Protective effect of HV-P411, an herbal mixture, on carbon tetrachloride-induced liver fibrosis

Food Chemistry 124 (2011) 248–253

Contents lists available at ScienceDirect

Food Chemistry journal homepage: www.elsevier.com/locate/foodchem

Protective effect of HV-P411, an herbal mixture, on carbon tetrachloride-induced liver fibrosis Hyo-Yeon Kim a, Seok-Joo Kim a, Kyung Nam Kim b, Sin Gu Lee b, Sun-Mee Lee a,* a b

School of Pharmacy, Sungkyunkwan University, Suwon 440-746, Republic of Korea HVLS Co., Ltd., Jecheon, Chungcheongbuk-do 390-250, Republic of Korea

a r t i c l e

i n f o

Article history: Received 16 March 2010 Received in revised form 25 May 2010 Accepted 8 June 2010

Keywords: Carbon tetrachloride Extracellular matrix Liver fibrosis Vitis vinifera/Schisandra chinensis/Taraxacum officinale (HV-P411)

a b s t r a c t This study was performed to examine the anti-fibrotic activity of HV-P411, an herbal mixture of seeds of Vitis vinifera, Schisandra chinensis and Taraxacum officinale extract, against carbon tetrachloride (CCl4)induced liver fibrosis. Hepatic fibrosis was induced by intraperitoneal injection of CCl4 (0.5 ml/kg, twice weekly) for 8 weeks. Rats were treated orally with HV-P411 at 50, 100, 200, and 400 mg/kg once a day. After chronic exposure to CCl4, the levels of hydroxyproline were markedly increased; these were significantly reduced by HV-P411 at all dose levels. The level of serum aminotransferases and lipid peroxidation were increased after the CCl4 treatment, while reduced glutathione was decreased. These changes were attenuated by HV-P411. In addition, HV-P411 attenuated CCl4-induced raised serum concentration of transforming growth factor-b1, and the levels of matrix metalloprotease-2 and tissue inhibitor of metalloprotease-1 mRNAs. Our results suggest that HV-P411 may prevent liver fibrosis by modulating fibrogenesis and fibrolysis. Ó 2010 Elsevier Ltd. All rights reserved.

1. Introduction Hepatic fibrosis is a reversible wound-healing response to liver injury, which has the potential to progress to cirrhosis. Fibrosis frequently occurs in almost all patients with chronic liver injury and is the fundamental cause of end-stage liver disease complications, such as portal hypertension, encephalopathy, synthetic dysfunction and impaired metabolic capacity (Friedman, 2008). The pathogenesis of liver fibrosis is related to the complex network of the liver, non-parenchymal cells and balance between extracellular matrix production and degradation. Reactive oxygen species (ROS), apoptotic fragments, and Kupffer cells infiltration contribute to hepatic stellate cell (HSC) activation (Canbay, Friedman, & Gores, 2004). HSCs, stimulated by transforming growth factor (TGF)-b1, develop fibrosis by increasing matrix reconstruction (Breitkopf, Godoy, Ciuclan, Singer, & Dooley, 2006). Although the understanding of fibrosis progression is improving, anti-fibrotic therapies are fraught with toxicity due to longterm administration. Anti-fibrotics derived from natural sources have been demonstrated to possess less toxicity and acceptable efficacies (Dulundu et al., 2007). Vitis vinifera is well known as an anti-oxidant, containing procyanidins and proanthocyanidins

* Corresponding author. Address: School of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Republic of Korea. Tel.: +82 31 290 7712; fax: +82 31 292 8800. E-mail address: [email protected] (S.-M. Lee). 0308-8146/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodchem.2010.06.026

