- Email: [email protected]
Reperfusion Model
Journal of Surgical Research 157, e107–e116 (2009) doi:10.1016/j.jss.2008.10.019
Protective Effect of Adeno-Mediated Human Bcl-xL Gene Transfer to the Mouse Liver in a Partial Ischemia/Reperfusion Model Kazuo Honda, M.D.,1 Taiji Tohyama, M.D., Hiroshi Kotegawa, M.D., Yoh Kojima, M.D., Fumiki Kushihata, M.D., Jota Watanabe, M.D., and Nobuaki Kobayashi, M.D. Department of Organ Regulatory Surgery, Ehime Graduate School of Medicine, Ehime, Japan Submitted for publication August 28, 2008
Background. The protective effect of heat preconditioning has been ascribed to the induction of heat shock proteins (HSP) in the liver. We detected an increase in Bcl-xL expression prior to HSP 70 expression in the rat liver after heat preconditioning. The net effect of overexpression of human Bcl-xL with a recombinant adenovector was estimated in a partial ischemia/ reperfusion model of the mouse liver. Materials and Methods. The time courses of the expression of HSP, Bcl-xL, Bcl-2, Bax, and Bag-1 in the SD rat liver after heat preconditioning were studied by Western blotting. The localizations of Bcl-xL, Bcl2, and Bax at 6 h after preconditioning were examined by immunostaining. The expression of Bcl-xL in the C57/BL mouse liver after intravenous injection of the recombinant adenovector was assessed by Western blotting and immunostaining. The protective effect of overexpression of Bcl-xL was estimated in a 60-min partial ischemia/reperfusion model of the mouse liver. Results. The expression of Bcl-xL peaked 12 h after heat preconditioning. The overexpression of Bcl-xL decreased enzyme release, histological cell injury, and the number of TUNEL-positive cells. Conclusion. Transfer of the human Bcl-xL gene to the liver had a protective effect against ischemia/reperfusion injury in a mouse model. Ó 2009 Elsevier Inc. All rights reserved.
Key Words: heat preconditioning; murine liver; HepG2; human Bcl-xL; gene transfer; ischemia/reperfusion injury.
1 To whom correspondence and reprint requests should be addressed at Department of Organ Regulatory Surgery, Ehime University Graduate School of Medicine, Shitsukawa, Toon City, Ehime, 791-0295, Japan. E-mail: [email protected].
INTRODUCTION
Many reports on heat preconditioning in animal models have shown that pre-exposure to hyperthermia increases the tolerance to ischemia/reperfusion injury of the liver [1]. The protective effect of heat preconditioning has been chiefly ascribed to the induction of heat shock protein 70 (HSP 70) [2] and heme oxygenase (HO-1) [3], but detailed mechanisms responsible for cytoprotection are not well elucidated. We studied the protective effect of heat preconditioning in a rat liver transplantation model and reported that HPS 70 was induced in the hepatocytes around the central veins as well as in the sinusoidal endothelial cells (SEC). The proportions of terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL)-positive hepatocytes and SEC of the heat shock group at 3 h after transplant reperfusion were significantly lower than those of the control, and electron micrographs revealed the reduction of apoptosis of SEC [4]. In the same transplant model, the serum levels of interleukin-6 and interleukin-10 were significantly lower in the heat preconditioning group than in the control group [5]. The Bcl-2 family includes both anti-apoptotic and pro-apoptotic proteins. We examined the time course of the expression of Bcl-xL, Bcl-2, Bax, and Bag-1 by Western blotting in relation to HSP 70 expression in the same rat heat preconditioning model; the localizations of Bcl-xL, Bcl-2, and Bax proteins were then studied by immunostaining. Bcl-xL was induced in the hepatocytes around the central veins 12 h before HSP 70 induction, while Bcl-2 was not induced in the hepatocytes and there were no changes in the expression of Bax and Bag-1. Bilbao reported in 1999 that an adenovector containing the human Bcl-2 gene was transferred to the mouse liver, which had
e107
0022-4804/09 $36.00 Ó 2009 Elsevier Inc. All rights reserved.
e108
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
protective effect against ischemia/reperfusion injury [6] and organ preservation injury [7]. However, Oshiro reported that an overexpression of antiapoptotic protein Bcl-2 with an adenovector of human Bcl-2 paradoxically exerted a proapoptotic effect in a hepatic ischemia/reperfusion model of rats [8]. We assumed that the specific gene to be transferred to the hepatocytes should be Bcl-xL, because there was no expression of Bcl-2 in the hepatocytes from the beginning and Bcl-2 was not induced in the hepatocytes by heat preconditioning. We amplified the total length of the mRNA of human Bcl-xL by reverse transcription-polymerase chain reaction (RT-PCR) and produced an adenovector of Bcl-xL. The protective effect of Bcl-xL gene transfer was evaluated with RCN-H4 rat colon cancer cells and HepG2 human hepatoblastoma cells in vitro and in a partial ischemia/reperfusion model of mouse liver in vivo. MATERIALS AND METHODS Heat Preconditioning of Rats Male Sprague-Dawley rats weighing 280 to 330 g were purchased from Charles River (Kanagawa, Japan). The rats were kept in the Department of Biological Resources, Integrated Center for Science Shigenobu Station, and the experiments followed the guidelines for animal experiments of Ehime University. Heat shock preconditioning was applied as described elsewhere [4]. In brief, the rats of the heat shock (HS) group (n ¼ 4) were wrapped with a vinyl bag under anesthesia and immersed in hot water at 43 C to raise their body temperature to 42–42.5 C with monitoring by a digital thermometer in the rectum for 15 min. The rats of the control (C) group (n ¼ 4) received only anesthesia.
Western Blot Analysis of Heat Shock Protein and Bcl-2 Family Members After Heat Preconditioning The liver tissue samples were collected at 3, 6, 12, 24, 48, and 72 h after heat preconditioning and stored at –80 C. Frozen liver tissues were homogenized in lysis buffer (10 mM Tris-HCl pH 7.5, 250 mM sucrose, 1 mM phenylmethylsulphonyl fluoride, 10 mg/mL aprotinin, 10 mg/mL pepstatin) and the protein content of the supernatants was measured using a commercial bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Twenty micrograms of proteins was separated on a 10% polyacrylamide gel with 0.1% sodium dodecyl sulfate and transferred to polyvinylidene fluoride membranes (Pall, East Hills, NY) for HSP analysis. One hundred micrograms of proteins were used for Bcl-xL, Bcl-2, Bax, or Bag-1. The membranes were blocked with 5% skim milk in Tris-buffered saline (20 mM Tris, 500 mM NaCl, pH 7.5) at 4 C overnight, and incubated with the primary antibody at room temperature for 2 h. The antibodies used in this experiment were as follows: anti-Bcl-xL mouse monoclonal antibody, antiBcl-2 mouse monoclonal antibody (Transduction Laboratories, Lexington, KY), anti-Bax rabbit polyclonal antibody (Oncogene Research Products, Cambridge, MA), anti-Bag-1 mouse monoclonal antibody (Mbl, Nagoya, Japan), and anti-HSP70 mouse monoclonal antibody (Stress Gen Biotechnologies Corp., Victoria, BC, Canada). The proteins were visualized using 5-bromo-4-chloro-3-indolyl phosphate-nitroblue tetrazolium with an ECF Western blotting kit (Amersham Pharmacia Biotech, Bucks, UK) and photographed by Fluor Imager SI (Amersham Pharmacia Biotech). The intensity of fluorescence was analyzed by ImageQuant (Amersham Pharmacia Biotech) and
expressed as fluorescence intensity index corrected by the positive control in the same gel.
Immunohistochemical Staining of Bcl-xL, Bcl-2, and Bax The rat livers sampled 6 h after heat preconditioning and the controls sampled at 6 h after anesthesia were perfused and fixed with 4% paraformaldehyde in phosphate-buffered saline at 4 C for 72 h. The 4-mm-thick sections were stained by the avidin-biotin horseradish peroxidase method using a Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, CA). The antibodies for Bcl-xL, Bcl-2, and Bax were used as the primary antibodies, and mouse IgG1 (DAKO, Glostrup, Denmark), mouse IgG2 (Dako) and normal rabbit serum (Vector Laboratories), respectively, were used as negative controls. The sections were incubated at 4 C overnight and visualized using diaminobenzidine.
