Protective Effect of Baicalin Against Carbon Tetrachloride–Induced Acute Hepatic Injury in Mice

Journal of Pharmacological Sciences

J Pharmacol Sci 106, 136 – 143 (2008)1

©2008 The Japanese Pharmacological Society

Full Paper

Protective Effect of Baicalin Against Carbon Tetrachloride–Induced Acute Hepatic Injury in Mice Sang-Won Park1, Chan-Ho Lee1, Yeong Shik Kim2, Sam Sik Kang2, Su Jin Jeon3, Kun Ho Son3, and Sun-Mee Lee1,* 1

College of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon-si, Gyeonggi-do 440-746, Korea College of Pharmacy, Seoul National University, Seoul 110-460, Korea 3 Department of Food Science and Nutrition, Andong National University, Gyeongbuk 760-749, Korea 2

Received August 23, 2007; Accepted November 21, 2007

Abstract. This study examined the effects of baicalin, a bioactive flavonoid isolated from Scutellariae Radix, on carbon tetrachloride (CCl4)-induced liver injury. Mice were treated intraperitoneally with 0.5 ml / kg CCl4 and different groups of animals received 25, 50, 100, and 200 mg / kg baicalin. At 24 h after the CCl4 treatment, the level of serum aminotransferases and lipid peroxidation was significantly elevated, whereas the hepatic glutathione content was decreased. These changes were attenuated by baicalin. The histological studies showed that baicalin inhibited the portal inflammation, centrizonal necrosis, and Kupffer cell hyperplasia, which are the three most common characteristics of CCl4-induced liver damage. The serum level and mRNA expression of tumor necrosis factor-α were markedly increased by the CCl4 treatment but suppressed by baicalin. The mRNA and protein expression levels of inducible nitric oxide synthase and heme oxygenase-1 increased significantly at 24 h after the CCl4 treatment. Baicalin attenuated the increase in the protein and gene expression of inducible nitric oxide synthase but augmented the increase in those of heme oxygenase-1. These findings suggest that baicalin protects hepatocytes from the oxidative damage caused by CCl4, and this protection is likely due to the induction of HO-1 expression and the inhibition of the proinflammatory mediators. Keywords: baicalin, carbon tetrachloride (CCl4), heme oxygenase-1, oxidative stress, proinflammatory mediator inflammatory agent and smooth muscle relaxant, and used as a component of some hepatoprotective herb mixtures in China, Japan, and Korea (2). Baicalin is the major active constituent of the isolated root of Scutellaria baicalensis GEORGI that scavenges reactive oxygen species (ROS) and has an anti-inflammatory activity (3). A recent report suggested that baicalin suppresses the hemin-nitrite-H2O2–induced liver injury caused by inhibitory oxidation and nitration in HepG2 cells (4) and inhibits the activation of redox-sensitive nuclear factor-κB (NF-κB) in kidney tissue from old rats (5). However, there is limited information on the in vivo hepatoprotective effects of baicalin. Carbon tetrachloride (CCl4) is commonly used as a chemical inducer of experimental liver injury (6). It has been suggested that the hepatic necrosis caused by CCl4 involves bioactivation by a microsomal cytochrome P450–dependent monooxygenase system, resulting in

Introduction Liver diseases are a major problem throughout the world. Many environmental toxins cause liver injury to humans, and despite new advances in hepatology, the treatment for liver diseases does not resolve the problems caused by these toxins. Furthermore, despite the increasing need for agents to protect the liver from damage, modern medicine lacks a reliable liver protective drug. Therefore, there has been considerable interest in the role of complementary and alternative medicines for the treatment of liver diseases (1). The radix of Scutellaria baicalensis GEORGI is an eastern traditional medicine that is used as an anti*Corresponding author. [email protected] Published online in J-STAGE: January 11, 2008 doi: 10.1254/jphs.FP0071392