(Bagchi et al., 2000). It has anti-inflammatory activity (Li, Zhang, Wu, & Tian, 2001) and inhibits apoptosis of cardiomyocytes by attenuating c-Jun amino-terminal protein kinase during ischaemia (Sato, Bagchi, Tosaki, & Das, 2001). In addition, V. vinifera is proven to possess hepatoprotective effects against acetaminophen-induced liver damage (Ray, Kumar, & Bagchi, 1999), and biliary obstruction-induced hepatic fibrosis (Dulundu et al., 2007). The fruit of Schisandra chinensis is a traditional herb, which has a wide spectrum of pharmacological action, including anti-asthmatic, anti-diabetic and sedative effects (Opletal, Sovova, & Bartlova, 2004). The lignans of S. chinensis has been shown to possess activities against hepatocellular carcinoma (Loo, Cheung, & Chow, 2007) and acute carbon tetrachloride (CCl4)-induced hepatotoxicity (Ip et al., 1996). In an in vitro study, S. chinensis was demonstrated to inhibit HSC proliferation observed during fibrogenesis (Chor et al., 2005). Dandelion (Taraxacum officinale) is used as a medicinal herb to treat renal disease, dyspepsia, heartburn and arthritis (Schutz, Carle, & Schieber, 2006). In addition, it is combined with other herbs to treat inflammatory diseases, such as hepatitis (Sweeney, Vora, Ulbricht, & Basch, 2005). In our recent studies, V. vinifera, S. chinensis or T. officinale alone suppressed the increase in serum aminotransferase activities in D-galactosamine-treated rat. HV-P411, a mixture of V. vinifera, S. chinensis and T. officinale, exhibited synergistic effect in suppressing the increases in serum aminotransferase activities (unpublished data). Furthermore, Kim, Hyun, and Choung (2006) demonstrated that the combination of seeds of V. vinifera, S. chinensis and

H.-Y. Kim et al. / Food Chemistry 124 (2011) 248–253

T. officinale extract protected hepatic injury induced by chronic exposure to alcohol. The aim of this study was to evaluate the efficacy and molecular mechanisms of HV-P411 in the treatment of CCl4-induced liver fibrosis. 2. Materials and methods 2.1. Preparation of HV-P411 HV-P411 was prepared by HVLS Co., Ltd., Seoul, Korea. Dried S. chinensis and T. officinale were purchased from the Kyung-Dong market (Seoul, Korea) and dried voucher specimens were authenticated and deposited in the herbarium of HVLS Co., Ltd. (Seoul, Korea). The 3.0 kg of homogenised S. chinensis and 6.0 kg of T. officinale were extracted twice at 90 ± 10 °C for 4 h in 10 times volume of distilled water. Each extract was filtered through 150 mesh and concentrated using a rotary evaporator (Model: Cosmos 660, KyungSeo Machine Co., Incheon, Korea). The dry powder of extracts was obtained by freeze-drying and the yields were 35.6% and 38.6%, respectively. The extract of seeds of V. vinifera was obtained from HVLS Co., Ltd. The seeds of V. vinifera were extracted by hot water, heated ethyl alcohol or acetone at room temperature, fermented by yeast, and hydrolysed with tannase and standardised by proanthocyanidin constituting at least 95% (w/w). The extracts were standardised for quality control, according to the regulations imposed by Korea Food and Drug Administration. HV-P411 was dissolved in physiologic saline (vehicle) for the experiments. 2.2. Treatment of animals Male Sprague–Dawley rats (240–260 g) were obtained from Orient Inc., Gyeonggi-do, Korea. All animals were treated in accordance with the Sungkyunkwan University Animal Care Committee guidelines. The dose of HV-P411 complex was based on a previous study (Kim et al., 2006) and our preliminary study. The animals were randomly assigned to six groups. Group I (control) received only olive oil (0.5 ml/kg, i.p., twice per week). CCl4 was dissolved in olive oil (1:3, v/v) and hepatic fibrosis was induced in Groups II–VI inclusive by intraperitoneal injection of CCl4 (0.5 ml/kg, twice per week) for 8 weeks. Groups I and II were treated orally with the vehicle. Rats in Groups III–VI were treated with oral administration of HV-P411 once a day during this period; Group III was treated with HV-P411 50 (12.5 mg V. vinifera, 18.75 mg S. chinensis and 18.75 mg T. officinale); Group IV was treated with HV-P411 100 (25 mg V. vinifera, 37.5 mg S. chinensis and 37.5 mg T. officinale); Group V was treated with HV-P411 200 (50 mg V. vinifera, 75 mg S. chinensis and 75 mg T. officinale); Group VI was treated with HV-P411 400 (100 mg V. vinifera, 150 mg S. chinensis and 150 mg T. officinale). Blood was obtained from the inferior vena cava and each liver was isolated and stored at 75 °C for analyses. 2.3. Serum aminotransferase activities Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities were determined using ChemiLab ALT and AST assay kits (IVDLab Co., Ltd., Gyeonggi-do, Korea), respectively. 2.4. Histological analysis The anterior portion of the left lateral lobe of the liver was sectioned for the purpose of histological examinations. Tissue was fixed by immersion in 10% neutral-buffered formalin. The sample was then embedded in paraffin, sliced into 5-lm sections, stained