Preparation of Adenovector, AxCAhBcl-xL, for Bcl-xL Gene Transfer The cosmid included in the Takara adenovirus vector expression kit (Takara Bio Inc., Shiga, Japan) is constructed from adenovirus type 5, deleted of E1A, E1B, and E3 lesions, and CAG promoter. The total RNA was extracted from HepG2 human hepatoblastoma cells and RT-PCR was performed with the primers at both ends of the cDNA of Bcl-xL (forward primer: 5’-ATGCCTCAGAGCAACCGGGA; reverse primer: 5’-TCATTTCCGACTGAAGAGTG). The target 702-bp band was cut out from an agarose gel and purified with a QIA Quick gel extraction kit (Qiagen, Hilden, Germany) and the sequence was confirmed with an ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA). The DNA was ligated into the SmaI site of the cosmid vector, pAxCAwtit. It was packaged into lambda-phage with Gigapack III XL packaging extract (Stratagene, Cedar Creek, TX) and transformed into DH5-a Escherichia coli (E. coli). The bacteria were cultured and the cosmid was prepared with a QIA filter plasmid midi kit (Qiagen). The inserted DNA length was determined with ClaI endonuclease and the sequence was confirmed by an ABI 310 sequencer (forward primer: 5’-TCTAGAGCCTCTGCTAACCATG; reverse primer: 5’-AGCCACCACCTTCTGATAGGCA). The E. coli was cultured in a large quantity and the sequence was confirmed for the second time. After preparation with endonuclease, the cosmid was transfected to 293 cells by a lipofection method with TransIT-LT1 (Takara Bio Inc.). After overnight incubation, these 293 cells were collected and transferred to 96-well plates in undiluted solution, 103 diluted, and 1003 diluted solution. The cells were collected from the wells in which all the cells were degenerated, and subjected to freeze and thaw and then centrifuged. The supernatant was collected as the primary virus solution. The infection with the virus was repeated to prepare a large amount of virus solutions. The absence of replication-competent adenovirus (RCA) was confirmed in the second and fourth virus solutions by PCR using E1A-F (CTGATCGAAGAGGTACTGGCTGATAATCTTCCACC) and E1A-R (TTATGGCCTGGG GCGTTTACAGCTCAAGTCCAAAG) with HeLa cells. The adenovectors were prepared with a BD Adeno-X purification kit (BD Biosciences, San Jose, CA) and stored at –80 C. The titer of the virus solution was determined before experimental use. The adenovector of LacZ (AxCAlacZ) was prepared with pAxCAiLacZ (Takara Bio Inc.).
Western Blot Analysis for In Vitro Bcl-xL Expression RCN-H4 rat colon cancer cells, which do not express Bcl-xL, were cultured in RPMI 1640 medium containing 10% fetal calf serum in a CO2 incubator. 2 3 106 cells of RCN-H4 were infected with 1, 10, and 50 MOI of AxCAhBcl-xL and rinsed with phosphate buffered saline (PBS) after 24 h incubation. After 2 d, cells were subjected to Western blotting with anti-human Bcl-xL monoclonal antibody (Transduction Laboratories) as described above. The samples at 1,
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e109
FIG. 1. (A) Time course of the expression of HSP 70 and Bcl-2 family members in the rat liver after heat preconditioning. The liver samples were subjected to Western blotting after the elevation of body temperature to 42 C for 15 min. The expression of HSP peaked 24 h after heat shock. The expression of Bcl-xL peaked 12 h after heat preconditioning, while there were no obvious changes in Bcl-2, Bax, and Bag-1 levels. (B) Analysis of Bcl-xL and HSP expression after heat shock by Fluor Imager SI. Bcl-xL protein expression showed a significant increase from 6 to 24 h after heat shock and the peak was earlier than that of HSP expression. Fluorescence intensity index ¼ study sample/positive control sample. Values are represented by mean 6 SD of 4 independent experiments. *P < 0.05 versus control. 2, 3, and 5 d after 10 MOI infection of AxCAhBcl-xL were determined by Western blotting.
Real-Time Polymerase Chain Reaction for Bcl-xL Expression RCN-H4 cells were infected with 0.1, 1, 10, and 50 MOI of AxCAhBcl-xL and the total RNA was extracted with TRIZOL (Wako Pure Chemical Industries, Osaka, Japan). The reverse transcription reaction was performed with a first strand cDNA synthesis kit (Applied Biosystems) and PCR was performed with primers of a Taq Man Gene Expression Assays Hs 00169141-mI and ABI 7300 (Applied Biosystems). GAPDH was used as a control with Taq Man Rodent GAPDH Control Reagent VIC (Applied Biosystems). The data were calibrated with GAPDH and analyzed with SDS system software (Applied Biosystems). The levels of the mRNA were determined at 1, 3, and 5 d after 50 MOI infection of AxCAhBcl-xL.
Effect of Bcl-xL Gene Transfer to RCN-H4 Cells and HepG2 Cells Cisplatin was used as the inducer of apoptosis. 2 3 103 cells in RPMI 1640 medium containing 5% fetal bovine serum were transferred to each well of a 96-well plate. Cisplatin was added to RCN-H4 cells at the final concentrations of 0.01, 0.1, 0.5, 1, and 5 mg/mL, and to
HepG2 cells at 0.1, 1, 5, 10, and 50 mg/mL. The survival was determined with the Premix WST-1 Cell Proliferation Assay System (Takara Bio Inc., Shiga, Japan). The absorbance of the formazan was determined with a model 550 microplate reader (Bio-Rad Laboratories, Hercules, CA). The concentrations of cisplatin were selected to lower the cell survival rate to less than 50% (1 mg/mLl for RCN-H4 and 2 mg/mL for HepG2). The protective effects of AxCAhBcl-xL at 10 MOI were compared with those of AxCAlacZ.
Changes in Caspase 3 Levels with Bcl-xL Gene Transfer The changes in caspase 3 levels were studied with RCN-H4 cells, which do not express Bcl-xL, to evaluate the net effect of gene transfer of Bcl-xL. The activity of caspase 3 was determined with a commercial caspase 3 colorimetric activity assay kit (Chemicon, Temecula, CA). RCN-H4 cells were transferred to RPMI 1640 medium containing 5% fetal bovine serum and infected with 10 MOI of AxCAhBcl-xL or AxCAlacZ. Cisplatin was added at the final concentration of 1 mg/mL 3 d later. The cells were collected after 48 h incubation and treated with 200 mL of lysis buffer for 1 h. The concentration of the protein in the supernatant was determined with a Bio-Rad DC protein assay (Bio-Rad Laboratories). Thirty microliters (100 mg) of each sample were added to assay buffer and caspase 3 substrate and incubated for 2 h at 37 C. The absorbance was measured at a wave length of 405 nm.
e110
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
FIG. 2. Localization of the induced Bcl-xL at 6 h after heat preconditioning. The liver samples 6 h after the elevation of body temperature up to 42 C for 15 min were stained with anti-Bcl-xL. In the anesthesia-only group, the nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bcl-xL all over the lobule. The lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were also stained, but the sinusoidal cells were not stained. Bcl-xL was induced in the cytoplasm of the hepatocytes in zone 3 of Rappaport’s acinus (around the central vein) 6 h after heat preconditioning. The length of the scale bar is 100 mm. C: central vein. P: portal vein.
In Vivo Gene Expression in the Mouse liver with AxCAhBcl-xL Male C57BL/6 mice (Japan SLC Inc, Hamamatsu, Japan) were kept in the Department of Biological Resources, Integrated Center for Science Shigenobu Station and the experiments followed the guideline for animal experiments of Ehime University. AxCAhBcl-xL (0.5 3 108 PFU and 1 3 109 PFU) and AxCAlacZ (13 109 PFU) in 300 mL of PBS were injected into the tail vein of mice. The livers were collected 3 d later and immunostaining and Western blotting were performed as described above.
Protective Effect of In Vivo Bcl-xL Gene Transfer Against Ischemia/Reperfusion Liver Injury To evaluate the toxicity of the infection of adenovectors, 1 3 109 PFU of AxCAhBcl-xL and AxCAlacZ were injected into the tail vein of the mice. The levels of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) 3 d after infection were determined with a C-2 test (Wako Pure Chemical Industries, Osaka, Japan). Three days before the surgical procedure, 1 3 109 PFU of AxCAhBcl-xL was injected into the tail vein for the Bcl-xL group
FIG. 3. Immunostaing of the rat liver with anti-Bcl-2 and anti-Bax antibody. The liver samples 6 h after heat shock were stained with antiBcl-2 and anti-Bax, and compared with the anesthesia-only group. The hepatocytes were not stained with anti-Bcl-2 in the anesthesia only group, while the lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were stained and the sinusoidal cells in zone 1 of Rappaport’s acinus were stained. Bcl-2 was not induced in the hepatocytes 6 h after heat shock. The nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bax and there were no obvious changes after heat shock. The length of the scale bar is 50 mm. C: central vein. P: portal vein.
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e111
FIG. 4. Bcl-xL expression in RCN-H4 cells. (A) RCN-H4 cells were infected with AxCAhBcl-xL at the concentration of 1, 10, and 50 MOI and were subjected to Western blotting 2 d later. Bcl-xL expression was detected at 10 and 50 MOI. (B) Time course of Bcl-xL expression after infection of AxCAhBcl-xL (10 MOI). The level of Bcl-xL protein peaked at day 3. (C) Real time PCR by relative ratio of Bcl-xL mRNA expression in RCN-H4 after infection of AxCAhBcl-xL (10 MOI). The Bcl-xL mRNA level was highest at day 3, same as the Bcl-xL protein expression. (n ¼ 6) and the same amount of AxCAlacZ for the lacZ group (n ¼ 6). The control mice (n ¼ 6) were injected with 300 mL of PBS. Under ether anesthesia, the left lateral lobe of the liver was exposed and a microvascular clamp was applied on the vascular pedicle to obliterate the hepatic artery and the portal vein, resulting in approximately 37% ischemia of the total liver. The clamp was removed 60 min later under anesthesia and the peripheral blood and the liver samples were collected at 6 h after reperfusion. Serum AST and AST levels were then determined. The liver samples were fixed with 10% formalin and stained with hematoxylin-eosin (HE). The grades of the histological liver injury were estimated at 100 adjacent points in 1-mm2 fields under a 200-power microscope by blinded pathologists based on the following criteria: grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders,
and mild to moderate neutrophil infiltration; and grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe neutrophil infiltration. The extent of the liver injury was expressed as a percentage of the grades.
