- Email: [email protected]
Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice
Accepted Manuscript Title: Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice Author: Bin Wang Yansen Li Masami Mizu Toma Furuta Chunmei Li PII: DOI: Reference:
S0040-8166(16)30237-3 http://dx.doi.org/doi:10.1016/j.tice.2016.12.008 YTICE 1066
To appear in:
Tissue and Cell
Received date: Revised date: Accepted date:
28-9-2016 13-12-2016 24-12-2016
Please cite this article as: Wang, Bin, Li, Yansen, Mizu, Masami, Furuta, Toma, Li, Chunmei, Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice.Tissue and Cell http://dx.doi.org/10.1016/j.tice.2016.12.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice
Bin Wang1,2, Yansen Li1, Masami Mizu3, Toma Furuta3 and Chunmei Li1,*
1College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, 210095, China 2Jiangsu Food & Pharmaceutical Science College, Huaian, 223005, China 3Product Development Division, Mitsui Sugar Co., Ltd. Tokyo, 103-8423, Japan
* Corresponding author: C. Li, email: [email protected] Bin Wang and Yansen Li contributed equally to this work.
College of Animal Science and Technology, Nanjing Agricultural University, No.1 Weigang, Nanjing 210095, PR China. Tel: +86-025-84395971; Fax: +86-025-84395314.
Abbreviations: SCE, sugar cane extract; DSS, dextran sulfate sodium; Nrf2, nuclear factor E2-related factor 2; CAT, catalase; SOD1, superoxide dismutase 1; Gpx1, glutathione peroxidase 1; Gpx4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha; GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability; ZO-1, zona occludens-1; IBD, inflammatory bowel disease
Highlights
1. SCE improved growth performance and spleen relative weight in the DSS-induced inflammation. 2. SCE upregulated the colonic SOD1 expression. 3. SCE alleviated DSS-disturbed tight junctions and the DSS-induced inflammation. 4. SCE ameliorated the DSS-promoted effect on the p65 nuclear accumulation and the
DSS-inhibited effect on the Nrf2 nuclear accumulation.
Abstract Sugar cane extract (SCE) exhibits various biological effects and has been reported to enhance animal growth performance. However, the effect of SCE on inflammation in animals is still obscure. To study the effects and underlying mechanism of SCE on dextran sulfate sodium (DSS)-induced colonic inflammation, forty female ICR mice (26.63 ± 0.19g, 6-week-old) were assigned into four groups: a control group (Cont), a DSS-challenged group (DSS), a SCE-supplemented group (SCE), and a DSS+SCE group (DSS+SCE). Mice in Cont group and DSS group were fed basic diet and other mice received 1% SCE supplemented in basic diet from 6-week to 8-week-old. Mice in DSS and DSS+SCE groups were also given a 4% DSS solution from 7-week to 8-week-old via drinking water to induce colonic inflammation. After 2 weeks, mice were sacrificed and samples were collected. The results showed that dietary SCE alleviated DSS induced growth suppression, splenic damage, colonic histological changes, colonic inflammation, oxidative stress, and colonic dysfunction of tight junctions. Meanwhile, the DSS exposure activated nuclear transcription factor kappa B p65 and inhibited nuclear factor E2-related factor 2 (Nrf2), while SCE markedly attenuated the DSS-promoted effect on the p65 nuclear accumulation and the DSS-inhibited effect on the Nrf2 nuclear accumulation. In conclusion, SCE conferred a protective role in the DSS-induced inflammation and the mechanism might be associated with the activated signals of the nuclear factor kappa B p65 and Nrf2. Keywords: Sugar cane extract; Inflammation; Oxidative stress; Tight junction; Mouse
1. Introduction Sugar cane extract (SCE) is natural byproducts in sugar cane industry after removing glucose, fructose, and sucrose, and contains large abundances of phenolics and flavonoids. Previous reports suggest that dietary SCE improves growth performance in pigs and chickens (Hikosaka et al., 2007; Lo et al., 2006). Recent evidence suggested that SCE exhibited various biological effects, such as immunostimulation and antioxidative functions (Amer et al., 2004; Bazer et al., 2015; Chung et al., 2011). In pseudorabies virus infection, dietary supplementation with SCE improved the immune function and enhanced the activity of nature kill cells in pigs (Lo et al., 2005). Chen et al. also reported that dietary SCE enhanced the biological function of neutrophils and the anti-inflammatory function that might play a beneficial role in bacterial infections in mice. In addition, SCE might play an antioxidative role in many physiological conditions via scavenging free radical species (Chung et al., 2011; Valli et al., 2012). However, it is not clear about the mechanism underlying these positive effects on animals fed with SCE. Recently, some studies reported an anti-inflammatory effect of SCE in different animal models. In the zymosan-induced arthritis, sugar cane alleviated the inflammatory response through its inhibitory effects on the arachidonic acid metabolism in mice (Ledon et al., 2007). In the lipopolysaccharide (LPS)-challenged mice, dietary SCE markedly inhibited the expression and amount of inflammatory cytokines (Hikosaka et al., 2006). Colonic inflammation is a chronic intestinal inflammatory response and has been considered as one of the most intractable gastrointestinal diseases, which may further develop into colorectal cancer and influence life quality of patients (Utrilla et al., 2015; Wurth et al., 2015; Xiong et al., 2015). Currently, aminosalicylic, immunosuppressor and steroid hormone are main drugs for treating colonic inflammation. Previous studies were carried to find new drugs from extracts and activate compounds of herbs to prevent or treat the colonic inflammation. However, there is little reference about the effects of SCE on colonic
inflammation. Thus, we hypothesized that dietary SCE alleviates inflammatory response in animals. In the present study, the anti-inflammatory effect and the antioxidative activity were investigated to verify the protective function of dietary supplementation with SCE on the dextran sulfate sodium (DSS)-induced colonic inflammatory response in mice, since this model induced production of multiple inflammatory and pro-inflammatory mediators. We hypothesized that SCE would protect mice against the DSS-induced colonic inflammation via enhancing the anti-inflammatory and antioxidative functions. 2. Material and Methods 2.1. SCE composition SCE was extracted from sugar cane juice (Saccharum officinarum L.) by chromatographic separation on an ion exchange column and kindly provided by Mitsui Sugar Co., Japan. The composition of SCE powder consists of 10.47% crude protein, 1.33% crude fiber, 3.02% crude fat, 67.83% nitrogen-free extracts and 9.08% ash. The relative content of sugarcane polyphenols is 8.54 mg/g. The amino acid contents
(mg/g)
of
SCE
determined
via
an
isotope
dilution
liquid
chromatography-mass spectrometry were as following: Asp+Asn 9.876, Thr 2.727, Ser 4.091, Glu+Gln 30.675, Gly 3.079, Ala 3.209, Cys 0.746, Val 3.826, Met 0.207, Ile 2.882, Leu 5.717, Tyr 1.088, Phe 4.653, Lys 1.529, His 1.707, Arg 2.259, and Pro 4.187. SCE was mixed with bread flour (1:4) and then used for dietary supplementation in this study. 2.2. Animal model and groups Forty female ICR mice (26.63 ± 0.19g, 6-week-old) were randomly divided into four groups: one water control group (n = 10), one DSS challenged group (n = 10), one SCE supplemented group (n = 10), and one DSS+SCE group (n = 10). Mice in
control group and DSS group were fed basic diet (Table 1) and the other mice received 1% SCE supplemented in basic diet from 6-week to 8-week-old for 14 days, according to our previous results (unpublished data). At 7-week-old, mice in the DSS and the DSS+SCE groups were also given a 4% DSS solution (KAYON Bio. Technology Co. Ltd) for 7 days (day 8 to day 14 of the experiment) via drinking water to induce the colonic inflammation (Sann et al., 2013). After the experimental period (14 days), all mice were sacrificed, and the colonic length and the weights of the liver, spleen, and kidney were recorded (n=10). Before slaughter, eight blood samples in each group were collected by orbital blood collection. One piece of colonic sample (1g) was collected in liquid nitrogen and stored at -70 ºC for PCR analysis. This study was approved by the animal welfare committee of the Jiangsu Food & Pharmaceutical Science College. 2.3. Histomorphometry determination The morphological determination was measured using haematoxylin and eosin (HE) staining. Briefly, one piece of each colonic samples (0.5 cm) was stored in 10% formalin, which was further mounted in the paraffin blocks. Six-micrometer-thick sections were cut from the paraffin blocks and then stained with HE. All HE staining specimens were determined under a light microscope (Nikon, Japan). Colonic villus height and crypt depth were investigated by an image-analysis system (Yin et al., 2015). 2.4. Serum oxidative indexes Blood samples were collected with orbital blood collection and stored at 4 ºC for 4 hours and then serum from each mice were separated after blood centrifugation at 3,500 × g and 4 ºC for 15 min. Serum malondialdehyde (MDA), glutathione peroxidase (GSH-PX), and total antioxidant capability (T-AOC) were measured (Nanjing Jiancheng, China) (Yin et al., 2015).