136

Baicalin in CCl4-Induced Hepatic Injury

the formation of trichloromethyl free radicals and ROS, which initiate lipid peroxidation and protein oxidation leading to hepatocellular membrane damage (7). This process is followed by the release of inflammatory mediators from the activated hepatic macrophages, which are believed to potentiate the CCl4-induced hepatic injury. This study evaluated the role of the inhibition of oxidative stress and inflammation as a possible molecular mechanism for the protective effect of baicalin in a CCl4-induced liver injury. Materials and Methods Chemicals Unless stated otherwise, all chemicals were obtained from Sigma Chemical Co. (St. Louis, MO, USA). Preparation of baicalin from Scutellariae Radix The dried roots of Scutellaria baicalensis GEORGI (Labiatae) were purchased in Sun-Chon and were authenticated by Dr. J.H. Lee, an Oriental medicine specialist. A voucher specimen was deposited at the Department of Food and Nutrition, Andong University, Korea. The dried roots of Scutellaria baicalensis Georgi (20 kg) were percolated with 70% ethanol (EtOH) three times and concentrated in vacuo, and a residue (6 kg) was suspended in H2O and partitioned successively with CH2Cl2, EtOAc, and butanol (BuOH), to give CH2Cl2 (300 g), EtOAc (120 g), and BuOH (2.2 kg) soluble fractions, respectively. A portion of the BuOH fraction (50 g) was subjected to silica gel column chromatography eluted with a stepwise gradient of CH2Cl2:MeOH to yield ten fractions (C1 – C10) based on their polarities. Also fraction C7 was rechromatographed on a silica gel column eluted with CHCl3:MeOH:H2O = 7:3:1 – 52:28:8 to give five subfractions (C7.1 – C7.5). The C7.5 fraction was re-crystallized in methanol to obtain pure baicalin, which was subjected to analytical HPLC (3.9 × 300 mm, µbondapak C-18 column) with elution by MeOH : 5% acetic acid [7:3 (v / v), 0.5 ml / min]; the obtained baicalin, with a purity >95%, had a retention time of 5.9 min. The structure of baicalin was verified by comparison of the NMR data with those reported in the literature (Fig. 1) (8). Animals and experimental treatments Male ICR mice (25 – 30 g) were given access to water and food throughout the experiments ad libitum. The animals were fasted for 16 h before the CCl4 treatment. The use and care of animals were carried out according to the Sungkyunkwan University Animal Care Committee guidelines. The mice were randomly divided

137

Fig. 1. The structure of baicalin (7-D-glucuronic acid,5,6-dihydroxyflavone).

into 7 groups with 8 animals each. Group 1 was used as the normal control and was given the respective vehicles. Groups 2 – 7 were administered CCl4 (0.5 ml / kg in olive oil) intraperitoneally. The mice in groups 3 – 7 were treated intraperitoneally with baicalin (25, 50, 100, and 200 mg / kg) and silymarin (positive control for hepatoprotective properties, 200 mg / kg) twice 30 min before and 2 h after the CCl4 injection, respectively. These baicalin doses were selected because they had been previously evaluated in a lung injury model of rats induced by paraquat poisoning (9). Twenty four hours after injecting the CCl4, blood was taken from the abdominal aorta and the liver was isolated and stored at −75°C for later analysis. Determination of serum aminotransferase activities The serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities were determined by standard spectrophotometric procedures using a ChemiLab ALT and AST assay kit (IVDLab Co., Ltd., Korea), respectively. Measurements of hepatic lipid peroxidation and glutathione content The steady-state level of malondialdehyde (MDA), which is the end product of lipid peroxidation, was measured in the liver homogenates by measuring the level of thiobarbituric acid-reactive substances spectrophotometrically at 535 nm, as described by Buege and Aust (10). The hepatic glutathione content was determined in the liver homogenates after precipitation with 1% picric acid using yeast-glutathione reductase, 5,5'dithio-bis(2-nitrobenzoic acid), and NADPH, at 412 nm (11). The hepatic glutathione values are expressed as mmol / mg protein. Histological analysis of tissues The liver slices were made from a part of the left lobe and fixed immediately in a 10% buffered formalin phosphate solution, embedded in paraffin, and sectioned at 5 µm. The serial sections were stained with hematoxylin

138

S-W Park et al Table 1.