TUNEL Staining of the Liver TUNEL staining was performed with an apoptosis in situ detection kit (Wako Pure Chemical Industries) to estimate the DNA damage after ischemia/reperfusion. The 4-mm sections of the liver samples were deparaffined and incubated with 10 mg/mL of proteinase K for 10 min. The sections were incubated with 100 mL of TdT reaction solution and the endogenous peroxidase was blocked with 3% H2O2, and then incubated with 100 mL of POD-conjugated antibody solution for 10 min at 37 C. The sections were treated with 100 ml of 3,3’-diaminobenzidine
FIG. 5. The survival rates of RCN-H4 cells and HepG2 cells against cisplatin. (A) The survival rates of RCN-H4 cells at different concentrations of cisplatin 48 h after administration were estimated with WST1 assay. The survival rate at the concentration of 1 mg/mL of cisplatin was 44.4 6 14.5%. (B)The effect of the Bcl-xL gene transfer to RCN-H4 cells at the concentration of 1 mg/mL of cisplatin. The survival rate was significantly increased in the Bcl-xL group (*P < 0.05). (C) The survival rates of HepG2 cells at different concentrations of cisplatin. HepG2 cells survived 58% at 1 mg/mL of cisplatin and 3% at 5 mg/mL. (D) The effect of the Bcl-xL gene transfer to HepG2 cells at the concentration of 2 mg/mL. The survival rate was significantly increased in the Bcl-xL group (*P < 0.05).
e112
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
Bcl-2, Bax, and Bag-1 levels (Fig. 1A). Bcl-xL protein expression showed a significant increase from 6 to 24 h and the peak was earlier than that of HSP expression (Fig. 1B).
Localization of the Induced Bcl-xL 6 Hours After Heat Preconditioning
FIG. 6. The changes in caspase three levels with Bcl-xL gene transfer. The Bcl-xL gene was transferred to RCN-H4 cells to evaluate the net effect of gene transfer. Caspase 3 activity in RCN-H4 cells was measured with a caspase-3 colorimetric activity assay kit 48 h after Cisplatin administration at the concentration of 1 mg/ml. The activity was significantly decreased in Bcl-xL group (n ¼ 4, *P < 0.05). (DAB) solution and counterstained with the counterstaining reagent. The number of the cells was counted in 50 fields under a 400-power microscope and the ratio of the TUNEL positive cells was calculated. Each result is expressed as a mean values 6 SD.
Statistical Analysis Statistical analysis was performed with the Mann-Whitney’s U test to evaluate differences between the control and the heat shock groups in the Western blot analysis. Statistical analysis was performed with the Steel-Dwass test to evaluate differences among the experimental groups. Values of P < 0.05 were considered statistically significant.
The livers were stained with the anti Bcl-xL antibody. In the anesthesia only group, the nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bcl-xL all over the lobule. The lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were also stained, but the sinusoidal cells were not stained. Bcl-xL was induced in the cytoplasm of the hepatocytes in zone 3 of Rappaport’s acinus (around the central vein) 6 h after heat preconditioning (Fig. 2). The hepatocytes were not stained with antiBcl-2 in the anesthesia only group, while the lobular bile duct cells, endothelial cells of the portal vein, hepatic arterial cells, and the sinusoidal cells in zone 1 of Rappaport’s acinus were stained. Bcl-2 was not induced in the hepatocytes 6 h after heat shock. The nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bax and there were no obvious changes after heat shock (Fig. 3).
RESULTS Time Course of the Expression of HSP and Bcl-2 Family Members in the Rat Liver After Heat Preconditioning
Expression of HSP was detected slightly in the livers of the untreated rats. The HSP expression peaked 24 h after heat shock. The expression of Bcl-xL increased at 6 h, peaked at 12 h, and then returned to the initial level at 72 h, while the expression level of HSP was still increased at 72 h. There were no obvious changes in
Bcl-xL Expression in RCN-H4 Cells with AxCAhBcl-xL
The RCN-H4 cells were infected with AxCAhBcl-xL. The human Bcl-xL protein was expressed in the RCNH4 cells at a low level with 1 MOI and was evidently expressed with 50 MOI of AxCAhBcl-xL (Fig. 4A). The level of the Bcl-xL protein was highest at day 3 (Fig. 4B). The level of mRNA was also highest at day 3, shown with real-time PCR (Fig. 4C).
FIG. 7. Immunohistochemical staining of the liver of C57BL/6 mice with anti-Bcl-xL antibody 72 h after intravenous administration of adenovectors. (A) Bcl-xL was diffusedly expressed in the hepatocytes by AxCAhBcl-xL (13109 PFU). (B) The hepatocytes around the central vein were slightly stained by the administration of AxCAlacZ (1 3 109 PFU). The length of the scale bar is 50 mm.
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e113
xL and a clear band with 1 3 109 PFU. Very dim bands were seen in the saline lane and the AxCAlacZ lane, which represented the endogenous expression of mouse Bcl-xL (Fig. 8). FIG. 8. Western blotting of the Bcl-xL protein expression in the mouse liver. Mice were administered with 0.5 3 108 PFU, 1 3 109 PFU of AxCAhBcl-xL, or 1 3 109 PFU of AxCALacZ or saline intravenously. The levels of Bcl-xL expression were dependent on the amount of PFU 3 d after the infection of AxCAhBcl-xL. Expression of Bcl-xL was slightly detected in the saline group and the LacZ group, indicating the endogenous murine Bcl-xL protein expression.
Biological Activities of AxCAhBcl-xL In Vitro
Because the survival rate of the RCN-H4 cells was 44% with 1 mg/mL of cisplatin (Fig. 5A), the protective effect of AxCAhBcl-xL was evaluated at this concentration. The survival rate of the Bcl-xL group was significantly higher than those of the lacZ group and the control group (Fig. 5B). Because the survival rate of HepG2 cells was 58% with 1 mg/mL of cisplatin and 3% with 5 mg/mL (Fig. 5C), the protective effect was estimated at the concentration of 2 mg/mL. The survival rate of the HepG2 cells, which express endogenous human Bcl-xL, was 5% in the control group, 8% in the lacZ group, and 29% in the Bcl-xL group (Fig. 5D). The relative activity of the caspase 3 in RCN-H4 cells treated with 1 mg/ml of cisplatin was 8.2 6 1.2, compared with no cisplatin administration. The relative activity of the lacZ group was 6.9 6 1.5, but the relative caspase 3 activity of the Bcl-xL group was 2.6 6 0.4, which was significantly lower than the other groups (Fig. 6).
Bcl-xL Expression in the Mouse Liver
The livers of the mice 3 d after intravenous injection of AxCAhBcl-xL were subjected to immunostaining. Most of the hepatocytes were stained in the cytoplasm (Fig. 7). The Western blotting of the homogenized liver showed a faint band with 0.5 3 108 PFU of AxCAhBcl-
Protective Effects of Bcl-xL Gene Transfer In Vivo
The influence of the adenovector-infection on the hepatocytes was evaluated by the measurement of the serum AST and ALT levels 3 d after infection. The levels of AST and ALT were almost equal among the control, lacZ, and Bcl-xL groups (data not shown). The AST level 6 h after the ischemia/reperfusion of the Bcl-xL group was significantly lower than those of the control and lacZ groups (Fig. 9A), as well as the ALT level (Fig. 9B). The hepatocytes of the control and lacZ groups were evidently degraded with HE staining but the change in the Bcl-xL group was mild (Fig. 10). The ratio of grade-3 cell injury was significantly low in the Bcl-xL group (Table 1). The ratio of the TUNEL-positive cells was 46.4 6 8.7% with the control group and 45.9 6 13.6% in the lacZ group, while the ratio was 16.7 6 1.5% in the Bcl-xL group (Fig. 11). DISCUSSION
The late protective effect of liver preconditioning has been ascribed to the synthesis of multiple stress-response proteins, including HSP 70, HSP 27, and HSP 32/heme oxygenase-1. In our rat transplant model, the numbers of the apoptotic hepatocytes and SECs significantly decreased by heat preconditioning, suggesting some anti-apoptotic effect of heat preconditioning; however, there have been few reports on the changes in Bcl family members after liver preconditioning. Yadav et al. reported that Bcl-2 levels were similar in control and 90min ischemia-preconditioned livers of mice at 0, 1, and 3 h after reperfusion [9]. Doi et al. applied 15 min warm ischemia 48 h before 70% hepatectomy of rat livers and reported that the Bcl-xL level in the liver of the ischemia group was significantly higher than that in the
FIG. 9. Effects of Bcl-xL gene transfer to the liver. Mice were administered with 13109 PFU of AxCAhBcl-xL, AxCALacZ, or saline 3 d before induction of partial hepatic ischemia (37% of the total liver volume) for 60 min. Serum AST (A) and ALT (B) levels were measured 6 h after reperfusion (n ¼ 6). AST and ALT levels were significantly lower in Bcl-xL group. (n ¼ 6, *P < 0.05).
e114
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
FIG. 10. HE staining of the ischemic liver 6 h after reperfusion. (A) Saline group, (B) LacZ group, and (C) Bcl-xL group. The mouse livers treated with saline or LacZ adenovector showed pericentral necrosis, increased eosinophilia, and vacuolization (A), (B). These morphological changes are markedly reduced by Bcl-xL gene transfer (C).