249

with haematoxylin–eosin (H&E), and followed by blinded histological assessment. Histological changes were evaluated in non-consecutive, randomly chosen  200 histological fields. 2.5. Hepatic hydroxyproline content Hepatic hydroxyproline content was measured as the fibrotic index (Jamall, Finelli, & Que Hee, 1981). Briefly, liver tissue was homogenised in 6 N hydrochloric acid and then hydrolysed at 110 °C for 18 h. After cooling, chloramine T was added to the hydrolysate. After 5 min, p-dimethylaminobenzaldehyde was added and the mixture was incubated for 30 min at 60 °C. Sample absorbance was read at 560 nm against a reagent blank, which contained the complete system without added tissue. 2.6. Hepatic lipid peroxidation and reduced glutathione (GSH) content The steady-state level of malondialdehyde (MDA), a lipid peroxidation end product, was analysed by measuring the level of thiobarbituric acid reactive substances spectrophotometrically at 535 nm, using 1,1,3,3-tetraethoxypropane (Sigma, St. Louis, MO) as standard. The level of GSH was determined by the difference between total glutathione and oxidised glutathione (GSSG) levels. Total glutathione level was measured spectrophotometrically at a wavelength of 412 nm using yeast glutathione reductase and 5,50 -dithio-bis(2-nitrobenzoic acid) as described (Tietze, 1969). GSSG level was measured using the same methodology, but in the presence of 2-vinylpyridine (Griffith, 1980). 2.7. Serum TGF-b1 level The serum concentration of TGF-b1 was quantified using a commercial TGF-b1 ELISA Kit, OptEIA™ (BD Bioscience, San Jose, CA) according to the manufacturer’s instructions. 2.8. Reverse transcription polymerase chain reaction (RT-PCR) Total RNA was extracted and the first strand of cDNA was synthesised by reverse transcription of total RNA using oligo(dT)12–18 primer and SuperScript™ II RNase H-Reverse Transcriptase (Invitrogen Tech-Line™, Carlsbad, CA). PCR reaction was carried out in a 20-ll reaction volume with a diluted cDNA sample. The final reaction concentrations were as follows: sense and antisense primers, 10 pM; dNTP mix, 250 lM; 10 PCR buffer and Ex Taq DNA polymerase, 0.5 U/reaction. PCR was carried out with an initial denaturation step at 94 °C for 5 min, and a final extension step at 72 °C for 7 min in the GeneAmp 2700 thermocycler (Applied Biosystems, Foster City, CA). The amplification cycling conditions are as follows: for matrix metalloprotease (MMP)-2, 34 cycles at 94 °C for 30 s, 54 °C for 30 s and 72 °C for 60 s; for tissue inhibitor of metalloprotease (TIMP)-1, 30 cycles at 94 °C for 30 s, 56 °C for 30 s and 72 °C for 30 s; and for b-actin, 25 cycles at 94 °C for 30 s, 62 °C for 30 s and 72 °C for 30 s. The following primers were used; for MMP-2, the 50 primer was CTATTCTGTCAGCACTTTGG and the 30 primer was CAGACTTTGGTTCTCCAACTT; for TIMP-1, the 50 primer was ACAGCTTTCTGCAACTCG and the 30 primer was CTATAGGTCTT TACGAAGGCC; for b-actin, the 50 primer was TTGTAACCAACTGGG ACGATATGG and the 30 primer was GATCTTGATCTTCATGGTGCT AG. After PCR, 10-lL samples of PCR products were electrophoresed through 1.5% agarose gel, stained with ethidium bromide and visualised by ultraviolet illumination. The intensity of each PCR product was analysed semi-quantitatively with SLB Mylmager (UVP Inc., Upland, CA) and ImageQuant™ TL (Amersham Biosciences/GE Healthcare, Piscataway, NJ).