PCR primers used in this study and the amplified product length

Gene (accession number)

Primer sequences (5'-3')

TNF-α (M11731)

Sense: AGCCCACGTCGTAGCAAACCACCAA Antisense: AACACCCATTCCCTTCACAGAGCAAT

446

iNOS (NM_010927)

Sense: AAGCTGCATGTGACATCGACCCGT Antisense: GCATCTGGTAGCCAGCGTACCGG

598

COX-2 (NM_011198)

Sense: ACTCACTCAGTTTGTTGAGTCATTC Antisense: TTTGATTAGTACTGTAGGGTTAATG

582

HO-1 (NM_010442)

Sense: AACAAGCAGAACCCAGTCT Antisense: TGTCATCTCCAGAGTGTTC

374

β-Actin (X03672)

Sense: TGGAATCCTGTGGCATCCATGAAA Antisense: TAAAACGCAGCTCAGTAACAGTCCG

348

and eosin (H&E) to evaluate the portal inflammation, hepatocellular necrosis, and Kupffer cell hyperplasia. The sections were examined in a blind manner under an Olympus CKX 41 microscope (Olympus Optical Co., Ltd., Tokyo) (12). Measurement of serum TNF-α The tumor necrosis factor-α (TNF-α) concentrations were quantified using a commercial TNF-α ELISA assay kit (eBiosciences Co., San Diego, CA, USA). Western blot immunoassay Freshly isolated liver tissue was homogenized in a lysis buffer. A 20-µg sample of protein from the liver homogenates was loaded per lane on 7.5% or 10.0% polyacrylamide gels. Electrophoresis was then performed. The proteins were then transferred to nitrocellulose membranes. Western blot analysis was performed using the polyclonal antibodies against mouse inducible nitric oxide synthase (iNOS; Transduction Laboratories, San Jose, CA, USA), cyclooxygenase-2 (COX-2; Cayman, Ann Arbor, MI, USA), heme oxygenase-1 (HO-1; Stressgen Bioreagents Corp., Ann Arbor, MI, USA), and the monoclonal antibody against mouse β-actin. The binding of all the antibodies was detected using an ECL detection system (iNtRON Biotechnology Co., Ltd., Korea), according to the manufacturer’s instructions. The intensity of the immunoreactive bands was determined using a densitometric analysis program (Image Gauge V3.12; Fuji Photo Film Co., Ltd., Tokyo). Total RNA extraction and reverse transcriptionpolymerase chain reaction The total RNA was isolated using the method described by Chomczynski and Sacchi (13). Reverse transcription of the total RNA was carried out to

Product length (bp)

synthesize the first strand cDNA using oligo(dT)12-18 primer and SuperScriptTM II RNase H− Reverse Transcriptase (Invitrogen Tech-LineTM, Carlsbad, CA, USA). The PCR reaction was performed with a diluted cDNA sample and amplified in each 2-µl reaction volume. The final reaction concentrations are as follows: primers, 10 µM; dNTP mix, 250 mM; 10 × PCR buffer; Ex Taq DNA polymerase, and 0.5 U / reaction. The genespecific primers are listed in Table 1. All the PCR reactions had an initial denaturation step at 94°C for 5 min and a final extension at 72°C for 7 min using a GeneAmp 2700 thermocycler (Applied Biosystems, Foster City, CA, USA). The PCR amplification cycling conditions were as follows: 28 cycles of 94°C (30 s), 65°C (30 s), and 72°C (30 s) for TNF-α; 35 cycles of 94°C (30 s), 60°C (30 s), and 72°C (30 s) for iNOS; and 35, 30, and 25 cycles of 94°C (30 s), 56°C (30 s), and 72°C (30 s) for COX-2, HO-1, and β-actin, respectively. After RT-PCR, 10-µl samples of the amplified products were resolved by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide. The intensity of each PCR product was evaluated semiquantitatively using a digital camera (DC120; Eastman Kodak, New Haven, CT, USA) and a densitometric scanning analysis program (1D Main; Advanced American Biotechnology, Fullerton, CA, USA). Statistics All the results are reported as the means ± S.E.M. The overall significance of the data was examined by oneway analysis of variance (ANOVA). The differences between the groups were considered significant at P<0.05 with the appropriate Bonferronic correction made for multiple comparisons.