nonischemia group 12 h after the hepatectomy [10]. Hu et al. studied the expression of C-jun and Bcl-xL after normothermic liver ischemic preconditioning in rats. The expressions of Bcl-xL mRNA and protein in the ischemic preconditioning group were significantly increased at 3, 6, and 20 h compared with those in both the sham operation group and the ischemia reperfusion group [11]. However, these reports involved cases of ischemic preconditioning; there has been no systematic report on the changes of expression of Bcl family members after heat preconditioning. The protein level of Bcl-xL peaked at 12 h and HSP 70 peaked at 24 h after preconditioning, while there were no changes in the levels of Bcl-2, Bax, and Bag-1. The liver samples 6 h after preconditioning were subjected to immunostaining because real-time PCR revealed a decline in the mRNA level of Bcl-xL 12 h after preconditioning (data not shown). Interestingly, Bcl-xL was induced in the hepatocytes around the central veins, which was the same area as the induced HSP 70 protein [4]. Several reports on Bcl-2 gene transfer using adenovectors to the liver have been published [6, 7, 8, 12, 13] as well as to the brain [14], the heart [15], the lung [16] and the kidney [17]. Some reports applied the HVJ-liposome as a vector of the Bcl-2 gene instead of using an adenovector [18, 19]. However, reports on the in vivo gene transfer of Bcl-xL are very few. Huang et al. reported in 2003 that Bcl-xL gene transfer pro-
tected the heart against ischemia/reperfusion injury in a rat model [20]. They also reported that Bcl-xL gene transfer prolonged cardiac cold preservation time in rats [21]. Chien et al. reported that adeno-mediated Bcl-xL gene transfer significantly improved the renal dysfunction induced by ischemia/reperfusion [22]. However, there is presently no available report on Bcl-xL gene transfer to the liver. We developed an adenovector of the human Bcl-xL gene and verified its biological activities with RCN-H4 rat colon carcinoma cells, which do not express human Bcl-xL, and with
TABLE 1 Histological Grade 6 Hours After Reperfusion
Saline LacZ Bcl-xL
Grade 0
Grade 1
Grade 2
Grade 3
1.06 6 1.1% 0.5 6 0.7% 3.1 6 4.5%
26.1 6 9.6% 28.3 6 16.6% 56.6 6 9.1%
32.7 6 3.2% 26.4 6 10.4% 22.9 6 8.5%
40.1 6 10.6% 44.7 6 14.0% 17.2 6 6.7%*
Notes. The proportion of each histological grade determined by a point-counting method with an ordinal scale. Grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders, and mild to moderate PMN infiltration; grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe PMN infiltration. The ratio of grade 3 was significantly low in Bcl-xL group (* P < 0.05).
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e115
turbances in an isolated perfusion model of the rat liver. Hepatology 2000;31:407. 4. Matsumoto K, Honda K, Kobayashi N. Protective effect of heat preconditioning of rat liver graft resulting in improved transplant survival. Transplantation 2001;15(71):862. 5. Watanabe J, Kushihata F, Matsumoto K, et al. Downregulation of cytokine release by heat preconditioning of livers used for transplantation in rats. Dig Dis Sci 2005; 50:1823. FIG. 11. The liver samples 6 h after reperfusion were subjected to a TUNEL assay. The ratio of TUNEL positive cells was significantly lower in the Bcl-xL group than that of the other groups. (n ¼ 6, *P < 0.05).
HepG2 cells, from which we obtained the cDNA of human Bcl-xL. In the animal study, the expression of the human Bcl-xL in the mouse liver was confirmed by immunostaining and Western blot. In the 60-min ischemia/reperfusion model of the 37% mouse liver, the serum levels of AST and ALT were significantly lower in the Bcl-xL group and the histological grades of the Bcl-xL group were lower than those of the lacZ group and the control group. The ratio of the TUNEL-positive cells of the Bcl-xL group was lower, which suggested that the Bcl-xL gene transfer decreased the DNA damage of the hepatocytes. From these results, we concluded that the Bcl-xL gene transfer to the liver had a protective effect against ischemia/reperfusion injury. We are investigating the intracellular consequences of Bcl-xL gene transfer in hepatocytes, including heat shock proteins. Takehara et al. generated hepatocyte-specific Bcl-xL deficient mice using the Cre-loxP system and analyzed the consequences of long-term apoptosis in hepatocytes. In vivo hepatocyte-specific disruption of Bcl-xL resulted in spontaneous apoptosis of hepatocytes for more than 6 mo [23]. They concluded that their study identified BclxL as a critical apoptosis antagonist in hepatocytes. Temporary overexpression of Bcl-xL with this adenovector might be further applicable to general liver surgery and various liver diseases. ACKNOWLEDGMENTS This work was partially supported by Grants-in-Aid for Scientific Research from the Society for the Promotion of Science, Japan.
REFERENCES 1. Carini R, Albano E. Recent insights on the mechanisms of liver preconditioning. Gastroenterology 2003;125:1480–91. 2. Saad S, Kanai M, Awane M, et al. Protective effect of heat shock pretreatment with heat shock protein induction before hepatic warm ischemic injury caused by Pringle’s maneuver. Surgery 1995;118:510. 3. Terajima H, Enders G, Thiaener A, et al. Impact of hyperthermic preconditioning on postischemic hepatic microcirculatory dis-
6. Bilbao G, Contreras JL, Eckhoff DE, et al. Reduction of ischemiareperfusion injury of the liver by in vivo adenovirus-mediated gene transfer of the antiapoptotic Bcl-2 gene. Ann Surg 1999; 230:185. 7. Bilbao G, Contreras JL, Gomez-Navarro J, et al. Genetic modification of liver grafts with an adenoviral vector encoding the Bcl-2 gene improves organ preservation. Transplantation 1999; 27(67):775. 8. Oshiro T, Shiraishi M, Muto Y. Adenovirus mediated gene transfer of antiapoptotic protein in hepatic ischemia-reperfusion injury: the paradoxical effect of Bcl-2 expression in the reperfused liver. J Surg Res 2002;103:30. 9. Kamimukai N, Togo S, Hasegawa S, et al. Expression of Bcl-2 family reduces apoptotic hepatocytes after excessive hepatectomy. Eur Surg Res 2001;33:8. 10. Takehara T, Liu X, Fujimoto J, et al. Expression and role of Bcl-xL in human hepatocellular carcinomas. Hepatology 2001; 34:55. 11. Watanabe J, Kushihata F, Honda K, et al. Prognostic significance of Bcl-xL in human hepatocellular carcinoma. Surgery 2004;135:604. 12. Rentsh M, Kienle K, Muller T, et al. Adenoviral bcl-2 transfer improves survival and early graft function after ischemia and reperfusion in rat liver transplantation. Transplantation 2005; 27(80):1461. 13. Takushi Y, Shiraishi M, Nozato E, et al. Expression of anti-apoptotic protein, Bcl-2, in liver regeneration after a partial hepatectomy. J Sug Res 2006;134:93. 14. Simazaki K, Urabe M, Monahan J, et al. Adeno-associated virus vector-mediated bcl-2 gene transfer into post-ischemic gerbil braion in vivo: Prospects for gene therapy of ischemia-induced neuronal death. Gene Ther 2000;7:1244. 15. Chatterjee S, Stewart AS, Bish LT, et al. Viral gene transfer of the antiapoptotic factor Bcl-2 protects against chronic postischemic heart failure. Circulation 2002;24; 106(12 Suppl. 1):1212. 16. Cooke DT, Hoyt EG, Robbins RC. Overexpression of human Bcl2 in syngenic rat donor lungs preserves posttransplant function and reduces intragraft caspase activity and interleukin-1beta production. Transplantation 2005;15(79):762. 17. Chiang-Ting C, Tzu-Ching C, Ching-Yi T, et al. Adenovirus-mediated bcl-2 gene transfer inhibits renal ischemia/reperfusion induced tubular oxidative stress and apoptosis. Am J Transplant 2005;5:1194. 18. Yanada S, Saitoh Y, Kaneda Y, Miwa N. Cytoprotection by bcl-2 gene transfer against ischemic liver injuries together with repressed lipid peroxidation and increased ascorbic acid in livers and serum. J Cell Biochem 2004;15(93):857. 19. Yanada S, Sasaki M, Takayama S, et al. Hemagglutinating virus of Japan-artificial viral envelope liposome-mediated cotransfer of bag-1 and bcl-2 genes protects hepatic cells against ischemic injury through BAG-1-assisted preferential enhancement of bcl-2 protein expression. Hum Gene Ther 2005;16:627.
e116
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
20. Huang J, Ito Y, Morikawa M, et al. Bcl-xL gene transfer protects the heart against ischemia/reperfusion injury. Biochem Bioph Res Co 2003;7(311):64. 21. Huang J, Nakamura K, Ito Y, et al. Bcl-xL gene transfer inhibits Bax translocation and prolongs cardiac preservation time in rats. Circulation 2005;5(112):76.
22. Chien CT, Shyue SK, Lai MK. Bcl-xL augmentation potentially reduces ischemia/reperfusion induced proximal and distal tubular apoptosis and autophagy. Transplantation 2007;84:1183. 23. Takehara T, Tatsumi T, Suzuki T, et al. Hepatocyte-specific disruption of Bcl-xL leads to continuous hepatocyte apoptosis and liver fibrotic responses. Gastroenterology 2004;127:1189.
