp. Ther. 301, 494–500. Mitchell, M.D., Dudley, D.J., Edwin, S.S., Schiller, S.L., 1991. Interleukin-6 stimulates prostaglandin production by human amnion and decidual cells. Eur. J. Pharmacol. 192, 189–191. Molina-Holgado, E., Arevalo-Martin, A., Ortiz, S., Vela, J.M., Guaza, C., 2002. Theiler's virus infection induces the expression of cyclooxygenase-2 in murine astrocytes: inhibition by the anti-inflammatory cytokines interleukin-4 and interleukin-10. Neurosci. Lett. 324, 237–241. Montine, T.J., Milatovic, D., Gupta, R.C., Valyi-Nagy, T., Morrow, J.D., Breyer, R.M., 2002. Neuronal oxidative damage from activated innate immunity is EP2 receptor-dependent. J. Neurochem. 83, 463–470. Nakayama, M., Uchimura, K., Zhu, R.L., Nagayama, T., Rose, M.E., Stetler, R.A., Isakson, P.C., Chen, J., Graham, S.H., 1998. Cyclooxygenase-2 inhibition prevents delayed death of CA1 hippocampal neurons following global ischemia. Proc. Natl. Acad. Sci. U. S. A. 95, 10954–10959. Ni, L., Acevedo, G., Muralidharan, B., Padala, N., To, J., Jonakait, G.M., 2007. Toll-like receptor ligands and CD154 stimulate microglia to produce a factor(s) that promotes excess cholinergic differentiation in the developing rat basal forebrain: implications for neurodevelopmental disorders. Pediatr. Res. 61, 15–20. Nogawa, S., Zhang, F., Ross, M.E., Iadecola, C., 1997. Cyclo-oxygenase-2 gene expression in neurons contributes to ischemic brain damage. J. Neurosci. 17, 2746–2755.

Norel, X., Walch, L., Labat, C., Gascard, J.P., Dulmet, E., Brink, C., 1999. Prostanoid receptors involved in the relaxation of human bronchial preparations. Br. J Pharmacol. 126, 867–872. Pasinetti, G.M., Aisen, P.S., 1998. Cyclooxygenase-2 expression is increased in frontal cortex of Alzheimer's disease brain. Neurosci. 87, 319–324. Patterson, P.H., 2002. Maternal infection: window on neuroimmune interactions in fetal brain development and mental illness. Curr. Opin. Neurobiol. 12, 115–118. Plesnila, N., Zhu, C., Culmsee, C., Groger, M., Moskowitz, M.A., Blomgren, K., 2004. Nuclear translocation of apoptosisinducing factor after focal cerebral ischemia. J Cereb. Blood Flow Metab. 24, 458–466. Pompl, P.N., Ho, L., Bianchi, M., McManus, T., Qin, W., Pasinetti, G.M., 2003. A therapeutic role for cyclooxygenase-2 inhibitors in a transgenic mouse model of amyotrophic lateral sclerosis. FASEB J. 17, 725–727. Prasad, K.N., Hovland, A.R., La Rosa, F.G., Hovland, P.G., 1998. Prostaglandins as putative neurotoxins in Alzheimer's disease. Proc. Soc. Exp. Biol. Med. 219, 120–125. Randall, C.L., Anton, R.F., Becker, H.C., White, N.M., 1989. Role of prostaglandins in alcohol teratogenesis. Ann. N. Y. Acad. Sci. 562, 178–182. Refsnes, M., Dajani, O.F., Sandnes, D., Thoresen, G.H., Rottingen, J.A., Iversen, J.G., Christoffersen, T., 1995. On the mechanisms of the growth-promoting effect of prostaglandins in hepatocytes: the relationship between stimulation of DNA synthesis and signaling mediated by adenylyl cyclase and phosphoinositide-specific phospholipase C. J. Cell. Physiol. 164, 465–473. Rozenfeld, C., Martinez, R., Figueiredo, R.T., Bozza, M.T., Lima, F.R., Pires, A.L., Silva, P.M., Bonomo, A., Lannes-Vieira, J., De Souza, W., Moura-Neto, V., 2003. Soluble factors released by Toxoplasma gondii-infected astrocytes down-modulate nitric oxide production by gamma interferon-activated microglia and prevent neuronal degeneration. Infect. Immun. 71, 2047–2057. Saleem, S., Li, R.C., Wei, G., Dore, S., 2007. Effects of EP1 receptor on cerebral blood flow in the middle cerebral artery occlusion model of stroke in mice. J. Neurosci. Res. 85, 2433–2440. Scali, C., Prosperi, C., Vannucchi, M.G., Pepeu, G., Casamenti, F., 2000. Brain inflammatory reaction in an animal model of neuronal degeneration and its modulation by an anti-inflammatory drug: implication in Alzheimer's disease. Eur. J. Neurosci. 12, 1900–1912. Skold, M., Cullheim, S., Hammarberg, H., Piehl, F., Suneson, A., Lake, S., Sjogren, A., Walum, E., Risling, M., 2000. Induction of VEGF and VEGF receptors in the spinal cord after mechanical spinal injury and prostaglandin administration. Eur. J. Neurosci. 12, 3675–3686. Slagsvold, H.H., Rosseland, C.M., Jacobs, C., Khuong, E., Kristoffersen, N., Gaarder, M., Fallgren, A.B., Huitfeldt, H.S., Paulsen, R.E., 2003. High molecular weight DNA fragments are processed by caspase sensitive or caspase independent pathways in cultures of cerebellar granule neurons. Brain Res. 984, 111–121. Slawik, H., Volk, B., Fiebich, B., Hull, M., 2004. Microglial expression of prostaglandin EP3 receptor in excitotoxic lesions in the rat striatum. Neurochem. Int. 45, 653–660. Slemmer, J.E., Zhu, C., Landshamer, S., Trabold, R., Grohm, J., Ardeshiri, A., Wagner, E., Sweeney, M.I., Blomgren, K., Culmsee, C., Weber, J.T., Plesnila, N., 2008. Causal role of apoptosis-inducing factor for neuronal cell death following traumatic brain injury. Am. J. Pathol. 173, 1795–1805. Smith, S.E., Li, J., Garbett, K., Mirnics, K., Patterson, P.H., 2007. Maternal immune activation alters fetal brain development through interleukin-6. J. Neurosci. 27, 10695–10702.