Baicalin in CCl4-Induced Hepatic Injury Table 2. Groups

139

Effect of baicalin on the serum aminotransferases, lipid peroxidation, and hepatic glutathione content in the CCl4-induced mice Dose (mg /kg)

Control

ALT (U/ l)

AST (U /l)

Malondialdehyde (nmol / g liver)

Hepatic glutathione content (nmol /mg protein)

62.5 ± 16.0

151.3 ± 33.9

32.9 ± 0.3

6.97 ± 0.55

CCl4 Vehicle Baicalin

25 50 100 200

Silymarin

200

12528.1 ± 990.8**

13589.2 ± 1225.0**

44.1 ± 0.6**

3.27 ± 0.29**

11978.6 ± 496.2**

13853.3 ± 1076.1**

38.4 ± 0.8**++

4.47 ± 0.66*

9173.0 ± 629.4**

+

++

5.65 ± 0.59+

8790.0 ± 580.3**

++

++

5.81 ± 0.54+

+

8370.6 ± 627.7**

++

7828.6 ± 630.6**

++

11544.8 ± 939.9** 8779.0 ± 317.3**++

39.6 ± 0.7** 37.9 ± 0.7**

10929.3 ± 1177.3**

40.3 ± 1.6**

4.56 ± 0.43*

9013.9 ± 832.7**++

36.4 ± 1.0*++

3.35 ± 1.06**

The values are the means ± S.E.M. of 8 mice per group. *,**Significantly different (P<0.05, P<0.01) from the control group. different (P<0.05, P<0.01) from the vehicle-treated CCl4 group.

+,++

Significantly

Results

with baicalin at the dose of 100 mg/kg.

Serum aminotransferase activities, lipid peroxidation, and hepatic glutathione content The serum ALT and AST activities in the control group were 62.5 ± 16.0 and 151.3 ± 33.9 U /l, respectively. The serum ALT and AST activities increased markedly 24 h after the CCl4 injection. These increases were inhibited by the 50 and 100 mg/kg baicalin treatment. The serum ALT and AST activities were also lower in the silymarin-treated CCl4 group than in the vehicle-treated CCl4 group. Similar to the aminotransferase activities, the MDA level increased significantly in the CCl4-injected mice, which was attenuated by all doses of baicalin and silymarin at 200 mg/kg. The hepatic glutathione content in the CCl4-injected mice decreased to 47% of the control value but this decrease was attenuated by the baicalin treatment at a dose of 50 and 100 mg/kg (Table 2).

iNOS, COX-2, and HO-1 protein expression Similar to the serum TNF-α level, the level of iNOS and COX-2 protein expression was significantly higher in the CCl4-treated mice than in the controls. The increase in the level of iNOS protein expression was significantly suppressed by the 100 mg/kg baicalin treatment, but baicalin had little effect on the level of COX-2 protein expression. The level of HO-1 protein expression in the CCl4 group was significantly higher than that in the control group. This increase was augmented by the baicalin (100 mg/kg) treatment (Fig. 4).