Protective Effect of Adeno-Mediated Human Bcl-xL Gene Transfer to the Mouse Liver in a Partial Ischemia/Reperfusion Model Kazuo Honda, M.D.,1 Taiji Tohyama, M.D., Hiroshi Kotegawa, M.D., Yoh Kojima, M.D., Fumiki Kushihata, M.D., Jota Watanabe, M.D., and Nobuaki Kobayashi, M.D. Department of Organ Regulatory Surgery, Ehime Graduate School of Medicine, Ehime, Japan Submitted for publication August 28, 2008
Background. The protective effect of heat preconditioning has been ascribed to the induction of heat shock proteins (HSP) in the liver. We detected an increase in Bcl-xL expression prior to HSP 70 expression in the rat liver after heat preconditioning. The net effect of overexpression of human Bcl-xL with a recombinant adenovector was estimated in a partial ischemia/ reperfusion model of the mouse liver. Materials and Methods. The time courses of the expression of HSP, Bcl-xL, Bcl-2, Bax, and Bag-1 in the SD rat liver after heat preconditioning were studied by Western blotting. The localizations of Bcl-xL, Bcl2, and Bax at 6 h after preconditioning were examined by immunostaining. The expression of Bcl-xL in the C57/BL mouse liver after intravenous injection of the recombinant adenovector was assessed by Western blotting and immunostaining. The protective effect of overexpression of Bcl-xL was estimated in a 60-min partial ischemia/reperfusion model of the mouse liver. Results. The expression of Bcl-xL peaked 12 h after heat preconditioning. The overexpression of Bcl-xL decreased enzyme release, histological cell injury, and the number of TUNEL-positive cells. Conclusion. Transfer of the human Bcl-xL gene to the liver had a protective effect against ischemia/reperfusion injury in a mouse model. Ó 2009 Elsevier Inc. All rights reserved.
Key Words: heat preconditioning; murine liver; HepG2; human Bcl-xL; gene transfer; ischemia/reperfusion injury.
1 To whom correspondence and reprint requests should be addressed at Department of Organ Regulatory Surgery, Ehime University Graduate School of Medicine, Shitsukawa, Toon City, Ehime, 791-0295, Japan. E-mail: [email protected].
INTRODUCTION
Many reports on heat preconditioning in animal models have shown that pre-exposure to hyperthermia increases the tolerance to ischemia/reperfusion injury of the liver [1]. The protective effect of heat preconditioning has been chiefly ascribed to the induction of heat shock protein 70 (HSP 70) [2] and heme oxygenase (HO-1) [3], but detailed mechanisms responsible for cytoprotection are not well elucidated. We studied the protective effect of heat preconditioning in a rat liver transplantation model and reported that HPS 70 was induced in the hepatocytes around the central veins as well as in the sinusoidal endothelial cells (SEC). The proportions of terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL)-positive hepatocytes and SEC of the heat shock group at 3 h after transplant reperfusion were significantly lower than those of the control, and electron micrographs revealed the reduction of apoptosis of SEC [4]. In the same transplant model, the serum levels of interleukin-6 and interleukin-10 were significantly lower in the heat preconditioning group than in the control group [5]. The Bcl-2 family includes both anti-apoptotic and pro-apoptotic proteins. We examined the time course of the expression of Bcl-xL, Bcl-2, Bax, and Bag-1 by Western blotting in relation to HSP 70 expression in the same rat heat preconditioning model; the localizations of Bcl-xL, Bcl-2, and Bax proteins were then studied by immunostaining. Bcl-xL was induced in the hepatocytes around the central veins 12 h before HSP 70 induction, while Bcl-2 was not induced in the hepatocytes and there were no changes in the expression of Bax and Bag-1. Bilbao reported in 1999 that an adenovector containing the human Bcl-2 gene was transferred to the mouse liver, which had
e107
0022-4804/09 $36.00 Ó 2009 Elsevier Inc. All rights reserved.
e108
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
protective effect against ischemia/reperfusion injury [6] and organ preservation injury [7]. However, Oshiro reported that an overexpression of antiapoptotic protein Bcl-2 with an adenovector of human Bcl-2 paradoxically exerted a proapoptotic effect in a hepatic ischemia/reperfusion model of rats [8]. We assumed that the specific gene to be transferred to the hepatocytes should be Bcl-xL, because there was no expression of Bcl-2 in the hepatocytes from the beginning and Bcl-2 was not induced in the hepatocytes by heat preconditioning. We amplified the total length of the mRNA of human Bcl-xL by reverse transcription-polymerase chain reaction (RT-PCR) and produced an adenovector of Bcl-xL. The protective effect of Bcl-xL gene transfer was evaluated with RCN-H4 rat colon cancer cells and HepG2 human hepatoblastoma cells in vitro and in a partial ischemia/reperfusion model of mouse liver in vivo. MATERIALS AND METHODS Heat Preconditioning of Rats Male Sprague-Dawley rats weighing 280 to 330 g were purchased from Charles River (Kanagawa, Japan). The rats were kept in the Department of Biological Resources, Integrated Center for Science Shigenobu Station, and the experiments followed the guidelines for animal experiments of Ehime University. Heat shock preconditioning was applied as described elsewhere [4]. In brief, the rats of the heat shock (HS) group (n ¼ 4) were wrapped with a vinyl bag under anesthesia and immersed in hot water at 43 C to raise their body temperature to 42–42.5 C with monitoring by a digital thermometer in the rectum for 15 min. The rats of the control (C) group (n ¼ 4) received only anesthesia.
Western Blot Analysis of Heat Shock Protein and Bcl-2 Family Members After Heat Preconditioning The liver tissue samples were collected at 3, 6, 12, 24, 48, and 72 h after heat preconditioning and stored at –80 C. Frozen liver tissues were homogenized in lysis buffer (10 mM Tris-HCl pH 7.5, 250 mM sucrose, 1 mM phenylmethylsulphonyl fluoride, 10 mg/mL aprotinin, 10 mg/mL pepstatin) and the protein content of the supernatants was measured using a commercial bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Twenty micrograms of proteins was separated on a 10% polyacrylamide gel with 0.1% sodium dodecyl sulfate and transferred to polyvinylidene fluoride membranes (Pall, East Hills, NY) for HSP analysis. One hundred micrograms of proteins were used for Bcl-xL, Bcl-2, Bax, or Bag-1. The membranes were blocked with 5% skim milk in Tris-buffered saline (20 mM Tris, 500 mM NaCl, pH 7.5) at 4 C overnight, and incubated with the primary antibody at room temperature for 2 h. The antibodies used in this experiment were as follows: anti-Bcl-xL mouse monoclonal antibody, antiBcl-2 mouse monoclonal antibody (Transduction Laboratories, Lexington, KY), anti-Bax rabbit polyclonal antibody (Oncogene Research Products, Cambridge, MA), anti-Bag-1 mouse monoclonal antibody (Mbl, Nagoya, Japan), and anti-HSP70 mouse monoclonal antibody (Stress Gen Biotechnologies Corp., Victoria, BC, Canada). The proteins were visualized using 5-bromo-4-chloro-3-indolyl phosphate-nitroblue tetrazolium with an ECF Western blotting kit (Amersham Pharmacia Biotech, Bucks, UK) and photographed by Fluor Imager SI (Amersham Pharmacia Biotech). The intensity of fluorescence was analyzed by ImageQuant (Amersham Pharmacia Biotech) and
expressed as fluorescence intensity index corrected by the positive control in the same gel.
Immunohistochemical Staining of Bcl-xL, Bcl-2, and Bax The rat livers sampled 6 h after heat preconditioning and the controls sampled at 6 h after anesthesia were perfused and fixed with 4% paraformaldehyde in phosphate-buffered saline at 4 C for 72 h. The 4-mm-thick sections were stained by the avidin-biotin horseradish peroxidase method using a Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, CA). The antibodies for Bcl-xL, Bcl-2, and Bax were used as the primary antibodies, and mouse IgG1 (DAKO, Glostrup, Denmark), mouse IgG2 (Dako) and normal rabbit serum (Vector Laboratories), respectively, were used as negative controls. The sections were incubated at 4 C overnight and visualized using diaminobenzidine.
Preparation of Adenovector, AxCAhBcl-xL, for Bcl-xL Gene Transfer The cosmid included in the Takara adenovirus vector expression kit (Takara Bio Inc., Shiga, Japan) is constructed from adenovirus type 5, deleted of E1A, E1B, and E3 lesions, and CAG promoter. The total RNA was extracted from HepG2 human hepatoblastoma cells and RT-PCR was performed with the primers at both ends of the cDNA of Bcl-xL (forward primer: 5’-ATGCCTCAGAGCAACCGGGA; reverse primer: 5’-TCATTTCCGACTGAAGAGTG). The target 702-bp band was cut out from an agarose gel and purified with a QIA Quick gel extraction kit (Qiagen, Hilden, Germany) and the sequence was confirmed with an ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA). The DNA was ligated into the SmaI site of the cosmid vector, pAxCAwtit. It was packaged into lambda-phage with Gigapack III XL packaging extract (Stratagene, Cedar Creek, TX) and transformed into DH5-a Escherichia coli (E. coli). The bacteria were cultured and the cosmid was prepared with a QIA filter plasmid midi kit (Qiagen). The inserted DNA length was determined with ClaI endonuclease and the sequence was confirmed by an ABI 310 sequencer (forward primer: 5’-TCTAGAGCCTCTGCTAACCATG; reverse primer: 5’-AGCCACCACCTTCTGATAGGCA). The E. coli was cultured in a large quantity and the sequence was confirmed for the second time. After preparation with endonuclease, the cosmid was transfected to 293 cells by a lipofection method with TransIT-LT1 (Takara Bio Inc.). After overnight incubation, these 293 cells were collected and transferred to 96-well plates in undiluted solution, 103 diluted, and 1003 diluted solution. The cells were collected from the wells in which all the cells were degenerated, and subjected to freeze and thaw and then centrifuged. The supernatant was collected as the primary virus solution. The infection with the virus was repeated to prepare a large amount of virus solutions. The absence of replication-competent adenovirus (RCA) was confirmed in the second and fourth virus solutions by PCR using E1A-F (CTGATCGAAGAGGTACTGGCTGATAATCTTCCACC) and E1A-R (TTATGGCCTGGG GCGTTTACAGCTCAAGTCCAAAG) with HeLa cells. The adenovectors were prepared with a BD Adeno-X purification kit (BD Biosciences, San Jose, CA) and stored at –80 C. The titer of the virus solution was determined before experimental use. The adenovector of LacZ (AxCAlacZ) was prepared with pAxCAiLacZ (Takara Bio Inc.).