2.5. Quantification mRNA Total RNA from colonic samples were isolated with TRIZOL regent (Invitrogen, USA) and then treated with DNase I (Invitrogen, USA) to extract RNA. Synthesis of the first strand (cDNA) was conducted using oligo (dT) 20 and Superscript II reverse transcriptase (Invitrogen, USA). Primers used in this study were designed by Primer 5.0 to produce an amplification product and the detailed sequences were shown in Table 2. The protocol of RT-PCR was according to previous report (Yin et al., 2014). The relative mRNA expression of target genes were normalized and expressed as a ratio compared with the control group. 2.6. Western bolt Proteins from colonic tissues were extracted with protein extraction reagents (Thermo Fisher Scientific Inc., USA). Proteins (30-50 µg) were run in a SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to apolyvinylidene difluoride (PVDF) membrane (BioRad, Hercules, CA, USA). Membranes were further blocked and then incubated with the following primary antibodies: ZO-1 (ab59720), Claudin1 (ab115225), Occludin (ab31721), nuclear transcription factor kappa B p65 (p65) (ab16502), and nuclear factor E2-related factor 2 (Nrf2) (ab62352) (Abcam, Inc., USA). Mouse β-actin primary antibody (Sigma) was used as the loading control for western blotting analysis. Membranes were washed five times and incubated with second antibodies, which were further washed five times and quantified using the image J program (NIH) (Yin et al., 2015). 2.7. Statistical analysis All data were analyzed using IBM SPSS 21.0. Comparisons between groups were used the one-way analysis of variance (ANOVA) followed with Tukey’s multiple comparison test. Data are expressed as the mean ± SEM in this study and
values in the same row with different superscripts (a, b, c) are significant (P<0.05). 3. Results 3.1. Effects of SCE on average daily weight gain and relative organ weights During the experimental period from day 0 to day 7, dietary SCE markedly increased average daily weight gain (P<0.05) (Table 3). The DSS-challenge significantly inhibited average daily weight gain compared with the control group from day 8 to day 14 (P<0.05), while SCE alleviated the DSS-induced growth suppression (P<0.05). Liver, kidney, and spleen were weighed to calculate the relative organ weights and the results showed that the DSS-challenge increased spleen weight (P<0.05) (Table 3), which might induce splenic damage. However, dietary supplementation with 1% SCE reduced spleen weight compared with the DSS group. 3.2. Effects of SCE on colonic morphology As shown in Table 4, colonic morphology was determined via HE staining after DSS treatment. The results showed that the DSS-challenge enhanced colonic infiltration of inflammatory cells. In Figure 1, colon in the DSS+SCE group showed only mild infiltration of inflammatory cells to the mucosa compared with the DSS group. Colonic length is always used as a clinical index for colonic inflammation. The current data failed to notice any significant difference between the control and the DSS group. Dietary SCE markedly increased colonic length in the DSS+SCE group compared with the DSS group (P<0.05). 3.3. Effects of SCE on DSS-induced colonic inflammation As shown in Table 5, the relative mRNA expression of IL-1β, IL-10, IL-17, and TNF-α were investigated. The results exhibited that the DSS exposure markedly increased the relative mRNA expression of IL-1β, IL-17, and TNF-α (P<0.05), indicating an inflammatory response following the DSS challenge. Although SCE
failed to downregulate the relative mRNA expression of IL-1β and TNF-α, the relative mRNA abundance of IL-17 was markedly lower in the DSS+SCE group than that in the DSS group (P<0.05). 3.4. Effects of SCE on DSS-induced colonic oxidative stress Serum GSH-PX, MDA, and T-AOC were measured and shown in Table 6. The results showed that DSS exposure increased serum MDA level and inhibited T-AOC activity (P<0.05), while dietary supplementation with SCE failed to alleviate the DSS-induced oxidative stress (P>0.05). As shown in Table 5, RT-PCR was conducted to investigate the relative mRNA expression of the antioxidant genes after DSS exposure and the results showed that the DSS challenge significantly decreased the relative mRNA expression of GPX4 (P<0.05), while SCE markedly increased the relative mRNA expression of SOD1 in the DSS+SCE and the SCE groups (P<0.05). 3.5. Effects of SCE on colonic tight junction in DSS-challenged mice As shown in Fig. 2, DSS exposure markedly decreased the protein expression of colonic ZO-1, Occludin, and Claudin1 (P<0.05). Dietary supplementation with SCE alleviated the DSS-induced decrease in the protein expression of Occludin and Claudin1 compared with those in the DSS group (P<0.05). 3.6. Effects of SCE on p65 and Nrf2 signals in DSS-challenged mice Western blot was used to investigate the protein expression of the p65 and Nrf2 signals after DSS exposure in Figure 3. DSS treatment markedly increased the nuclear p65 accumulation and decreased the nuclear Nrf2 accumulation (P<0.05). Dietary SCE failed to influence p65 abundance (P>0.05), while nuclear Nrf2 abundance was significantly higher in the DSS+SCE group than those in the DSS group (P<0.05). 4. Discussion
SCE is a natural product and exhibits many biological effects, such as the immunostimulation function, the antioxidative function, and the anti-inflammatory action (Chen et al., 2012; Hikosaka et al., 2006; Rashti and Koohsari, 2015). In the present study, the effects of dietary SCE on the DSS-induced inflammatory response, oxidative stress, and colonic function were investigated. The results showed that dietary SCE alleviated the DSS-induced inflammatory response, oxidative stress, and colonic injury in mice, which might be associated with the p65 and Nrf2 signal pathway. SCE functioned as the growth-promoting action. Amer et al. reported that SCE markedly increased body weight at the first and second weeks after SCE administration in chickens (El-Abasy et al., 2002). In the present study, we found a marked increase in average daily weight gain in mice fed with dietary SCE. Meanwhile, SCE markedly alleviated the DSS-induced growth suppression. Previous study reported SCE slightly impacted the relative organ weight in the spleen, thymus, and bursa (El-Abasy et al., 2002). In this study, the results showed that dietary SCE reduced the relative splenic weight, indicating that SCE improved the growth performance and attenuated the inflammation response in the DSS-induced inflammation. In the present study, DSS was used to induce colonic inflammation according to previous reports (Ren et al., 2014). The results showed that DSS challenge caused colonic inflammatory response evidenced by the increased relative mRNA expression of IL-1β, IL-17, and TNF-α. Moreover, dietary SCE markedly inhibited the relative mRNA expression of IL-17 following the DSS challenge, indicating that SCE might be functioned as an anti-inflammatory action. Previous reports demonstrated that IL-17/IL-23 axis activation led to the occurrence and development of the inflammatory bowel disease (IBD) in experimental animal studies (Abdel Hadi et al., 2016; Behrens et al., 2015; Catana et al., 2015; Choi et al., 2015; Gooderham et al., 2015). Thus, inhibition of IL-17 via dietary additive might serve as a pharmacological