Histological analysis The histological features of the liver in the control group showed a normal liver lobular architecture and cell structure. However, 24 h after the CCl4 injection, the histopathological lesions of the liver showed extensive hepatocellular damage, as evidenced by the presence of portal inflammation, centrizonal necrosis, and Kupffer cell hyperplasia. These histopathological changes were ameliorated by both the baicalin (100 mg/kg) and silymarin (200 mg/kg) treatments (Fig. 2). Serum TNF-α level As shown in Fig. 3, the level of serum TNF-α was 133.6 ± 8.5 pg/ml in the control group. On the other hand, in the vehicle treated-CCl4 group, the serum TNFα level increased to 2.3 times that of the control group. This increase was significantly attenuated by treatment

TNF-α, iNOS, COX-2, and HO-1 mRNA expression The TNF-α, iNOS, COX-2, and HO-1 mRNA expression was quite low in the control group. However, the level of TNF-α, iNOS, COX-2, and HO-1 mRNA expression increased markedly 24 h after the CCl4 injection. The increase in the level of TNF-α and iNOS mRNA expression was suppressed by the baicalin treatment at a dose of 100 mg/ kg, whereas the level of COX-2 mRNA expression was not affected by baicalin. The level of HO-1 mRNA expression was further elevated by the baicalin treatment (Fig. 5). Discussion CCl4-induced hepatic injury is an experimental model widely used in hepatoprotective drug screening. This study shows for the first time that baicalin can prevent the acute hepatic damage induced by CCl4. CCl4-induced hepatotoxicity is believed to involve two phases. The initial phase involves the metabolism of CCl4 by cytochrome P450, which leads to the formation of free radicals and lipid peroxidation (14). The second step involves the activation of Kupffer cells, probably by free

140

S-W Park et al

Fig. 2. Effect of baicalin on the histological changes in the liver of the CCl4-treated mice (original magnification ×100). A: Control group: normal lobular architecture and cell structure; B: vehicle-treated CCl4 group: extensive hepatocellular damage with the presence of portal inflammation, centrizonal necrosis, and Kupffer cell hyperplasia; C: CCl4 and baicalin (100 mg /kg)treated group: mild portal inflammation and minimal hepatocellular necrosis and Kupffer cell hyperplasia. D: CCl4 and silymarin (200 mg / kg)-treated group: mild portal inflammation and minimal hepatocellular necrosis and Kupffer cell hyperplasia.

Fig. 3. Effect of baicalin (100 mg /kg) on the serum TNF-α level in the liver of the CCl4-treated mice. The values are reported as the means ± S.E.M. of 8 mice per group. **Significantly different (P<0.01) from the control group. ++Significantly different (P<0.01) from the CCl4 group.

radicals. The activation of Kupffer cells is accompanied by the production of proinflammatory mediators (15). As a result of the hepatic injury, the altered permeability of the membrane causes the enzymes from the cells to be

Fig. 4. Effect of baicalin (100 mg / kg) on the iNOS, COX-2, and HO-1 protein expression in the liver of the CCl4-treated mice. The values are reported as the means ± S.E.M. of 8 mice per group. **Significantly different (P<0.01) from the control group. ++Significantly different (P<0.01) from the CCl4 group.

Baicalin in CCl4-Induced Hepatic Injury

Fig. 5. Effect of baicalin (100 mg / kg) on the TNF-α, iNOS, COX-2, and HO-1 mRNA expression in the liver of the CCl4-treated mice. The values are reported as the means ± S.E.M. of 8 mice per group. **Significantly different (P<0.01) from the control group. ++Significantly different (P<0.01) from the CCl4 group.

released into circulation (16), which damages the hepatic cells, as shown by the abnormally high level of serum hepatospecific enzymes. In this study, the serum ALT and AST levels increased markedly 24 h after the CCl4 injection, but these increases were attenuated by treatment with baicalin at 50 and 100 mg/ kg. These results indicate that baicalin preserves the structural integrity of the hepatocellular membrane and protects the mice against CCl4-induced hepatotoxicity. This phenomenon was also supported by histological examinations. CCl4 caused a variety of histological changes to the liver, including centrizonal necrosis, portal inflammation, and Kupffer cell hyperplasia. These changes were significantly attenuated by baicalin. Furthermore, the hepatoprotective effect of baicalin seemed to be the same as that of silymarin, which has been used as a potent hepatoprotective agent. The present results suggest that baicalin may have potential clinical application for treating liver diseases. It is generally accepted that the hepatotoxicity of CCl4 is the result of reductive dehalogenation. The trichloromethyl free radical is capable of binding to lipids, which initiates lipid peroxidation and liver damage (17). GSH constitutes the first line of defense against free radicals and is a critical determinant of the tissue susceptibility to oxidative damage. Previous studies on the mechanism of