Western Blot Analysis for In Vitro Bcl-xL Expression RCN-H4 rat colon cancer cells, which do not express Bcl-xL, were cultured in RPMI 1640 medium containing 10% fetal calf serum in a CO2 incubator. 2 3 106 cells of RCN-H4 were infected with 1, 10, and 50 MOI of AxCAhBcl-xL and rinsed with phosphate buffered saline (PBS) after 24 h incubation. After 2 d, cells were subjected to Western blotting with anti-human Bcl-xL monoclonal antibody (Transduction Laboratories) as described above. The samples at 1,
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e109
FIG. 1. (A) Time course of the expression of HSP 70 and Bcl-2 family members in the rat liver after heat preconditioning. The liver samples were subjected to Western blotting after the elevation of body temperature to 42 C for 15 min. The expression of HSP peaked 24 h after heat shock. The expression of Bcl-xL peaked 12 h after heat preconditioning, while there were no obvious changes in Bcl-2, Bax, and Bag-1 levels. (B) Analysis of Bcl-xL and HSP expression after heat shock by Fluor Imager SI. Bcl-xL protein expression showed a significant increase from 6 to 24 h after heat shock and the peak was earlier than that of HSP expression. Fluorescence intensity index ¼ study sample/positive control sample. Values are represented by mean 6 SD of 4 independent experiments. *P < 0.05 versus control. 2, 3, and 5 d after 10 MOI infection of AxCAhBcl-xL were determined by Western blotting.
Real-Time Polymerase Chain Reaction for Bcl-xL Expression RCN-H4 cells were infected with 0.1, 1, 10, and 50 MOI of AxCAhBcl-xL and the total RNA was extracted with TRIZOL (Wako Pure Chemical Industries, Osaka, Japan). The reverse transcription reaction was performed with a first strand cDNA synthesis kit (Applied Biosystems) and PCR was performed with primers of a Taq Man Gene Expression Assays Hs 00169141-mI and ABI 7300 (Applied Biosystems). GAPDH was used as a control with Taq Man Rodent GAPDH Control Reagent VIC (Applied Biosystems). The data were calibrated with GAPDH and analyzed with SDS system software (Applied Biosystems). The levels of the mRNA were determined at 1, 3, and 5 d after 50 MOI infection of AxCAhBcl-xL.
Effect of Bcl-xL Gene Transfer to RCN-H4 Cells and HepG2 Cells Cisplatin was used as the inducer of apoptosis. 2 3 103 cells in RPMI 1640 medium containing 5% fetal bovine serum were transferred to each well of a 96-well plate. Cisplatin was added to RCN-H4 cells at the final concentrations of 0.01, 0.1, 0.5, 1, and 5 mg/mL, and to
HepG2 cells at 0.1, 1, 5, 10, and 50 mg/mL. The survival was determined with the Premix WST-1 Cell Proliferation Assay System (Takara Bio Inc., Shiga, Japan). The absorbance of the formazan was determined with a model 550 microplate reader (Bio-Rad Laboratories, Hercules, CA). The concentrations of cisplatin were selected to lower the cell survival rate to less than 50% (1 mg/mLl for RCN-H4 and 2 mg/mL for HepG2). The protective effects of AxCAhBcl-xL at 10 MOI were compared with those of AxCAlacZ.
Changes in Caspase 3 Levels with Bcl-xL Gene Transfer The changes in caspase 3 levels were studied with RCN-H4 cells, which do not express Bcl-xL, to evaluate the net effect of gene transfer of Bcl-xL. The activity of caspase 3 was determined with a commercial caspase 3 colorimetric activity assay kit (Chemicon, Temecula, CA). RCN-H4 cells were transferred to RPMI 1640 medium containing 5% fetal bovine serum and infected with 10 MOI of AxCAhBcl-xL or AxCAlacZ. Cisplatin was added at the final concentration of 1 mg/mL 3 d later. The cells were collected after 48 h incubation and treated with 200 mL of lysis buffer for 1 h. The concentration of the protein in the supernatant was determined with a Bio-Rad DC protein assay (Bio-Rad Laboratories). Thirty microliters (100 mg) of each sample were added to assay buffer and caspase 3 substrate and incubated for 2 h at 37 C. The absorbance was measured at a wave length of 405 nm.
e110
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
FIG. 2. Localization of the induced Bcl-xL at 6 h after heat preconditioning. The liver samples 6 h after the elevation of body temperature up to 42 C for 15 min were stained with anti-Bcl-xL. In the anesthesia-only group, the nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bcl-xL all over the lobule. The lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were also stained, but the sinusoidal cells were not stained. Bcl-xL was induced in the cytoplasm of the hepatocytes in zone 3 of Rappaport’s acinus (around the central vein) 6 h after heat preconditioning. The length of the scale bar is 100 mm. C: central vein. P: portal vein.
In Vivo Gene Expression in the Mouse liver with AxCAhBcl-xL Male C57BL/6 mice (Japan SLC Inc, Hamamatsu, Japan) were kept in the Department of Biological Resources, Integrated Center for Science Shigenobu Station and the experiments followed the guideline for animal experiments of Ehime University. AxCAhBcl-xL (0.5 3 108 PFU and 1 3 109 PFU) and AxCAlacZ (13 109 PFU) in 300 mL of PBS were injected into the tail vein of mice. The livers were collected 3 d later and immunostaining and Western blotting were performed as described above.
Protective Effect of In Vivo Bcl-xL Gene Transfer Against Ischemia/Reperfusion Liver Injury To evaluate the toxicity of the infection of adenovectors, 1 3 109 PFU of AxCAhBcl-xL and AxCAlacZ were injected into the tail vein of the mice. The levels of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) 3 d after infection were determined with a C-2 test (Wako Pure Chemical Industries, Osaka, Japan). Three days before the surgical procedure, 1 3 109 PFU of AxCAhBcl-xL was injected into the tail vein for the Bcl-xL group
FIG. 3. Immunostaing of the rat liver with anti-Bcl-2 and anti-Bax antibody. The liver samples 6 h after heat shock were stained with antiBcl-2 and anti-Bax, and compared with the anesthesia-only group. The hepatocytes were not stained with anti-Bcl-2 in the anesthesia only group, while the lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were stained and the sinusoidal cells in zone 1 of Rappaport’s acinus were stained. Bcl-2 was not induced in the hepatocytes 6 h after heat shock. The nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bax and there were no obvious changes after heat shock. The length of the scale bar is 50 mm. C: central vein. P: portal vein.
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e111
FIG. 4. Bcl-xL expression in RCN-H4 cells. (A) RCN-H4 cells were infected with AxCAhBcl-xL at the concentration of 1, 10, and 50 MOI and were subjected to Western blotting 2 d later. Bcl-xL expression was detected at 10 and 50 MOI. (B) Time course of Bcl-xL expression after infection of AxCAhBcl-xL (10 MOI). The level of Bcl-xL protein peaked at day 3. (C) Real time PCR by relative ratio of Bcl-xL mRNA expression in RCN-H4 after infection of AxCAhBcl-xL (10 MOI). The Bcl-xL mRNA level was highest at day 3, same as the Bcl-xL protein expression. (n ¼ 6) and the same amount of AxCAlacZ for the lacZ group (n ¼ 6). The control mice (n ¼ 6) were injected with 300 mL of PBS. Under ether anesthesia, the left lateral lobe of the liver was exposed and a microvascular clamp was applied on the vascular pedicle to obliterate the hepatic artery and the portal vein, resulting in approximately 37% ischemia of the total liver. The clamp was removed 60 min later under anesthesia and the peripheral blood and the liver samples were collected at 6 h after reperfusion. Serum AST and AST levels were then determined. The liver samples were fixed with 10% formalin and stained with hematoxylin-eosin (HE). The grades of the histological liver injury were estimated at 100 adjacent points in 1-mm2 fields under a 200-power microscope by blinded pathologists based on the following criteria: grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders,
and mild to moderate neutrophil infiltration; and grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe neutrophil infiltration. The extent of the liver injury was expressed as a percentage of the grades.