drug for IBD (Fitzpatrick, 2013; Li et al., 2015). Oxidative stress has been observed in many inflammatory models, including the trinitro-benzene-sulfonic acid-induced and the DSS-induced colonic inflammation responses (Banan et al., 2005; Banan et al., 2007; Zhou et al., 2016). Antioxidant agents play a beneficial role in inflammatory response via enhancing the antioxidative function and decreasing pro-inflammatory cytokines production (Hendy and Gemeai, 2014; Hirai and Matsui, 2015; James et al., 2012; Rao et al., 2015; Resta-Lenert et al., 2008; Shahandeh et al., 2015; Zhu et al., 2015). In the present study, results showed that SCE upregulated SOD1 expression, which
might
further
enhance
the
antioxidative
function
and
mediate
anti-inflammatory response in mice after the DSS challenge. Tight junction plays an important role in protecting the intestine against infections. The disturbance of tight junctions could cause intestinal barrier dysfunction and injury (Hu et al., 2015; Li et al., 2014). Compelling evidence showed that intestinal infection and inflammatory response could dysregulate tight junction function (Lee, 2015). Yamauchi et al. reported that dietary 0.05, 1, and 3% SCE improved intestinal histology in chickens via mediating intestinal villus height, villus area, epithelial cell area and cell mitosis (Yamauchi et al., 2006a, b). Moreover, SCE was also demonstrated to improve the intestinal structure and barrier integrity (Yamauchi et al., 2006a). In the present study, the DSS challenge reduced colonic protein expression of ZO-1, Occludin, and Claudin1, while dietary SCE alleviated the DSS-induced damages in the tight junctions. These results implying that dietary SCE might play a protective role via the increasing protein expression of the colonic Occludin and Claudin1. The nuclear factor p65 controls many genes expression in the biological processions, which are associated with the inflammatory responses, apoptosis, and the immune function (Cao et al., 2014; Ma et al., 2015). Many stimuli factors like oxidative stress, inflammatory cytokines, and bacterial infection could activate p65 and translocate the cytoplasmatic p65 into the nucleus (Yin et al., 2013). In the
present study, DSS markedly enhanced nuclear p65 translocation, which might mediate colonic inflammation. Meanwhile, the Nrf2 translocation into nuclei could promote the expression of a great number of cytoprotective and detoxificant genes (Buendia et al., 2016; Yin et al., 2013). The activated Nrf2-antioxdative signaling pathway could confer a beneficial role in the DSS-induced inflammation (Wang et al., 2016). In the present study, the results showed that dietary SCE markedly alleviated the DSS-promoted effect on the p65 nuclear accumulation and the DSS-inhibited effect on the Nrf2 nuclear accumulation, suggesting that the protective mechanism of SCE in the colonic inflammation and oxidative stress might be associated with the p65 and Nrf2 signal pathway in mice. A possible mechanism underlying the protective effect of SCE against the DSS-induced colonic inflammation, oxidative stress and tight junction dysfunction in mouse colon was shown in Figure 4. The DSS challenge increased the proinflammatory IL-17 expression, and further activated the p65 signal pathway, which promoted the transcription of downstream proinflammatory genes (TNF-α and IL-1β) and enhanced the colonic inflammation. The DSS challenge induced the colonic oxidative stress via decreasing the antioxidative substances (GPX1 and GPX4) and weakening the antioxidative capacity (GSH-PX and T-AOC). The DSS challenge caused the colonic tight junction dysfunction by down-regulating the tight junction-related proteins (ZO-1, Claudin1 and Occludin). SCE plays a beneficial role in the DSS-induced colonic inflammation, oxidative stress and tight junction dysfunction via inhibiting the IL-17 expression, activating the SOD1 and Nrf2-related signal pathway, and relieving the DSS-induced low expression of the tight junction-related proteins, respectively. Acknowledgments This study was jointly supported by the National Key Research and Development Program of China (2016YFD0500505), National Natural Science Foundation of China (No. 31272485 and No.31402116), and Jiangsu Qinglan Project (201615).
Competing interests The authors declared that they have no competing interests.
References
Abdel Hadi, L., Di Vito, C., Riboni, L., 2016. Fostering Inflammatory Bowel Disease: Sphingolipid Strategies to Join Forces. Mediators Inflamm 2016, 3827684. Amer, S., Na, K.J., El-Abasy, M., Motobu, M., Koyama, Y., Koge, K., Hirota, Y., 2004. Immunostimulating effects of sugar cane extract on X-ray radiation induced immunosuppression in the chicken. Int Immunopharmacol 4, 71-77. Banan, A., Shaikh, M., Mutlu, E., Kommanduri, S., Farhadi, A., Polzin, L., Liccardi, N., Zhang, L.J., Keshavarzian, A., 2005. Changes in distinct PKC Isoforms - Upregulation of atypical PKC-lambda and downregulation of classical PKC-beta-1-predict tissue oxidative stress and NF-kappa B activation in mucosa of patients with inflammatory bowel disease (IBD). Gastroenterology 128, A304-A304. Banan, A.C., Shaikh, M., Zhang, L.J., Forsyth, C.B., Farhadi, A., Mutlu, E., Tang, Y., Keshavarzian, A., 2007. A unique inflammatory mechanism for intestinal injury during IBD: Modulation of a distinct phospholipase C-gamma 1 (PLC-gamma 1) dependent pathway could underlie EGF-Receptor initiated pathways that lead to mucosal oxidative stress and Nf-kappa B activation in man. Gastroenterology 132, A363-A363. Bazer, F.W., Wang, X., Johnson, G.A., Wu, G., 2015. Select nutrients and their effects on conceptus development in mammals. Animal Nutrition 1, 85-95. Behrens, G., Jochem, C., Schmid, D., Keimling, M., Ricci, C., Leitzmann, M.F., 2015. Physical activity and risk of pancreatic cancer: a systematic review and meta-analysis. Eur J Epidemiol 30, 279-298. Buendia, I., Michalska, P., Navarro, E., Gameiro, I., Egea, J., Leon, R., 2016. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther 157, 84-104. Cao, A.T., Yao, S., Stefka, A.T., Liu, Z., Qin, H., Liu, H., Evans-Marin, H.L., Elson, C.O., Nagler, C.R., Cong, Y., 2014. TLR4 regulates IFN-gamma and IL-17 production by both thymic and induced Foxp3+ Tregs during intestinal inflammation. J Leukoc Biol 96, 895-905. Catana, C.S., Berindan Neagoe, I., Cozma, V., Magdas, C., Tabaran, F., Dumitrascu, D.L., 2015. Contribution of the IL-17/IL-23 axis to the pathogenesis of inflammatory bowel disease. World J Gastroenterol 21, 5823-5830. Chen, M.H., Lo, D.Y., Liao, J.W., Hsuan, S.L., Chien, M.S., Lin, C.C., Chen, T.H., Lee, W.C., 2012. Immunostimulation of sugar cane extract on neutrophils to Salmonella typhimurium infection in mice. Phytother Res 26, 1062-1067. Choi, A.-J., Buisson, N., Kim, C.-T., 2015. Digestion characteristics and kinetic analysis of bio-molecules in a simulated human intestinal system. Integr Food Nutr Metab 2, 189-192. Chung, Y.M., Wang, H.C., El-Shazly, M., Leu, Y.L., Cheng, M.C., Lee, C.L., Chang, F.R., Wu, Y.C., 2011. Antioxidant and tyrosinase inhibitory constituents from a desugared sugar cane extract, a byproduct of sugar production. J Agric Food Chem 59, 9219-9225. El-Abasy, M., Motobu, M., Shimura, K., Na, K.J., Kang, C.B., Koge, K., Onodera, T., Hirota, Y., 2002. Immunostimulating and growth-promoting effects of sugar cane extract (SCE) in chickens. J Vet Med Sci 64, 1061-1063. Fitzpatrick, L.R., 2013. Inhibition of IL-17 as a Pharmacological Approach for IBD. International Reviews of Immunology 32, 544-555. Gooderham, M., Posso-De Los Rios, C.J., Rubio-Gomez, G.A., Papp, K., 2015. Interleukin-17 (IL-17)