141

CCl4-induced hepatotoxicity reported that GSH plays a key role in detoxifying the reactive toxic metabolites of CCl4 and that liver necrosis begins when the GSH stores are depleted (18). In this study, baicalin exhibited protective effects by impairing the CCl4-mediated oxidative stress through the decreased production of free radical derivatives, as evidenced by the decreased MDA level. Furthermore, baicalin attenuated the hepatic glutathione depletion 24 h after the CCl4 injection. The increase in the hepatic glutathione level in the baicalintreated mice could be due either to its effect on the de novo synthesis of glutathione, its regeneration, or both. As a consequence, the hepatic glutathione level could be maintained at levels sufficient to counteract the increased formation of free radicals, as in the case of CCl4 toxicity. These results suggest that the antioxidant properties may be one mechanism through which baicalin protects against the liver damage mediated by CCl4. Baicalin at 100 mg/kg was selected as the optimal effective dose for evaluating the molecular mechanisms of baicalin against CCl4-induced hepatotoxicity. Kupffer cells release a number of inflammatory mediators with cytotoxic potential. The two mediators of particular interest are TNF-α and nitric oxide (NO). TNF-α is a pleiotropic proinflammatory cytokine that is produced rapidly by macrophages in response to tissue injury. TNF-α stimulates the release of cytokine from macrophages and induces a phagocyte oxidative metabolism and NO production (19). NO is a highly reactive oxidant that is produced by parenchymal and nonparenchymal liver cells from L-arginine through the action of NOS. NO participates in a variety of physiological processes, including vasodilation, neurotransmission, and nonspecific host defense. When released by macrophages against infectious agents, NO can also react with the superoxide anion to form a potent and versatile oxidant, peroxynitrite, which stimulates the production of TNF-α in Kupffer cells through the activation of the oxidant-sensitive transcription factor NF-κB (20). The notion that NO is involved in acute liver injury is based on several observations that toxininduced hepatic damage is associated with increased NO production by the liver (21). However, it remains to be determined whether the augmented production of NO has a protective or deleterious role in the liver. In this study, the serum level of TNF-α and iNOS protein expression increased after CCl4 administration with a concomitant increase in their gene expression, and this increase was prevented by baicalin. These results suggest that baicalin largely regulates the CCl4-induced production of TNF-α and iNOS at the transcriptional level. Previous studies reported that the induction of COX

142

S-W Park et al

in the inflammatory response is the secondary effect of CCl4-induced hepatotoxicity (22). COX-2 is the mitogen-inducible isoform of COX, and it is induced in macrophages by several proinflammatory stimuli, such as cytokines and growth factors, leading to COX-2 expression and the subsequent release of prostaglandins (23). In this study, the levels of COX-2 protein and gene expression increased significantly after the CCl4 treatment. However, the baicalin treatment did not affect this increase. Kim et al. (24) also reported that baicalin inhibited iNOS gene expression and NO production but does not affect the production of prostaglandin E2 and the expression of the COX-2 gene in lipopolysaccharidetreated Raw 264.7 macrophages. HO-1 is not only a key enzyme in the heme catabolism but is also a heat shock protein (HSP 32) in rats. HO-1 is induced by its substrate heme, as well as by various oxidative stresses, and is believed to play an important protective role against oxidative injury (25). Wen et al. (26) reported that the administration of CCl4 resulted in a time-dependent increase in hepatic HO-1 activity, which reached a maximum at 24 h. This increase was accompanied by the rapid and significant induction of HO-1 protein expression, which occurred in the same time-dependent manner following CCl4 administration. In this study, the levels of HO-1 protein and gene expression also increased markedly 24 h after the CCl4 injection. Interestingly, the baicalin treatment augmented the increase in the levels of HO-1 protein and gene expression. When animals were pretreated zincprotophophyrin IX for inhibition of HO-1 expression, the histology of baicalin-treated CCl4-exposed liver tissue did not markedly differ from that of the CCl4exposed ones (data not shown). This finding suggests that the protective mechanism of baicalin against CCl4induced hepatic injury might be closely associated with overexpression of HO-1. HO-1 oxidatively cleaves heme yielding CO, iron, and biliverdin IXα, which is then reduced to bilirubin IXα by biliverdin reductase (27). Recently, it was reported that CO has anti-inflammatory and antiapoptotic properties (28). CO, a newly identified signaling molecule, has long been believed to participate in many biological events and play a key role in mediating the cytoprotection against oxidant-induced injury (29). The cellular functions of overproduced CO in the liver cells are unclear but the CO generated through the HO-1 pathway during CCl4-induced tissue injury might be important in the antioxidant defense as well as in the anti-inflammatory response (30). More studies will be needed to examine this effect in detail. In conclusion, baicalin protects the liver from CCl4induced oxidative stress, which might be due to the induction of HO-1 and the inhibition of the inflam-