250

H.-Y. Kim et al. / Food Chemistry 124 (2011) 248–253

Fig. 1. Effects of HV-P411 on serum ALT (A) and AST (B) activities. Rats were received intraperitoneal injection of CCl4 (0.5 ml/kg) twice a week for 8 weeks. During the period, HV-P411 or saline were administered orally once a day. Serum aminotransferase activities were measured spectrophotometrically. The results are presented as mean ± SEM of 8–10 animals per group. aDenotes significant differences (p < 0.05) from the control group; bdenotes significant differences (p < 0.01) from the control group; and cdenotes significant differences (p < 0.01) from the vehicle-treated CCl4 group. ALT, alanine aminotransferase; AST, aspartate aminotransferase; and CCl4, carbon tetrachloride.

2.9. Statistical analysis All results are reported as mean ± SEM. The overall significance of the data was examined by one-way analysis of variance (ANOVA). Differences between the groups were considered statistically significant at p < 0.05 with appropriate Bonferroni correction made for multiple comparisons. 3. Results

ing repeated CCl4 injection for 8 weeks, serum ALT activities in rats were markedly increased, to approximately four times that of the control group (p < 0.01; Fig. 1A). HV-P411 attenuated the increase in serum ALT activities in a dose-dependent manner (p < 0.01; Fig. 1A and Table 2). Serum AST level was also significantly increased, up to 288.4 ± 21.3 U/L after CCl4 injection (p < 0.01; Fig. 1B). HV-P411 at the doses of 50 and 100 mg/kg did not affect the serum AST level. However, 200 and 400 mg/kg doses decreased serum AST by 38.1% (p < 0.01) and 31.3% (p < 0.01), compared with the vehicle-treated CCl4 group (Fig. 1B and Table 2).

3.1. Serum aminotransferase activities As shown in Fig. 1, serum ALT and AST activities in the control group were 41.6 ± 3.4 and 92.0 ± 6.1 U/L, respectively. After receiv-

Table 1 Effects of HV-P411 on lipid peroxidation and hepatic GSH content.a Groups Control CCl4

a

*

Vehicle HV-P411

50 100 200 400

MDA (nmol/mg protein)b

GSH (lmol/g liver)

0.42 ± 0.03 1.12 ± 0.06* 1.05 ± 0.02* 1.08 ± 0.10* 0.95 ± 0.58* 1.22 ± 0.04*

7.20 ± 0.77 4.48 ± 0.10* 4.97 ± 0.59* 5.12 ± 0.84* 4.66 ± 0.47* 3.98 ± 0.16*

The results are presented as mean ± SEM of 8–10 animals per group. b MDA: malondialdehyde and GSH: hepatic reduced glutathione. Denotes significant differences (p < 0.01) from the control group.

3.2. Lipid peroxidation and hepatic GSH content MDA level was significantly increased by 2.7-fold compared to that of the control group after CCl4 injection (p < 0.01). HV-P411 did not attenuate the increased MDA level. The level of hepatic GSH was remarkably decreased by repeated CCl4 injection, compared with the control group (p < 0.01), and this decrease was not affected by HV-P411 treatment at all doses (Table 1).

3.3. Histological analysis Histological features shown in Fig. 2 demonstrate normal liver lobular architecture and the cell structure in the control group. Livers chronically exposed to CCl4 showed multiple and extensive accumulation of fat droplets and hepatocellular necrosis, as well

Fig. 2. Histological features of liver sections stained with H&E after chronic CCl4 exposure. Typical images were chosen from each experimental group (original magnification  200). (A) The control group, showing normal hepatic architecture; (B) the vehicle-treated CCl4 group, showing hepatocellular necrosis with extensive fat droplets and inflammatory infiltration; and (C) HV-P411 200 + CCl4 group, showing mild hepatocellular necrosis and inflammatory infiltration.