inhibitors in the treatment of plaque psoriasis: a review. Skin Therapy Lett 20, 1-5. Hendy, H.A.-R.E., Gemeai, A.R.O.A.-. 2014. Effect of broccoli intake on antioxidant in the liver and kidney tissues of hyperglycemic rats. Integr Food Nutr Metab 1, 1-6. Hikosaka, K., El-Abasy, M., Koyama, Y., Motobu, M., Koge, K., Isobe, T., Kang, C.B., Hayashidani, H., Onodera, T., Wang, P.C., Matsumura, M., Hirota, Y., 2007. Immunostimulating effects of the polyphenol-rich fraction of sugar cane (Saccharum officinarum L.) extract in chickens. Phytother Res 21, 120-125. Hikosaka, K., Koyama, Y., Motobu, M., Yamada, M., Nakamura, K., Koge, K., Shimura, K., Isobe, T., Tsuji, N., Kang, C.B., Hayashidani, H., Wang, P.C., Matsumura, M., Hirota, Y., 2006. Reduced lipopolysaccharide (LPS)-induced nitric oxide production in peritoneal macrophages and inhibited LPS-induced lethal shock in mice by a sugar cane (Saccharum officinarum L.) extract. Biosci Biotechnol Biochem 70, 2853-2858. Hirai, F., Matsui, T., 2015. Status of food intake and elemental nutrition in patients with Crohn’s disease. Integr Food Nutr Metab 2, 148-150. Hu, C.-A.A., Hou, Y., Yi, D., Qiu, Y., Wu, G., Kong, X., Yin, Y., 2015. Autophagy and tight junction proteins in the intestine and intestinal diseases. Animal Nutrition 1, 123-127. James, A.M., Collins, Y., Logan, A., Murphy, M.P., 2012. Mitochondrial oxidative stress and the metabolic syndrome. Trends Endocrinol Metab 23, 429-434. Ledon, N., Casaco, A., Remirez, D., Gonzalez, A., Cruz, J., Gonzalez, R., Capote, A., Tolon, Z., Rojas, E., Rodriguez, V.J., Merino, N., Rodriguez, S., Ancheta, O., Cano, M.C., 2007. Effects of a mixture of fatty acids from sugar cane (Saccharum officinarum L.) wax oil in two models of inflammation: zymosan-induced arthritis and mice tail test of psoriasis. Phytomedicine 14, 690-695. Lee, S.H., 2015. Intestinal permeability regulation by tight junction: implication on inflammatory bowel diseases. Intest Res 13, 11-18. Li, X., Wang, Q., Xu, H., Tao, L., Lu, J., Cai, L., Wang, C., 2014. Somatostatin regulates tight junction proteins expression in colitis mice. Int J Clin Exp Pathol 7, 2153-2162. Li, Y., Liu, Y., Chu, C.Q., 2015. Th17 Cells in Type 1 Diabetes: Role in the Pathogenesis and Regulation by Gut Microbiome. Mediators Inflamm 2015, 638470. Lo, D.Y., Chen, T.H., Chien, M.S., Koge, K., Hosono, A., Kaminogawa, S., Lee, W.C., 2005. Effects of sugar cane extract on the modulation of immunity in pigs. J Vet Med Sci 67, 591-597. Lo, D.Y., Chien, M.S., Yeh, K.S., Koge, K., Lin, C.C., Hsuan, S.L., Lee, W.C., 2006. Effects of sugar cane extract on pseudorabies virus challenge of pigs. J Vet Med Sci 68, 219-225. Ma, W., Wang, J., Li, Y., Hu, X., Shi, F., Wang, X., 2015. Enhancing pentose phosphate pathway in Corynebacterium glutamicum to improve l-isoleucine production. Biotechnol Appl Biochem. Rao, P.V.L.N.S., Kiranmayi, V.S., Swathi, P., Jeyseelan, L., Suchitra, M.M., Bitla, A.R., 2015. Comparison Of Two Analytical Methods Used For The Measurement Of Total Antioxidant Status. Journal of antioxidant activity 1, 22-28. Rashti, Z., Koohsari, H., 2015. Antibacterial effects of supernatant of lactic acid bacteria isolated from different Dough's in Gorgan city in north of Iran. Integr Food Nutr Metab 2, 193-196. Ren, W., Yin, J., Wu, M., Liu, G., Yang, G., Xion, Y., Su, D., Wu, L., Li, T., Chen, S., Duan, J., Yin, Y., Wu, G., 2014. Serum amino acids profile and the beneficial effects of L-arginine or L-glutamine supplementation in dextran sulfate sodium colitis. PLoS One 9, e88335. Resta-Lenert, S.C., Maruggi, M., Ho, C., 2008. Synbiotics protect against oxidative stress in inflammatory bowel disease (IBD) by inducing phase 2 response enzymes. Gastroenterology 134,
A89-A89. Sann, H., Erichsen, J., Hessmann, M., Pahl, A., Hoffmeyer, A., 2013. Efficacy of drugs used in the treatment of IBD and combinations thereof in acute DSS-induced colitis in mice. Life Sci 92, 708-718. Shahandeh, A., Purushothuman, S., Martin, K., Graham, M., Johnstone, D.M., Milward, E.A., 2015. Anti-Oxidant Phytochemicals As Potential Treatments For Age-Related Macular Degeneration. Journal of antioxidant activity 1, 29-41. Utrilla, M.P., Peinado, M.J., Ruiz, R., Rodriguez-Nogales, A., Algieri, F., Rodriguez-Cabezas, M.E., Clemente, A., Galvez, J., Rubio, L.A., 2015. Pea (Pisum sativum L.) seed albumin extracts show anti-inflammatory effect in the DSS model of mouse colitis. Molecular Nutrition & Food Research 59, 807-819. Valli, V., Gomez-Caravaca, A.M., Di Nunzio, M., Danesi, F., Caboni, M.F., Bordoni, A., 2012. Sugar cane and sugar beet molasses, antioxidant-rich alternatives to refined sugar. J Agric Food Chem 60, 12508-12515. Wang, Y., Wang, H., Qian, C., Tang, J., Zhou, W., Liu, X., You, Q., Hu, R., 2016. 3-(2-Oxo-2-phenylethylidene)-2,3,6,7-tetrahydro-1H-pyrazino[2,1-a]isoquinolin-4(1
1bH)-one
(compound 1), a novel potent Nrf2/ARE inducer, protects against DSS-induced colitis via inhibiting NLRP3 inflammasome. Biochem Pharmacol 101, 71-86. Wurth, R., Lagkouvardos, I., Clavel, T., Wilke, J., Foerst, P., Kulozik, U., Haller, D., Hormannsperger, G., 2015. Physiological relevance of food grade microcapsules: Impact of milk protein based microcapsules on inflammation in mouse models for inflammatory bowel diseases. Molecular Nutrition & Food Research 59, 1629-1634. Xiong, Y.J., Chen, D.P., Yu, C.C., Lv, B.C., Peng, J.Y., Wang, J.Y., Lin, Y., 2015. Citrus nobiletin ameliorates experimental colitis by reducing inflammation and restoring impaired intestinal barrier function. Molecular Nutrition & Food Research 59, 829-842. Yamauchi, K., Buwjoom, T., Koge, K., Ebashi, T., 2006a. Histological alterations of the intestinal villi and epithelial cells in chickens fed dietary sugar cane extract. Br Poult Sci 47, 544-553. Yamauchi, K., Buwjoom, T., Koge, K., Ebashi, T., 2006b. Histological intestinal recovery in chickens refed dietary sugar cane extract. Poult Sci 85, 645-651. Yin, J., Liu, M., Ren, W., Duan, J., Yang, G., Zhao, Y., Fang, R., Chen, L., Li, T., Yin, Y., 2015. Effects of dietary supplementation with glutamate and aspartate on diquat-induced oxidative stress in piglets. PLoS One 10, e0122893. Yin, J., Ren, W.K., Wu, X.S., Yang, G., Wang, J., Li, T.J., Ding, J.N., Cai, L.C., Su, D.D., 2013. Oxidative stress-mediated signaling pathways: A review. Journal of Food Agriculture & Environment 11, 132-139. Yin, J., Wu, M.M., Xiao, H., Ren, W.K., Duan, J.L., Yang, G., Li, T.J., Yin, Y.L., 2014. Development of an antioxidant system after early weaning in piglets. J Anim Sci 92, 612-619. Zhou, J., Liu, B., Liang, C., Li, Y., Song, Y.H., 2016. Cytokine Signaling in Skeletal Muscle Wasting. Trends Endocrinol Metab 27, 335-347. Zhu, L., Sun, Y., Zhang, G., Yu, P., Wang, Y., Zhang, Z., 2015. Radical-Scavenging And Anti-Oxidative Activities Of TBN In Cell-Free System And Murine H9c2 Cardiomyoblast Cells. Journal of antioxidant activity 1, 55-68.