matory response. Because baicalin can be consumed over long periods of time without any known side effects, its possible role as a promising therapeutic in human oxidative stress and inflammatory liver disease deserves consideration. The potential for using baicalin in experimental and practical applications should be examined further. Acknowledgment This work was supported by a grant from the Korea Food and Drug Administration (Studies on the Identification of Efficacy of Biologically Active Components from Oriental Herbal Medicines). References 1 Galati EM, Mondello MR, Lauriano ER, Taviano MF, Galluzzo M, Miceli N. Opuntia ficus indica (L.) Mill. fruit juice protects liver from carbon tetrachloride-induced injury. Phytother Res. 2005;19:796–800. 2 Taira Z, Yabe K, Hamaguchi Y, Hirayama K, Kishimoto M, Ishida S, et al. Effects of Sho-saiko-to extract and its components, Baicalin, baicalein, glycyrrhizin and glycyrrhetic acid, on pharmacokinetic behavior of salicylamide in carbon tetrachloride intoxicated rats. Food Chem Toxicol. 2004;42:803–807. 3 Li BQ, Fu T, Gong WH, Dunlop N, Kung H, Yan Y, et al. The flavonoid baicalin exhibits anti-inflammatory activity by binding to chemokines. Immunopharmacology. 2000;49:295–306. 4 Zhao Y, Li H, Gao Z, Gong Y, Xu H. Effects of flavonoids extracted from Scutellaria baicalensis Georgi on hemin-nitriteH2O2 induced liver injury. Eur J Pharmacol. 2006;536:192–199. 5 Kim DH, Kim HK, Park S, Kim JY, Zou Y, Cho KH, et al. Short-term feeding of baicalin inhibits age-associated NFkappaB activation. Mech Ageing Dev. 2006;127:719–725. 6 Kamalakkannan N, Rukkumani R, Varma PS, Viswanathan P, Rajasekharan KN, Menon VP. Comparative effects of curcumin and an analogue of curcumin in carbon tetrachloride-induced hepatotoxicity in rats. Basic Clin Pharmacol Toxicol. 2005; 97:15–21. 7 McCay PB, Lai EK, Poyer JL, DuBose CM, Janzen EG. Oxygen- and carbon-centered free radical formation during carbon tetrachloride metabolism. Observation of lipid radicals in vivo and in vitro. J Biol Chem. 1984;259:2135–2143. 8 Kubo M, Matsuka H, Kimura Y, Okuda H, Arichi S. Scutellariae Radix. X. Inhibitory effects of various flavonoids on histamine release from rat peritoneal Mast cells in vitro. Chem Pharm Bull. 1984;32:5051–5058. 9 Liu JH, Ma YT, Shi HW, Feng ZS, Zheng SL, Lv CH, et al. Effect of baicalin on expression of heme oxygenase-1 in lung injury of rats associated with paraquat poisoning. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi. 2006;24:337–340. 10 Buege JA, Aust SD. Microsomal lipid peroxidation. Methods Enzymol. 1978;52:302–310. 11 Brehe JE, Burch HB. Enzymatic assay for glutathione. Anal Biochem. 1976;74:189–197. 12 Sato Y, Yoneda M, Nakamura K, Makino I, Terano A. Protective effect of central thyrotropin-releasing hormone on carbon