H.-Y. Kim et al. / Food Chemistry 124 (2011) 248–253

251

as inflammatory cell infiltration. These pathological changes were attenuated by 200 mg/kg of HV-P411.

3.4. Hepatic hydroxyproline content Chronic CCl4 exposure induced hepatic fibrosis, and collagen production was determined by hydroxyproline levels. The level of hydroxyproline was 195 ± 44.7 lg/g liver in the control group. In the vehicle-treated CCl4 group, hydroxyproline content was markedly increased, to 3.8 times that of the control group (p < 0.01). In contrast, treatment with HV-P411 significantly reduced the increase in hydroxyproline content at 50, 200 and 400 mg/kg (389 ± 13.3, 375 ± 41.4, 358 ± 46.3 lg/g liver, each p < 0.01), and 100 mg/kg (467 ± 0.3 lg/g liver; p < 0.05; Fig. 3 and Table 2).

3.5. Serum TGF-b1 level As shown in Fig. 4, CCl4 administration increased significantly serum TGF-b1 level to 4.3 times that of the control group (p < 0.01). This increase was significantly attenuated by HV-P411 at 200 and 400 mg/kg (each p < 0.05; Fig. 4 and Table 2).

Fig. 4. Effects of HV-P411 on serum TGF-b1. The serum concentration of TGF-b1 was determined using enzyme-linked immunosorbent kinase assay. The results are presented as mean ± SEM of 8–10 animals per group. aDenotes significant differences (p < 0.05) from the control group; bdenotes significant differences (p < 0.01) from the control group; and cdenotes significant differences (p < 0.05) from the vehicle-treated CCl4 group. TGF-b1, transforming growth factor-b1.

3.6. MMP-2 and TIMP-1 mRNA expressions Fig. 5 shows the levels of MMP-2 and TIMP-1 mRNAs in liver tissue. After repeated CCl4 injection, the expression of MMP-2 mRNAs was significantly increased, compared to that of the control group (p < 0.01). The increases in MMP-2 mRNA expression were significantly attenuated by all doses of HV-P411 (p < 0.01), when compared with the vehicle-treated CCl4 rats. The vehicle-treated CCl4 group exhibited a significantly higher level of TIMP-1 mRNA expression compared with the controls (p < 0.01), while HV-P411 significantly decreased TIMP-1 mRNA expression at 200 and 400 mg/kg (each p < 0.01; Fig. 5 and Table 2).

4. Discussion

Fig. 3. Effects of HV-P411 on hepatic hydroxyproline content. The assay was performed as described in ‘‘Section 2”. The results are presented as mean ± SEM of 8–10 animals per group. aDenotes significant differences (p < 0.01) from the control group; bdenotes significant differences (p < 0.05) from the vehicle-treated CCl4 group; and cdenotes significant differences (p < 0.01) from the vehicle-treated CCl4 group.

Table 2 Summary of the protective effect of HV-P411 on CCl4-induced hepatic fibrosis.a Parameterb

ALT AST Hydroxyproline TGF-b MMP-2 TIMP-1 a

% of Inhibition HV-P411 50

HV-P411 100

HV-P411 200

HV-P411 400

33.68 11.42 47.48 18.23 31.79 24.24

37.24 23.15 36.96 12.88 20.22 22.87

43.66 38.10 49.32 43.59 26.27 27.57

46.31 31.34 51.71 46.73 30.91 35.95

Values in italics mean a statistically significant positive effect (p < 0.05). ALT: alanine aminotransferase; AST: aspartate aminotransferase; TGF-b: transforming growth factor-b; MMP-2: matrix metalloprotease-2; and TIMP-1: tissue inhibitor of metalloprotease-1. b