BR A IN RE S E A RCH 1 2 85 ( 20 0 9 ) 3 0 – 4 1

Takadera, T., Yumoto, H., Tozuka, Y., Ohyashiki, T., 2002. Prostaglandin E(2) induces caspase-dependent apoptosis in rat cortical cells. Neurosci. Lett. 317, 61–64. Takadera, T., Shiraishi, Y., Ohyashiki, T., 2004. Prostaglandin E2 induced caspase-dependent apoptosis possibly through activation of EP2 receptors in cultured hippocampal neurons. Neurochem. Int. 45, 713–719. Teismann, P., Vila, M., Choi, D.K., Tieu, K., Wu, D.C., Jackson-Lewis, V., Przedborski, S., 2003. COX-2 and neurodegeneration in Parkinson's disease. Ann. N. Y. Acad. Sci. 991, 272–277. Thorburn, G.D., 1992. The placenta, PGE2 and parturition. Early Hum. Dev. 29, 63–73. Vassiliou, E., Sharma, V., Jing, H., Sheibanie, F., Ganea, D., 2004. Prostaglandin E2 promotes the survival of bone marrow-derived dendritic cells. J. Immunol. 173, 6955–6964. Wang, Y., Dawson V.L., Dawson T.M. in press. Poly (ADP-ribose) signals to mitochondrial AIF: a key event in parthanatos. Exp. Neurol. doi:10.1016/j.expneurol.2009.03.020. White, K.E., Ding, Q., Moore, B.B., Peters-Golden, M., Ware, L.B., Matthay, M.A., Olman, M.A., 2008. Prostaglandin E2 mediates IL-1beta-related fibroblast mitogenic effects in acute lung injury through differential utilization of prostanoid receptors. J. Immunol. 180, 637–646.

41

Williams, A., Van Dam, A.M., Ritchie, D., Eikelenboom, P., Fraser, H., 1997. Immunocytochemical appearance of cytokines, prostaglandin E2 and lipocortin-1 in the CNS during the incubation period of murine scrapie correlates with progressive PrP accumulations. Brain Res. 754, 171–180. Yavin, E., Goldin, E., Magal, E., Tomer, A., Harel, S., 1989. Ischemia stress and arachidonic acid metabolites in the fetal brain. Ann. N. Y. Acad. Sci. 559, 248–258. Zhang, L., Jiang, L., Sun, Q., Peng, T., Lou, K., Liu, N., Leng, J., 2007. Prostaglandin E2 enhances mitogen-activated protein kinase/Erk pathway in human cholangiocarcinoma cells: involvement of EP1 receptor, calcium and EGF receptors signaling. Mol. Cell. Biochem. 305, 19–26. Zhu, C., Qiu, L., Wang, X., Hallin, U., Cande, C., Kroemer, G., Hagberg, H., Blomgren, K., 2003. Involvement of apoptosis-inducing factor in neuronal death after hypoxia–ischemia in the neonatal rat brain. J. Neurochem. 86, 306–317. Zhu, C., Wang, X., Huang, Z., Qiu, L., Xu, F., Vahsen, N., Nilsson, M., Eriksson, P.S., Hagberg, H., Culmsee, C., Plesnila, N., Kroemer, G., Blomgren, K., 2007. Apoptosis-inducing factor is a major contributor to neuronal loss induced by neonatal cerebral hypoxia–ischemia. Cell Death Differ. 14, 775–784.