Figure Legends
Fig. 1. Effects of dietary SCE on colonic histological structure after DSS exposure in mice via HE staining (×100 and ×400). A significant infiltration of inflammatory cells were noticed in the DSS group compared with the control. Colon in the DSS+SCE group showed only mild infiltration of inflammatory cells to the mucosa compared with the DSS group. Black arrows indicate the infiltration of inflammatory cells. Fig. 2. Effects of dietary SCE on colonic tight junctions after DSS exposure in mice. Data are presented as mean ± SEM. (A). ZO-1 expression; (B). Occludin expression; (C). Claudin1 expression. Fig. 3. Effects of dietary SCE on colonic p65 and Nrf2 after DSS exposure in mice. Data are presented as mean ± SEM. (A). p65 expression; (B). Nrf2 expression. Fig. 4. Schema showing how SCE may attenuate the DSS-induced colonic inflammation, oxidative stress, and tight junction dysfunction in the mouse colon. Red arrows: up-regulated or down-regulated expression; Black arrows: direct stimulatory modification; Dull arrows: direct inhibitory modification. SCE, sugar cane extract; DSS, dextran sulfate sodium; Nrf2, nuclear factor E2-related factor 2; SOD1, superoxide dismutase 1; GPX1, glutathione peroxidase 1; GPX4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha; GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability; ZO-1, zona occludens-1.
Table 1. Composition of the basal diet Ingredients
Amount, g/kg diet
Nutrient level
Amount
Corn meal Soybean meal Wheat bran Wheat flour Fish meal NaCl CaHPO4 CaCO3 Lard L-Lysine L-Methionine Mineral mix1 Vitamin mix2
520 200 110 90 30 2 10 12 20 2.5 2.7 0.6 0.2
Total energy, MJ/kg diet Crude protein, % Crude fat, % Starch, % Crude fiber, % Crude ash, % Calcium, % Phosphorus, %
15.2 21.9 4.2 50.1 4.4 6.3 1.07 0.69
1
Provided the following amount (mg/kg diet): 1) cobalt (as cyanococobalamin), 0.6; 2) copper (as CuSO4-5H2O), 5.0; 3) iodine (as CaI2), 0.48; 4) iron (as FeSO4), 75.0; 5) manganese (as MnO), 20.0; 6) selenium (as Na2SeO3), 0.40; and 7) zinc (as ZnO), 10.0 2
Provided the following amount (mg/kg diet): 1) all-rac-a-tocopheryl acetate, 64.0; 2) D-biotin,
0.2; 3) calcium d-pantothenate, 24.0; 4) cholecalciferol, 5.5; 5) folic acid, 6.0; 6) menadione sodium bisulfate, 2.2; 7) nicotinic acid, 30.3; 8) pyridoxine-HCL, 12.0; 9) retinyl acetate, 1.9; 10) riboflavin, 5.5; 11) thiamin-HCL, 13.0; 12) vitamin B-12, 0.022.
Table 2. PCR primer sequences: the forward primers (F) and the reverse primers (R) used in this study Gene
Accession No.
Nucleotide sequence of primers (5′–3′)
Size (bp)
β-Actin
NM_007393.3
117
CAT
XM_006498624.1
SOD1
NM_011434.1
Gpx1
NM_008160.6
Gpx4
NM_001037741.3
IL-1β
NM_008361.3
IL-10
NM_010548.2
IL-17
NM_010552.3
TNF-α
NM_013693.2
F:GTCCACCTTCCAGCAGATGT R:GAAAGGGTGTAAAACGCAGC F:AATATCGTGGGTGACCTCAA R:CAGATGAAGCAGTGGAAGGA F:CCACTGCAGGACCTCATTTT R:CACCTTTGCCCAAGTCATCT F:GGTTCGAGCCCAATTTTACA R:CCCACCAGGAACTTCTCAAA F:CTCCATGCACGAATTCTCAG R:ACGTCAGTTTTGCCTCATTG F:CTGTGACTCGTGGGATGATG R:GGGATTTTGTCGTTGCTTGT F: ACAGCCGGGAAGACAATAAC R: CAGCTGGTCCTTTGTTTGAAAG F:TACCTCAACCGTTCCACGTC R:TTTCCCTCCGCATTGACAC F:AGGCACTCCCCCAAAAGAT R:TGAGGGTCTGGGCCATAGAA
243 216 199 117 213 116 119 192
CAT, catalase; SOD1, superoxide dismutase 1; Gpx1, glutathione peroxidase 1; Gpx4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha.
Table 3. Effects of SCE on average daily weight gain and relative organ weights Item
Cont
Average daily weight gain (g) Day 0-7 0.16+0.05b Day 8-14 0.17+0.03b Organ relative weight (‰) Liver 45.80+2.53 Kidney 12.99+1.14 Spleen 3.24+0.19b
DSS
DSS+SCE
SCE
0.15+0.06b 0.07+0.04c
0.38+0.04a 0.36+0.05a
0.30+0.04a 0.35+0.12ab
45.50+4.32 13.05+0.84 4.35+0.67a
41.63+2.61 12.71+1.35 3.47+0.21b
41.99+2.96 13.28+1.04 3.54+0.25b
Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P< 0.05; n = 10).
Table 4. Effects of SCE on colonic weight and length after DSS exposure Item
Cont
DSS
DSS+SCE
SCE
Colonic weight (g) Colonic length (cm) W/L (100g/cm)
0.29+0.01 7.91+0.29ab 3.66+0.72
0.32+0.01 7.30+0.22b 3.94+0.22
0.30+0.01 9.19+0.26a 3.29+0.11
0.29+0.02 8.46+0.37ab 3.41+0.23
W/L, colonic weight versus colonic length. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 10).