TUNEL Staining of the Liver TUNEL staining was performed with an apoptosis in situ detection kit (Wako Pure Chemical Industries) to estimate the DNA damage after ischemia/reperfusion. The 4-mm sections of the liver samples were deparaffined and incubated with 10 mg/mL of proteinase K for 10 min. The sections were incubated with 100 mL of TdT reaction solution and the endogenous peroxidase was blocked with 3% H2O2, and then incubated with 100 mL of POD-conjugated antibody solution for 10 min at 37 C. The sections were treated with 100 ml of 3,3’-diaminobenzidine
FIG. 5. The survival rates of RCN-H4 cells and HepG2 cells against cisplatin. (A) The survival rates of RCN-H4 cells at different concentrations of cisplatin 48 h after administration were estimated with WST1 assay. The survival rate at the concentration of 1 mg/mL of cisplatin was 44.4 6 14.5%. (B)The effect of the Bcl-xL gene transfer to RCN-H4 cells at the concentration of 1 mg/mL of cisplatin. The survival rate was significantly increased in the Bcl-xL group (*P < 0.05). (C) The survival rates of HepG2 cells at different concentrations of cisplatin. HepG2 cells survived 58% at 1 mg/mL of cisplatin and 3% at 5 mg/mL. (D) The effect of the Bcl-xL gene transfer to HepG2 cells at the concentration of 2 mg/mL. The survival rate was significantly increased in the Bcl-xL group (*P < 0.05).
e112
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
Bcl-2, Bax, and Bag-1 levels (Fig. 1A). Bcl-xL protein expression showed a significant increase from 6 to 24 h and the peak was earlier than that of HSP expression (Fig. 1B).
Localization of the Induced Bcl-xL 6 Hours After Heat Preconditioning
FIG. 6. The changes in caspase three levels with Bcl-xL gene transfer. The Bcl-xL gene was transferred to RCN-H4 cells to evaluate the net effect of gene transfer. Caspase 3 activity in RCN-H4 cells was measured with a caspase-3 colorimetric activity assay kit 48 h after Cisplatin administration at the concentration of 1 mg/ml. The activity was significantly decreased in Bcl-xL group (n ¼ 4, *P < 0.05). (DAB) solution and counterstained with the counterstaining reagent. The number of the cells was counted in 50 fields under a 400-power microscope and the ratio of the TUNEL positive cells was calculated. Each result is expressed as a mean values 6 SD.
Statistical Analysis Statistical analysis was performed with the Mann-Whitney’s U test to evaluate differences between the control and the heat shock groups in the Western blot analysis. Statistical analysis was performed with the Steel-Dwass test to evaluate differences among the experimental groups. Values of P < 0.05 were considered statistically significant.
The livers were stained with the anti Bcl-xL antibody. In the anesthesia only group, the nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bcl-xL all over the lobule. The lobular bile duct cells, endothelial cells of the portal vein, and hepatic arterial cells were also stained, but the sinusoidal cells were not stained. Bcl-xL was induced in the cytoplasm of the hepatocytes in zone 3 of Rappaport’s acinus (around the central vein) 6 h after heat preconditioning (Fig. 2). The hepatocytes were not stained with antiBcl-2 in the anesthesia only group, while the lobular bile duct cells, endothelial cells of the portal vein, hepatic arterial cells, and the sinusoidal cells in zone 1 of Rappaport’s acinus were stained. Bcl-2 was not induced in the hepatocytes 6 h after heat shock. The nuclei and cytoplasm of the hepatocytes were diffusely stained with anti-Bax and there were no obvious changes after heat shock (Fig. 3).
RESULTS Time Course of the Expression of HSP and Bcl-2 Family Members in the Rat Liver After Heat Preconditioning
Expression of HSP was detected slightly in the livers of the untreated rats. The HSP expression peaked 24 h after heat shock. The expression of Bcl-xL increased at 6 h, peaked at 12 h, and then returned to the initial level at 72 h, while the expression level of HSP was still increased at 72 h. There were no obvious changes in
Bcl-xL Expression in RCN-H4 Cells with AxCAhBcl-xL
The RCN-H4 cells were infected with AxCAhBcl-xL. The human Bcl-xL protein was expressed in the RCNH4 cells at a low level with 1 MOI and was evidently expressed with 50 MOI of AxCAhBcl-xL (Fig. 4A). The level of the Bcl-xL protein was highest at day 3 (Fig. 4B). The level of mRNA was also highest at day 3, shown with real-time PCR (Fig. 4C).
FIG. 7. Immunohistochemical staining of the liver of C57BL/6 mice with anti-Bcl-xL antibody 72 h after intravenous administration of adenovectors. (A) Bcl-xL was diffusedly expressed in the hepatocytes by AxCAhBcl-xL (13109 PFU). (B) The hepatocytes around the central vein were slightly stained by the administration of AxCAlacZ (1 3 109 PFU). The length of the scale bar is 50 mm.
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e113
xL and a clear band with 1 3 109 PFU. Very dim bands were seen in the saline lane and the AxCAlacZ lane, which represented the endogenous expression of mouse Bcl-xL (Fig. 8). FIG. 8. Western blotting of the Bcl-xL protein expression in the mouse liver. Mice were administered with 0.5 3 108 PFU, 1 3 109 PFU of AxCAhBcl-xL, or 1 3 109 PFU of AxCALacZ or saline intravenously. The levels of Bcl-xL expression were dependent on the amount of PFU 3 d after the infection of AxCAhBcl-xL. Expression of Bcl-xL was slightly detected in the saline group and the LacZ group, indicating the endogenous murine Bcl-xL protein expression.
Biological Activities of AxCAhBcl-xL In Vitro
Because the survival rate of the RCN-H4 cells was 44% with 1 mg/mL of cisplatin (Fig. 5A), the protective effect of AxCAhBcl-xL was evaluated at this concentration. The survival rate of the Bcl-xL group was significantly higher than those of the lacZ group and the control group (Fig. 5B). Because the survival rate of HepG2 cells was 58% with 1 mg/mL of cisplatin and 3% with 5 mg/mL (Fig. 5C), the protective effect was estimated at the concentration of 2 mg/mL. The survival rate of the HepG2 cells, which express endogenous human Bcl-xL, was 5% in the control group, 8% in the lacZ group, and 29% in the Bcl-xL group (Fig. 5D). The relative activity of the caspase 3 in RCN-H4 cells treated with 1 mg/ml of cisplatin was 8.2 6 1.2, compared with no cisplatin administration. The relative activity of the lacZ group was 6.9 6 1.5, but the relative caspase 3 activity of the Bcl-xL group was 2.6 6 0.4, which was significantly lower than the other groups (Fig. 6).
Bcl-xL Expression in the Mouse Liver
The livers of the mice 3 d after intravenous injection of AxCAhBcl-xL were subjected to immunostaining. Most of the hepatocytes were stained in the cytoplasm (Fig. 7). The Western blotting of the homogenized liver showed a faint band with 0.5 3 108 PFU of AxCAhBcl-
Protective Effects of Bcl-xL Gene Transfer In Vivo
The influence of the adenovector-infection on the hepatocytes was evaluated by the measurement of the serum AST and ALT levels 3 d after infection. The levels of AST and ALT were almost equal among the control, lacZ, and Bcl-xL groups (data not shown). The AST level 6 h after the ischemia/reperfusion of the Bcl-xL group was significantly lower than those of the control and lacZ groups (Fig. 9A), as well as the ALT level (Fig. 9B). The hepatocytes of the control and lacZ groups were evidently degraded with HE staining but the change in the Bcl-xL group was mild (Fig. 10). The ratio of grade-3 cell injury was significantly low in the Bcl-xL group (Table 1). The ratio of the TUNEL-positive cells was 46.4 6 8.7% with the control group and 45.9 6 13.6% in the lacZ group, while the ratio was 16.7 6 1.5% in the Bcl-xL group (Fig. 11). DISCUSSION
The late protective effect of liver preconditioning has been ascribed to the synthesis of multiple stress-response proteins, including HSP 70, HSP 27, and HSP 32/heme oxygenase-1. In our rat transplant model, the numbers of the apoptotic hepatocytes and SECs significantly decreased by heat preconditioning, suggesting some anti-apoptotic effect of heat preconditioning; however, there have been few reports on the changes in Bcl family members after liver preconditioning. Yadav et al. reported that Bcl-2 levels were similar in control and 90min ischemia-preconditioned livers of mice at 0, 1, and 3 h after reperfusion [9]. Doi et al. applied 15 min warm ischemia 48 h before 70% hepatectomy of rat livers and reported that the Bcl-xL level in the liver of the ischemia group was significantly higher than that in the
FIG. 9. Effects of Bcl-xL gene transfer to the liver. Mice were administered with 13109 PFU of AxCAhBcl-xL, AxCALacZ, or saline 3 d before induction of partial hepatic ischemia (37% of the total liver volume) for 60 min. Serum AST (A) and ALT (B) levels were measured 6 h after reperfusion (n ¼ 6). AST and ALT levels were significantly lower in Bcl-xL group. (n ¼ 6, *P < 0.05).
e114
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
FIG. 10. HE staining of the ischemic liver 6 h after reperfusion. (A) Saline group, (B) LacZ group, and (C) Bcl-xL group. The mouse livers treated with saline or LacZ adenovector showed pericentral necrosis, increased eosinophilia, and vacuolization (A), (B). These morphological changes are markedly reduced by Bcl-xL gene transfer (C).