The molecular mechanism of hepatic fibrosis, which occurs at the final stage of chronic liver injuries, is being continuously elucidated, and chronic exposure in rats to CCl4 induces liver fibrosis similar to that in humans (Hosui et al., 2009). In this study, we demonstrated the protective effects of HV-P411 against CCl4-induced hepatic alteration involved in pathogenesis of liver fibrosis. Activated immune cells and hepatocytes secrete cytokines and growth factors, resulting in the degradation and remodelling of extracellular matrix (ECM). Activation of HSCs into matrix-secreting myofibroblasts plays an important role in producing excess ECM during liver fibrogenesis (Friedman, 2008). Therefore, one of the markers for liver fibrosis is the hydroxyproline content in hepatic tissue, as collagens are composed of hydroxyproline residues (Morrione, 1947). After 8 weeks of CCl4 treatment, we observed an increase in hydroxyproline after repeated CCl4 administration. Accumulation of collagen was reduced by treatment with HVP411. Histological changes were observed after CCl4 treatment, showing extensive areas of fatty change and gross necrosis, broad infiltration of lymphocytes, Kupffer cell hyperplasia and fibrous septa. These changes were markedly attenuated by HV-P411. Serum aminotransferase activities were also significantly increased and were reversed by HV-P411 treatment. Our results indicate that HV-P411 protects against hepatocellular damage induced by liver fibrosis.

252

H.-Y. Kim et al. / Food Chemistry 124 (2011) 248–253

Fig. 5. Effects of HV-P411 on the levels of MMP-2 and TIMP-1 mRNAs. RT-PCR was performed separately to quantify the levels of MMP-2 and TIMP-1 mRNAs, using b-actin as a reference gene. Relative levels of each are shown below panel. The results are presented as mean ± SEM of 8–10 animals per group. aDenotes significant differences (p < 0.01) from the control group; and bdenotes significant differences (p < 0.01) from the vehicle-treated CCl4 group. MMP-2, matrix metalloprotease-2; and TIMP-1, tissue inhibitor of metalloprotease-1.

Hepatic fibrosis is the wound-healing response to persistent tissue damage (Wallace, Burt, & Wright, 2008). The pathophysiology of hepatic fibrosis is divided into two major phases: initiation and perpetuation (Friedman, 2004). The earliest changes result from paracrine stimulation, primarily due to ROS. CCl4 causes acute hepatic injury through its metabolites and chronic exposure to CCl4 activates the immune system, resulting in hepatitis by lipid peroxides (Constandinou, Henderson, & Iredale, 2005). After 8 weeks of CCl4 exposure, we observed increased lipid peroxidation, as well as decreased hepatic GSH levels. However, HV-P411 treatment did not reverse these changes, which suggests that factors other than ROS may be responsible for the anti-fibrotic activity of HV-P411. ECM degradation causes TGF-b release from binding to ECM and membrane-anchored MMPs (Yang et al., 2003). TGF-b activates HSCs from quiescence to form myofibroblasts, which are the major source of collagen-producing cells in liver injury. Previous studies demonstrated that transgenic mice overexpressing TGF-b1 developed hepatic fibrosis, and inhibition of TGF-b signalling by injection of type II TGF-b receptor dramatically reduced fibrosis development (Ueberham et al., 2003). In this study, serum TGFb1 was elevated after chronic CCl4 exposure and this increase was significantly reversed by treatment with 200 and 400 mg/kg of HV-P411. This result suggests that HV-P411 exhibits anti-fibrotic activity by blocking TGF-b. In the normal state, ECM homeostasis is regulated by MMPs and TIMPs. The MMP family consists of over 20 different members, divided by their substrates (Somerville, Oblander, & Apte,