Table 5. Effects of dietary SCE on colonic genes expression after DSS exposure in mice Item IL-1β Il-10 IL-17 TNF-α SOD1 GPX1 GPX4 CAT ZO-1 Occludin Claudin1
Cont
DSS b
1.03+0.07 1.08+0.45 1.09+0.18b 0.90+0.30b 0.64+0.13b 0.86+0.15ab 1.01+0.28a 0.92+0.22b 1.02+0.08a 0.97+0.26b 0.94+0.21
DSS+SCE a
2.09+0.26 1.51+0.42 1.78+0.26a 1.51+0.10a 0.75+0.11b 0.47+0.14b 0.73+0.14b 0.87+0.22b 0.64+0.11b 0.99+0.21b 0.72+0.17
ab
1.58+0.43 1.19+0.34 1.23+0.21b 1.23+0.18ab 1.14+0.15a 0.60+0.16b 0.85+0.19b 0.69+0.21b 0.52+0.10b 1.02+0.23b 0.68+0.14
SCE 1.42+0.17ab 1.39+0.10 1.24+0.18b 1.09+0.26b 1.16+0.13a 1.25+0.28a 1.21+0.21a 1.40+0.26a 0.91+0.14a 1.65+0.25a 0.85+0.18
ZO-1, zona occludens-1. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 8).
Table 6. Effects of dietary SCE on serum oxidative stress after DSS exposure in mice Item
Cont
DSS
DSS+SCE
SCE
GSH-PX U/L MDA nmol/mL T-AOC U/ML
91.86+3.70 63.53+2.97b 25.54+1.09a
84.17+3.47 75.15+5.57a 17.38+0.61b
87.96+3.97 77.79+5.30a 19.41+1.58ab
84.44+1.85 64.85+4.98b 21.97+0.57a
GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 8).
S0040-8166(16)30237-3 http://dx.doi.org/doi:10.1016/j.tice.2016.12.008 YTICE 1066
To appear in:
Tissue and Cell
Received date: Revised date: Accepted date:
28-9-2016 13-12-2016 24-12-2016
Please cite this article as: Wang, Bin, Li, Yansen, Mizu, Masami, Furuta, Toma, Li, Chunmei, Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice.Tissue and Cell http://dx.doi.org/10.1016/j.tice.2016.12.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Protective effect of sugar cane extract against dextran sulfate sodium-induced colonic inflammation in mice
Bin Wang1,2, Yansen Li1, Masami Mizu3, Toma Furuta3 and Chunmei Li1,*
1College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, 210095, China 2Jiangsu Food & Pharmaceutical Science College, Huaian, 223005, China 3Product Development Division, Mitsui Sugar Co., Ltd. Tokyo, 103-8423, Japan
* Corresponding author: C. Li, email: [email protected] Bin Wang and Yansen Li contributed equally to this work.
College of Animal Science and Technology, Nanjing Agricultural University, No.1 Weigang, Nanjing 210095, PR China. Tel: +86-025-84395971; Fax: +86-025-84395314.
Abbreviations: SCE, sugar cane extract; DSS, dextran sulfate sodium; Nrf2, nuclear factor E2-related factor 2; CAT, catalase; SOD1, superoxide dismutase 1; Gpx1, glutathione peroxidase 1; Gpx4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha; GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability; ZO-1, zona occludens-1; IBD, inflammatory bowel disease
Highlights
1. SCE improved growth performance and spleen relative weight in the DSS-induced inflammation. 2. SCE upregulated the colonic SOD1 expression. 3. SCE alleviated DSS-disturbed tight junctions and the DSS-induced inflammation. 4. SCE ameliorated the DSS-promoted effect on the p65 nuclear accumulation and the
DSS-inhibited effect on the Nrf2 nuclear accumulation.
Abstract Sugar cane extract (SCE) exhibits various biological effects and has been reported to enhance animal growth performance. However, the effect of SCE on inflammation in animals is still obscure. To study the effects and underlying mechanism of SCE on dextran sulfate sodium (DSS)-induced colonic inflammation, forty female ICR mice (26.63 ± 0.19g, 6-week-old) were assigned into four groups: a control group (Cont), a DSS-challenged group (DSS), a SCE-supplemented group (SCE), and a DSS+SCE group (DSS+SCE). Mice in Cont group and DSS group were fed basic diet and other mice received 1% SCE supplemented in basic diet from 6-week to 8-week-old. Mice in DSS and DSS+SCE groups were also given a 4% DSS solution from 7-week to 8-week-old via drinking water to induce colonic inflammation. After 2 weeks, mice were sacrificed and samples were collected. The results showed that dietary SCE alleviated DSS induced growth suppression, splenic damage, colonic histological changes, colonic inflammation, oxidative stress, and colonic dysfunction of tight junctions. Meanwhile, the DSS exposure activated nuclear transcription factor kappa B p65 and inhibited nuclear factor E2-related factor 2 (Nrf2), while SCE markedly attenuated the DSS-promoted effect on the p65 nuclear accumulation and the DSS-inhibited effect on the Nrf2 nuclear accumulation. In conclusion, SCE conferred a protective role in the DSS-induced inflammation and the mechanism might be associated with the activated signals of the nuclear factor kappa B p65 and Nrf2. Keywords: Sugar cane extract; Inflammation; Oxidative stress; Tight junction; Mouse
1. Introduction Sugar cane extract (SCE) is natural byproducts in sugar cane industry after removing glucose, fructose, and sucrose, and contains large abundances of phenolics and flavonoids. Previous reports suggest that dietary SCE improves growth performance in pigs and chickens (Hikosaka et al., 2007; Lo et al., 2006). Recent evidence suggested that SCE exhibited various biological effects, such as immunostimulation and antioxidative functions (Amer et al., 2004; Bazer et al., 2015; Chung et al., 2011). In pseudorabies virus infection, dietary supplementation with SCE improved the immune function and enhanced the activity of nature kill cells in pigs (Lo et al., 2005). Chen et al. also reported that dietary SCE enhanced the biological function of neutrophils and the anti-inflammatory function that might play a beneficial role in bacterial infections in mice. In addition, SCE might play an antioxidative role in many physiological conditions via scavenging free radical species (Chung et al., 2011; Valli et al., 2012). However, it is not clear about the mechanism underlying these positive effects on animals fed with SCE. Recently, some studies reported an anti-inflammatory effect of SCE in different animal models. In the zymosan-induced arthritis, sugar cane alleviated the inflammatory response through its inhibitory effects on the arachidonic acid metabolism in mice (Ledon et al., 2007). In the lipopolysaccharide (LPS)-challenged mice, dietary SCE markedly inhibited the expression and amount of inflammatory cytokines (Hikosaka et al., 2006). Colonic inflammation is a chronic intestinal inflammatory response and has been considered as one of the most intractable gastrointestinal diseases, which may further develop into colorectal cancer and influence life quality of patients (Utrilla et al., 2015; Wurth et al., 2015; Xiong et al., 2015). Currently, aminosalicylic, immunosuppressor and steroid hormone are main drugs for treating colonic inflammation. Previous studies were carried to find new drugs from extracts and activate compounds of herbs to prevent or treat the colonic inflammation. However, there is little reference about the effects of SCE on colonic
inflammation. Thus, we hypothesized that dietary SCE alleviates inflammatory response in animals. In the present study, the anti-inflammatory effect and the antioxidative activity were investigated to verify the protective function of dietary supplementation with SCE on the dextran sulfate sodium (DSS)-induced colonic inflammatory response in mice, since this model induced production of multiple inflammatory and pro-inflammatory mediators. We hypothesized that SCE would protect mice against the DSS-induced colonic inflammation via enhancing the anti-inflammatory and antioxidative functions. 2. Material and Methods 2.1. SCE composition SCE was extracted from sugar cane juice (Saccharum officinarum L.) by chromatographic separation on an ion exchange column and kindly provided by Mitsui Sugar Co., Japan. The composition of SCE powder consists of 10.47% crude protein, 1.33% crude fiber, 3.02% crude fat, 67.83% nitrogen-free extracts and 9.08% ash. The relative content of sugarcane polyphenols is 8.54 mg/g. The amino acid contents
(mg/g)
of