Baicalin in CCl4-Induced Hepatic Injury

13

14

15

16

17

18

19

20

21

22

tetrachloride-induced acute hepatocellular necrosis in rats. J Hepatol. 2003;39:47–54. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. Koch RR, Glende EA Jr, Recknagel RO. Hepatotoxicity of bromotrichloromethane–bond dissociation energy and lipoperoxidation. Biochem Pharmacol. 1974;23:2907–2915. Edwards MJ, Keller BJ, Kauffman FC, Thurman RG. The involvement of Kupffer cells in carbon tetrachloride toxicity. Toxicol Appl Pharmacol. 1993;119:275–279. Drotman RB, Lawhorn GT. Serum enzymes as indicators of chemically induced liver damage. Drug Chem Toxicol. 1978; 1:163–171. Ahmed S, Rahman A, Alam A, Saleem M, Athar M, Sultana S. Evaluation of the efficacy of Lawsonia alba in the alleviation of carbon tetrachloride-induced oxidative stress. J Ethnopharmacol. 2000;69:157–164. Williams AT, Burk RF. Carbon tetrachloride hepatotoxicity: an example of free radical-mediated injury. Semin Liver Dis. 1990;10:279–284. Bautista AP, Schuler A, Spolarics Z, Spitzer JJ. Tumor necrosis factor-alpha stimulates superoxide anion generation by perfused rat liver and Kupffer cells. Am J Physiol. 1991;261:G891–G895. Matata BM, Galinanes M. Peroxynitrite is an essential component of cytokines production mechanism in human monocytes through modulation of nuclear factor-kappa B DNA binding activity. J Biol Chem. 2002;277:2330–2335. Li J, Billiar TR. Nitric Oxide. IV. Determinants of nitric oxide protection and toxicity in liver. Am J Physiol. 1999;276:G1069– G1073. Basu S. Oxidative injury induced cyclooxygenase activation in experimental hepatotoxicity. Biochem Biophys Res Commun.

143

1999;254:764–767. 23 Planaguma A, Claria J, Miquel R, Lopez-Parra M, Titos E, Masferrer JL, et al. The selective cyclooxygenase-2 inhibitor SC-236 reduces liver fibrosis by mechanisms involving nonparenchymal cell apoptosis and PPARgamma activation. FASEB J. 2005;19:1120–1122. 24 Kim KW, Ha KT, Park CS, Jin UH, Chang HW, Lee IS, et al. Polygonum cuspidatum, compared with baicalin and berberine, inhibits inducible nitric oxide synthase and cyclooxygenase-2 gene expressions in RAW 264.7 macrophages. Vascul Pharmacol. 2007;47:99–107. 25 Otterbein LE, Choi AM. Heme oxygenase: colors of defense against cellular stress. Am J Physiol. 2000;279:L1029–L1037. 26 Wen T, Guan L, Zhang YL, Zhao JY. Dynamic changes of heme oxygenase-1 and carbon monoxide production in acute liver injury induced by carbon tetrachloride in rats. Toxicology. 2006;228:51–57. 27 Maines MD. Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. FASEB J. 1988;2:2557– 2568. 28 Brouard S, Otterbein LE, Anrather J, Tobiasch E, Bach FH, Choi AM, et al. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med. 2000; 192:1015–1026. 29 Sass G, Soares MC, Yamashita K, Seyfried S, Zimmermann WH, Eschenhagen T, et al. Heme oxygenase-1 and its reaction product, carbon monoxide, prevent inflammation-related apoptotic liver damage in mice. Hepatology. 2003;38:909–918. 30 Otterbein LE, Bach FH, Alam J, Soares M, Tao Lu H, Wysk M, et al. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat Med. 2000;6:422–428.