2003). Among them, MMP-1 and MMP-3, which decompose fibrotic tissues, are inhibited by TGF-b during fibrosis, while expression of MMP-2 is increased by TGF-b (Schnur, Olah, Szepesi, Nagy, & Thorgeirsson, 2004). MMP-2, also known as gelatinase A, is absent in healthy liver and is expressed by activated HSCs during fibrogenesis. MMP-2 is activated through the formation of a complex of pro-MMP-2, TIMP and MMP-14 and the production of both pro and active MMP-2 is responsible for the hepatic fibrogenesis mechanism (Strongin et al., 1995). TIMPs, specific inhibitors of MMPs, bind to MMPs and regulate MMPs activity. Four members of TIMPs have been identified and TIMP-1 is considered a mediator of hepatic fibrosis (Iredale, 1997). Its binding inhibits degradation of newly synthesised collagen by reducing MMPs activity, which results in accumulation of fibrotic tissue (Schuppan, Ruehl, Somasundaram, & Hahn, 2001). We observed significant increase in hepatic MMP-2 and TIMP-1 mRNA expressions after chronic administration of CCl4. HV-P411 reduced MMP-2 mRNA expression at all doses, and 200 and 400 mg/kg of HV-P411 attenuated TIMP-1 mRNA expression. These results indicate that regulation of pro-fibrotic mediators is one major mechanism associated with the anti-fibrotic activity of HV-P411. In conclusion, the anti-fibrotic activity of HV-P411 could be attributed to suppressing fibrogenesis and enhancing collagenolytic activity. This study provides evidence that HV-P411 could be developed as a novel agent to prevent liver fibrosis. The exact mechanisms involved in fibrogenesis and fibrolysis by HV-P411 should be further investigated.

H.-Y. Kim et al. / Food Chemistry 124 (2011) 248–253

Acknowledgments This work was supported by grants from Ministry of Health and Welfare (A081077), Republic of Korea. References Bagchi, D., Bagchi, M., Stohs, S. J., Das, D. K., Ray, S. D., Kuszynski, C. A., et al. (2000). Free radicals and grape seed proanthocyanidin extract: Importance in human health and disease prevention. Toxicology, 148(2–3), 187–197. Breitkopf, K., Godoy, P., Ciuclan, L., Singer, M. V., & Dooley, S. (2006). TGF-beta/Smad signaling in the injured liver. Zeitschrift für Gastroenterologie, 44(1), 57–66. Canbay, A., Friedman, S., & Gores, G. J. (2004). Apoptosis: The nexus of liver injury and fibrosis. Hepatology, 39(2), 273–278. Chor, S. Y., Hui, A. Y., To, K. F., Chan, K. K., Go, Y. Y., Chan, H. L., et al. (2005). Antiproliferative and pro-apoptotic effects of herbal medicine on hepatic stellate cell. Journal of Ethnopharmacology, 100(1–2), 180–186. Constandinou, C., Henderson, N., & Iredale, J. P. (2005). Modeling liver fibrosis in rodents. Methods in Molecular Medicine, 117, 237–250. Dulundu, E., Ozel, Y., Topaloglu, U., Toklu, H., Ercan, F., Gedik, N., et al. (2007). Grape seed extract reduces oxidative stress and fibrosis in experimental biliary obstruction. Journal of Gastroenterology and Hepatology, 22(6), 885–892. Friedman, S. L. (2004). Mechanisms of disease: Mechanisms of hepatic fibrosis and therapeutic implications. Nature Clinical Practice. Gastroenterology & Hepatology, 1(2), 98–105. Friedman, S. L. (2008). Hepatic fibrosis – Overview. Toxicology, 254(3), 120–129. Griffith, O. W. (1980). Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Analytical Biochemistry, 106(1), 207–212. Hosui, A., Kimura, A., Yamaji, D., Zhu, B. M., Na, R., & Hennighausen, L. (2009). Loss of STAT5 causes liver fibrosis and cancer development through increased TGF{beta} and STAT3 activation. The Journal of Experimental Medicine, 206(4), 819–831. Ip, S. P., Poon, M. K., Che, C. T., Ng, K. H., Kong, Y. C., & Ko, K. M. (1996). Schisandrin B protects against carbon tetrachloride toxicity by enhancing the mitochondrial glutathione redox status in mouse liver. Free Radical Biology & Medicine, 21(5), 709–712. Iredale, J. P. (1997). Tissue inhibitors of metalloproteinases in liver fibrosis. The International Journal of Biochemistry & Cell Biology, 29(1), 43–54. Jamall, I. S., Finelli, V. N., & Que Hee, S. S. (1981). A simple method to determine nanogram levels of 4-hydroxyproline in biological tissues. Analytical Biochemistry, 112(1), 70–75. Kim, M. K., Hyun, S. H., & Choung, S. Y. (2006). Effect of herbal extract mixtures on serum and liver lipid metabolism in chronic ethanol-administered rats. Journal of Health Science, 52(4), 344–351.