SCE
determined
via
an
isotope
dilution
liquid
chromatography-mass spectrometry were as following: Asp+Asn 9.876, Thr 2.727, Ser 4.091, Glu+Gln 30.675, Gly 3.079, Ala 3.209, Cys 0.746, Val 3.826, Met 0.207, Ile 2.882, Leu 5.717, Tyr 1.088, Phe 4.653, Lys 1.529, His 1.707, Arg 2.259, and Pro 4.187. SCE was mixed with bread flour (1:4) and then used for dietary supplementation in this study. 2.2. Animal model and groups Forty female ICR mice (26.63 ± 0.19g, 6-week-old) were randomly divided into four groups: one water control group (n = 10), one DSS challenged group (n = 10), one SCE supplemented group (n = 10), and one DSS+SCE group (n = 10). Mice in
control group and DSS group were fed basic diet (Table 1) and the other mice received 1% SCE supplemented in basic diet from 6-week to 8-week-old for 14 days, according to our previous results (unpublished data). At 7-week-old, mice in the DSS and the DSS+SCE groups were also given a 4% DSS solution (KAYON Bio. Technology Co. Ltd) for 7 days (day 8 to day 14 of the experiment) via drinking water to induce the colonic inflammation (Sann et al., 2013). After the experimental period (14 days), all mice were sacrificed, and the colonic length and the weights of the liver, spleen, and kidney were recorded (n=10). Before slaughter, eight blood samples in each group were collected by orbital blood collection. One piece of colonic sample (1g) was collected in liquid nitrogen and stored at -70 ºC for PCR analysis. This study was approved by the animal welfare committee of the Jiangsu Food & Pharmaceutical Science College. 2.3. Histomorphometry determination The morphological determination was measured using haematoxylin and eosin (HE) staining. Briefly, one piece of each colonic samples (0.5 cm) was stored in 10% formalin, which was further mounted in the paraffin blocks. Six-micrometer-thick sections were cut from the paraffin blocks and then stained with HE. All HE staining specimens were determined under a light microscope (Nikon, Japan). Colonic villus height and crypt depth were investigated by an image-analysis system (Yin et al., 2015). 2.4. Serum oxidative indexes Blood samples were collected with orbital blood collection and stored at 4 ºC for 4 hours and then serum from each mice were separated after blood centrifugation at 3,500 × g and 4 ºC for 15 min. Serum malondialdehyde (MDA), glutathione peroxidase (GSH-PX), and total antioxidant capability (T-AOC) were measured (Nanjing Jiancheng, China) (Yin et al., 2015).
2.5. Quantification mRNA Total RNA from colonic samples were isolated with TRIZOL regent (Invitrogen, USA) and then treated with DNase I (Invitrogen, USA) to extract RNA. Synthesis of the first strand (cDNA) was conducted using oligo (dT) 20 and Superscript II reverse transcriptase (Invitrogen, USA). Primers used in this study were designed by Primer 5.0 to produce an amplification product and the detailed sequences were shown in Table 2. The protocol of RT-PCR was according to previous report (Yin et al., 2014). The relative mRNA expression of target genes were normalized and expressed as a ratio compared with the control group. 2.6. Western bolt Proteins from colonic tissues were extracted with protein extraction reagents (Thermo Fisher Scientific Inc., USA). Proteins (30-50 µg) were run in a SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to apolyvinylidene difluoride (PVDF) membrane (BioRad, Hercules, CA, USA). Membranes were further blocked and then incubated with the following primary antibodies: ZO-1 (ab59720), Claudin1 (ab115225), Occludin (ab31721), nuclear transcription factor kappa B p65 (p65) (ab16502), and nuclear factor E2-related factor 2 (Nrf2) (ab62352) (Abcam, Inc., USA). Mouse β-actin primary antibody (Sigma) was used as the loading control for western blotting analysis. Membranes were washed five times and incubated with second antibodies, which were further washed five times and quantified using the image J program (NIH) (Yin et al., 2015). 2.7. Statistical analysis All data were analyzed using IBM SPSS 21.0. Comparisons between groups were used the one-way analysis of variance (ANOVA) followed with Tukey’s multiple comparison test. Data are expressed as the mean ± SEM in this study and
values in the same row with different superscripts (a, b, c) are significant (P<0.05). 3. Results 3.1. Effects of SCE on average daily weight gain and relative organ weights During the experimental period from day 0 to day 7, dietary SCE markedly increased average daily weight gain (P<0.05) (Table 3). The DSS-challenge significantly inhibited average daily weight gain compared with the control group from day 8 to day 14 (P<0.05), while SCE alleviated the DSS-induced growth suppression (P<0.05). Liver, kidney, and spleen were weighed to calculate the relative organ weights and the results showed that the DSS-challenge increased spleen weight (P<0.05) (Table 3), which might induce splenic damage. However, dietary supplementation with 1% SCE reduced spleen weight compared with the DSS group. 3.2. Effects of SCE on colonic morphology As shown in Table 4, colonic morphology was determined via HE staining after DSS treatment. The results showed that the DSS-challenge enhanced colonic infiltration of inflammatory cells. In Figure 1, colon in the DSS+SCE group showed only mild infiltration of inflammatory cells to the mucosa compared with the DSS group. Colonic length is always used as a clinical index for colonic inflammation. The current data failed to notice any significant difference between the control and the DSS group. Dietary SCE markedly increased colonic length in the DSS+SCE group compared with the DSS group (P<0.05). 3.3. Effects of SCE on DSS-induced colonic inflammation As shown in Table 5, the relative mRNA expression of IL-1β, IL-10, IL-17, and TNF-α were investigated. The results exhibited that the DSS exposure markedly increased the relative mRNA expression of IL-1β, IL-17, and TNF-α (P<0.05), indicating an inflammatory response following the DSS challenge. Although SCE
failed to downregulate the relative mRNA expression of IL-1β and TNF-α, the relative mRNA abundance of IL-17 was markedly lower in the DSS+SCE group than that in the DSS group (P<0.05). 3.4. Effects of SCE on DSS-induced colonic oxidative stress Serum GSH-PX, MDA, and T-AOC were measured and shown in Table 6. The results showed that DSS exposure increased serum MDA level and inhibited T-AOC activity (P<0.05), while dietary supplementation with SCE failed to alleviate the DSS-induced oxidative stress (P>0.05). As shown in Table 5, RT-PCR was conducted to investigate the relative mRNA expression of the antioxidant genes after DSS exposure and the results showed that the DSS challenge significantly decreased the relative mRNA expression of GPX4 (P<0.05), while SCE markedly increased the relative mRNA expression of SOD1 in the DSS+SCE and the SCE groups (P<0.05). 3.5. Effects of SCE on colonic tight junction in DSS-challenged mice As shown in Fig. 2, DSS exposure markedly decreased the protein expression of colonic ZO-1, Occludin, and Claudin1 (P<0.05). Dietary supplementation with SCE alleviated the DSS-induced decrease in the protein expression of Occludin and Claudin1 compared with those in the DSS group (P<0.05). 3.6. Effects of SCE on p65 and Nrf2 signals in DSS-challenged mice Western blot was used to investigate the protein expression of the p65 and Nrf2 signals after DSS exposure in Figure 3. DSS treatment markedly increased the nuclear p65 accumulation and decreased the nuclear Nrf2 accumulation (P<0.05). Dietary SCE failed to influence p65 abundance (P>0.05), while nuclear Nrf2 abundance was significantly higher in the DSS+SCE group than those in the DSS group (P<0.05). 4. Discussion