nonischemia group 12 h after the hepatectomy [10]. Hu et al. studied the expression of C-jun and Bcl-xL after normothermic liver ischemic preconditioning in rats. The expressions of Bcl-xL mRNA and protein in the ischemic preconditioning group were significantly increased at 3, 6, and 20 h compared with those in both the sham operation group and the ischemia reperfusion group [11]. However, these reports involved cases of ischemic preconditioning; there has been no systematic report on the changes of expression of Bcl family members after heat preconditioning. The protein level of Bcl-xL peaked at 12 h and HSP 70 peaked at 24 h after preconditioning, while there were no changes in the levels of Bcl-2, Bax, and Bag-1. The liver samples 6 h after preconditioning were subjected to immunostaining because real-time PCR revealed a decline in the mRNA level of Bcl-xL 12 h after preconditioning (data not shown). Interestingly, Bcl-xL was induced in the hepatocytes around the central veins, which was the same area as the induced HSP 70 protein [4]. Several reports on Bcl-2 gene transfer using adenovectors to the liver have been published [6, 7, 8, 12, 13] as well as to the brain [14], the heart [15], the lung [16] and the kidney [17]. Some reports applied the HVJ-liposome as a vector of the Bcl-2 gene instead of using an adenovector [18, 19]. However, reports on the in vivo gene transfer of Bcl-xL are very few. Huang et al. reported in 2003 that Bcl-xL gene transfer pro-
tected the heart against ischemia/reperfusion injury in a rat model [20]. They also reported that Bcl-xL gene transfer prolonged cardiac cold preservation time in rats [21]. Chien et al. reported that adeno-mediated Bcl-xL gene transfer significantly improved the renal dysfunction induced by ischemia/reperfusion [22]. However, there is presently no available report on Bcl-xL gene transfer to the liver. We developed an adenovector of the human Bcl-xL gene and verified its biological activities with RCN-H4 rat colon carcinoma cells, which do not express human Bcl-xL, and with
TABLE 1 Histological Grade 6 Hours After Reperfusion
Saline LacZ Bcl-xL
Grade 0
Grade 1
Grade 2
Grade 3
1.06 6 1.1% 0.5 6 0.7% 3.1 6 4.5%
26.1 6 9.6% 28.3 6 16.6% 56.6 6 9.1%
32.7 6 3.2% 26.4 6 10.4% 22.9 6 8.5%
40.1 6 10.6% 44.7 6 14.0% 17.2 6 6.7%*
Notes. The proportion of each histological grade determined by a point-counting method with an ordinal scale. Grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders, and mild to moderate PMN infiltration; grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe PMN infiltration. The ratio of grade 3 was significantly low in Bcl-xL group (* P < 0.05).
HONDA ET AL.: BCL-XL GENE TRANSFER TO THE MOUSE LIVER
e115
turbances in an isolated perfusion model of the rat liver. Hepatology 2000;31:407. 4. Matsumoto K, Honda K, Kobayashi N. Protective effect of heat preconditioning of rat liver graft resulting in improved transplant survival. Transplantation 2001;15(71):862. 5. Watanabe J, Kushihata F, Matsumoto K, et al. Downregulation of cytokine release by heat preconditioning of livers used for transplantation in rats. Dig Dis Sci 2005; 50:1823. FIG. 11. The liver samples 6 h after reperfusion were subjected to a TUNEL assay. The ratio of TUNEL positive cells was significantly lower in the Bcl-xL group than that of the other groups. (n ¼ 6, *P < 0.05).
HepG2 cells, from which we obtained the cDNA of human Bcl-xL. In the animal study, the expression of the human Bcl-xL in the mouse liver was confirmed by immunostaining and Western blot. In the 60-min ischemia/reperfusion model of the 37% mouse liver, the serum levels of AST and ALT were significantly lower in the Bcl-xL group and the histological grades of the Bcl-xL group were lower than those of the lacZ group and the control group. The ratio of the TUNEL-positive cells of the Bcl-xL group was lower, which suggested that the Bcl-xL gene transfer decreased the DNA damage of the hepatocytes. From these results, we concluded that the Bcl-xL gene transfer to the liver had a protective effect against ischemia/reperfusion injury. We are investigating the intracellular consequences of Bcl-xL gene transfer in hepatocytes, including heat shock proteins. Takehara et al. generated hepatocyte-specific Bcl-xL deficient mice using the Cre-loxP system and analyzed the consequences of long-term apoptosis in hepatocytes. In vivo hepatocyte-specific disruption of Bcl-xL resulted in spontaneous apoptosis of hepatocytes for more than 6 mo [23]. They concluded that their study identified BclxL as a critical apoptosis antagonist in hepatocytes. Temporary overexpression of Bcl-xL with this adenovector might be further applicable to general liver surgery and various liver diseases. ACKNOWLEDGMENTS This work was partially supported by Grants-in-Aid for Scientific Research from the Society for the Promotion of Science, Japan.
REFERENCES 1. Carini R, Albano E. Recent insights on the mechanisms of liver preconditioning. Gastroenterology 2003;125:1480–91. 2. Saad S, Kanai M, Awane M, et al. Protective effect of heat shock pretreatment with heat shock protein induction before hepatic warm ischemic injury caused by Pringle’s maneuver. Surgery 1995;118:510. 3. Terajima H, Enders G, Thiaener A, et al. Impact of hyperthermic preconditioning on postischemic hepatic microcirculatory dis-
6. Bilbao G, Contreras JL, Eckhoff DE, et al. Reduction of ischemiareperfusion injury of the liver by in vivo adenovirus-mediated gene transfer of the antiapoptotic Bcl-2 gene. Ann Surg 1999; 230:185. 7. Bilbao G, Contreras JL, Gomez-Navarro J, et al. Genetic modification of liver grafts with an adenoviral vector encoding the Bcl-2 gene improves organ preservation. Transplantation 1999; 27(67):775. 8. Oshiro T, Shiraishi M, Muto Y. Adenovirus mediated gene transfer of antiapoptotic protein in hepatic ischemia-reperfusion injury: the paradoxical effect of Bcl-2 expression in the reperfused liver. J Surg Res 2002;103:30. 9. Kamimukai N, Togo S, Hasegawa S, et al. Expression of Bcl-2 family reduces apoptotic hepatocytes after excessive hepatectomy. Eur Surg Res 2001;33:8. 10. Takehara T, Liu X, Fujimoto J, et al. Expression and role of Bcl-xL in human hepatocellular carcinomas. Hepatology 2001; 34:55. 11. Watanabe J, Kushihata F, Honda K, et al. Prognostic significance of Bcl-xL in human hepatocellular carcinoma. Surgery 2004;135:604. 12. Rentsh M, Kienle K, Muller T, et al. Adenoviral bcl-2 transfer improves survival and early graft function after ischemia and reperfusion in rat liver transplantation. Transplantation 2005; 27(80):1461. 13. Takushi Y, Shiraishi M, Nozato E, et al. Expression of anti-apoptotic protein, Bcl-2, in liver regeneration after a partial hepatectomy. J Sug Res 2006;134:93. 14. Simazaki K, Urabe M, Monahan J, et al. Adeno-associated virus vector-mediated bcl-2 gene transfer into post-ischemic gerbil braion in vivo: Prospects for gene therapy of ischemia-induced neuronal death. Gene Ther 2000;7:1244. 15. Chatterjee S, Stewart AS, Bish LT, et al. Viral gene transfer of the antiapoptotic factor Bcl-2 protects against chronic postischemic heart failure. Circulation 2002;24; 106(12 Suppl. 1):1212. 16. Cooke DT, Hoyt EG, Robbins RC. Overexpression of human Bcl2 in syngenic rat donor lungs preserves posttransplant function and reduces intragraft caspase activity and interleukin-1beta production. Transplantation 2005;15(79):762. 17. Chiang-Ting C, Tzu-Ching C, Ching-Yi T, et al. Adenovirus-mediated bcl-2 gene transfer inhibits renal ischemia/reperfusion induced tubular oxidative stress and apoptosis. Am J Transplant 2005;5:1194. 18. Yanada S, Saitoh Y, Kaneda Y, Miwa N. Cytoprotection by bcl-2 gene transfer against ischemic liver injuries together with repressed lipid peroxidation and increased ascorbic acid in livers and serum. J Cell Biochem 2004;15(93):857. 19. Yanada S, Sasaki M, Takayama S, et al. Hemagglutinating virus of Japan-artificial viral envelope liposome-mediated cotransfer of bag-1 and bcl-2 genes protects hepatic cells against ischemic injury through BAG-1-assisted preferential enhancement of bcl-2 protein expression. Hum Gene Ther 2005;16:627.
e116
JOURNAL OF SURGICAL RESEARCH: VOL. 157, NO. 1, NOVEMBER 2009
20. Huang J, Ito Y, Morikawa M, et al. Bcl-xL gene transfer protects the heart against ischemia/reperfusion injury. Biochem Bioph Res Co 2003;7(311):64. 21. Huang J, Nakamura K, Ito Y, et al. Bcl-xL gene transfer inhibits Bax translocation and prolongs cardiac preservation time in rats. Circulation 2005;5(112):76.
22. Chien CT, Shyue SK, Lai MK. Bcl-xL augmentation potentially reduces ischemia/reperfusion induced proximal and distal tubular apoptosis and autophagy. Transplantation 2007;84:1183. 23. Takehara T, Tatsumi T, Suzuki T, et al. Hepatocyte-specific disruption of Bcl-xL leads to continuous hepatocyte apoptosis and liver fibrotic responses. Gastroenterology 2004;127:1189.