253

Li, W. G., Zhang, X. Y., Wu, Y. J., & Tian, X. (2001). Anti-inflammatory effect and mechanism of proanthocyanidins from grape seeds. Acta Pharmacologica Sinica, 22(12), 1117–1120. Loo, W. T., Cheung, M. N., & Chow, L. W. (2007). Fructus schisandrae (Wuweizi)containing compound inhibits secretion of HBsAg and HBeAg in hepatocellular carcinoma cell line. Biomedicine & Pharmacotherapy, 61(9), 606–610. Morrione, T. G. (1947). Quantitative study of collagen content in experimental cirrhosis. The Journal of Experimental Medicine, 85(3), 217–226. Opletal, L., Sovova, H., & Bartlova, M. (2004). Dibenzo[a,c]cyclooctadiene lignans of the genus Schisandra: Importance, isolation and determination. Journal of Chromatography B, 812(1–2), 357–371. Ray, S. D., Kumar, M. A., & Bagchi, D. (1999). A novel proanthocyanidin IH636 grape seed extract increases in vivo Bcl-XL expression and prevents acetaminopheninduced programmed and unprogrammed cell death in mouse liver. Archives of Biochemistry and Biophysics, 369(1), 42–58. Sato, M., Bagchi, D., Tosaki, A., & Das, D. K. (2001). Grape seed proanthocyanidin reduces cardiomyocyte apoptosis by inhibiting ischemia/reperfusion-induced activation of JNK-1 and C-JUN. Free Radical Biology & Medicine, 31(6), 729–737. Schutz, K., Carle, R., & Schieber, A. (2006). Taraxacum – A review on its phytochemical and pharmacological profile. Journal of Ethnopharmacology, 107(3), 313–323. Schnur, J., Olah, J., Szepesi, A., Nagy, P., & Thorgeirsson, S. S. (2004). Thioacetamideinduced hepatic fibrosis in transforming growth factor beta-1 transgenic mice. European Journal of Gastroenterology & Hepatology, 16(2), 127–133. Schuppan, D., Ruehl, M., Somasundaram, R., & Hahn, E. G. (2001). Matrix as a modulator of hepatic fibrogenesis. Seminars in Liver Disease, 21(3), 351–372. Somerville, R. P., Oblander, S. A., & Apte, S. S. (2003). Matrix metalloproteinases: Old dogs with new tricks. Genome Biology, 4(6), 216. Strongin, A. Y., Collier, I., Bannikov, G., Marmer, B. L., Grant, G. A., & Goldberg, G. I. (1995). Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. The Journal of Biological Chemistry, 270(10), 5331–5338. Sweeney, B., Vora, M., Ulbricht, C., & Basch, E. (2005). Evidence-based systematic review of dandelion (Taraxacum officinale) by natural standard research collaboration. Journal of Herbal Pharmacotherapy, 5(1), 79–93. Tietze, F. (1969). Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: Applications to mammalian blood and other tissues. Analytical Biochemistry, 27(3), 502–522. Ueberham, E., Low, R., Ueberham, U., Schonig, K., Bujard, H., & Gebhardt, R. (2003). Conditional tetracycline-regulated expression of TGF-beta1 in liver of transgenic mice leads to reversible intermediary fibrosis. Hepatology, 37(5), 1067–1078. Wallace, K., Burt, A. D., & Wright, M. C. (2008). Liver fibrosis. The Biochemical Journal, 411(1), 1–18. Yang, C., Zeisberg, M., Mosterman, B., Sudhakar, A., Yerramalla, U., Holthaus, K., et al. (2003). Liver fibrosis: Insights into migration of hepatic stellate cells in response to extracellular matrix and growth factors. Gastroenterology, 124(1), 147–159.