SCE is a natural product and exhibits many biological effects, such as the immunostimulation function, the antioxidative function, and the anti-inflammatory action (Chen et al., 2012; Hikosaka et al., 2006; Rashti and Koohsari, 2015). In the present study, the effects of dietary SCE on the DSS-induced inflammatory response, oxidative stress, and colonic function were investigated. The results showed that dietary SCE alleviated the DSS-induced inflammatory response, oxidative stress, and colonic injury in mice, which might be associated with the p65 and Nrf2 signal pathway. SCE functioned as the growth-promoting action. Amer et al. reported that SCE markedly increased body weight at the first and second weeks after SCE administration in chickens (El-Abasy et al., 2002). In the present study, we found a marked increase in average daily weight gain in mice fed with dietary SCE. Meanwhile, SCE markedly alleviated the DSS-induced growth suppression. Previous study reported SCE slightly impacted the relative organ weight in the spleen, thymus, and bursa (El-Abasy et al., 2002). In this study, the results showed that dietary SCE reduced the relative splenic weight, indicating that SCE improved the growth performance and attenuated the inflammation response in the DSS-induced inflammation. In the present study, DSS was used to induce colonic inflammation according to previous reports (Ren et al., 2014). The results showed that DSS challenge caused colonic inflammatory response evidenced by the increased relative mRNA expression of IL-1β, IL-17, and TNF-α. Moreover, dietary SCE markedly inhibited the relative mRNA expression of IL-17 following the DSS challenge, indicating that SCE might be functioned as an anti-inflammatory action. Previous reports demonstrated that IL-17/IL-23 axis activation led to the occurrence and development of the inflammatory bowel disease (IBD) in experimental animal studies (Abdel Hadi et al., 2016; Behrens et al., 2015; Catana et al., 2015; Choi et al., 2015; Gooderham et al., 2015). Thus, inhibition of IL-17 via dietary additive might serve as a pharmacological
drug for IBD (Fitzpatrick, 2013; Li et al., 2015). Oxidative stress has been observed in many inflammatory models, including the trinitro-benzene-sulfonic acid-induced and the DSS-induced colonic inflammation responses (Banan et al., 2005; Banan et al., 2007; Zhou et al., 2016). Antioxidant agents play a beneficial role in inflammatory response via enhancing the antioxidative function and decreasing pro-inflammatory cytokines production (Hendy and Gemeai, 2014; Hirai and Matsui, 2015; James et al., 2012; Rao et al., 2015; Resta-Lenert et al., 2008; Shahandeh et al., 2015; Zhu et al., 2015). In the present study, results showed that SCE upregulated SOD1 expression, which
might
further
enhance
the
antioxidative
function
and
mediate
anti-inflammatory response in mice after the DSS challenge. Tight junction plays an important role in protecting the intestine against infections. The disturbance of tight junctions could cause intestinal barrier dysfunction and injury (Hu et al., 2015; Li et al., 2014). Compelling evidence showed that intestinal infection and inflammatory response could dysregulate tight junction function (Lee, 2015). Yamauchi et al. reported that dietary 0.05, 1, and 3% SCE improved intestinal histology in chickens via mediating intestinal villus height, villus area, epithelial cell area and cell mitosis (Yamauchi et al., 2006a, b). Moreover, SCE was also demonstrated to improve the intestinal structure and barrier integrity (Yamauchi et al., 2006a). In the present study, the DSS challenge reduced colonic protein expression of ZO-1, Occludin, and Claudin1, while dietary SCE alleviated the DSS-induced damages in the tight junctions. These results implying that dietary SCE might play a protective role via the increasing protein expression of the colonic Occludin and Claudin1. The nuclear factor p65 controls many genes expression in the biological processions, which are associated with the inflammatory responses, apoptosis, and the immune function (Cao et al., 2014; Ma et al., 2015). Many stimuli factors like oxidative stress, inflammatory cytokines, and bacterial infection could activate p65 and translocate the cytoplasmatic p65 into the nucleus (Yin et al., 2013). In the
present study, DSS markedly enhanced nuclear p65 translocation, which might mediate colonic inflammation. Meanwhile, the Nrf2 translocation into nuclei could promote the expression of a great number of cytoprotective and detoxificant genes (Buendia et al., 2016; Yin et al., 2013). The activated Nrf2-antioxdative signaling pathway could confer a beneficial role in the DSS-induced inflammation (Wang et al., 2016). In the present study, the results showed that dietary SCE markedly alleviated the DSS-promoted effect on the p65 nuclear accumulation and the DSS-inhibited effect on the Nrf2 nuclear accumulation, suggesting that the protective mechanism of SCE in the colonic inflammation and oxidative stress might be associated with the p65 and Nrf2 signal pathway in mice. A possible mechanism underlying the protective effect of SCE against the DSS-induced colonic inflammation, oxidative stress and tight junction dysfunction in mouse colon was shown in Figure 4. The DSS challenge increased the proinflammatory IL-17 expression, and further activated the p65 signal pathway, which promoted the transcription of downstream proinflammatory genes (TNF-α and IL-1β) and enhanced the colonic inflammation. The DSS challenge induced the colonic oxidative stress via decreasing the antioxidative substances (GPX1 and GPX4) and weakening the antioxidative capacity (GSH-PX and T-AOC). The DSS challenge caused the colonic tight junction dysfunction by down-regulating the tight junction-related proteins (ZO-1, Claudin1 and Occludin). SCE plays a beneficial role in the DSS-induced colonic inflammation, oxidative stress and tight junction dysfunction via inhibiting the IL-17 expression, activating the SOD1 and Nrf2-related signal pathway, and relieving the DSS-induced low expression of the tight junction-related proteins, respectively. Acknowledgments This study was jointly supported by the National Key Research and Development Program of China (2016YFD0500505), National Natural Science Foundation of China (No. 31272485 and No.31402116), and Jiangsu Qinglan Project (201615).
Competing interests The authors declared that they have no competing interests.
References
Abdel Hadi, L., Di Vito, C., Riboni, L., 2016. Fostering Inflammatory Bowel Disease: Sphingolipid Strategies to Join Forces. Mediators Inflamm 2016, 3827684. Amer, S., Na, K.J., El-Abasy, M., Motobu, M., Koyama, Y., Koge, K., Hirota, Y., 2004. Immunostimulating effects of sugar cane extract on X-ray radiation induced immunosuppression in the chicken. Int Immunopharmacol 4, 71-77. Banan, A., Shaikh, M., Mutlu, E., Kommanduri, S., Farhadi, A., Polzin, L., Liccardi, N., Zhang, L.J., Keshavarzian, A., 2005. Changes in distinct PKC Isoforms - Upregulation of atypical PKC-lambda and downregulation of classical PKC-beta-1-predict tissue oxidative stress and NF-kappa B activation in mucosa of patients with inflammatory bowel disease (IBD). Gastroenterology 128, A304-A304. Banan, A.C., Shaikh, M., Zhang, L.J., Forsyth, C.B., Farhadi, A., Mutlu, E., Tang, Y., Keshavarzian, A., 2007. A unique inflammatory mechanism for intestinal injury during IBD: Modulation of a distinct phospholipase C-gamma 1 (PLC-gamma 1) dependent pathway could underlie EGF-Receptor initiated pathways that lead to mucosal oxidative stress and Nf-kappa B activation in man. Gastroenterology 132, A363-A363. Bazer, F.W., Wang, X., Johnson, G.A., Wu, G., 2015. Select nutrients and their effects on conceptus development in mammals. Animal Nutrition 1, 85-95. Behrens, G., Jochem, C., Schmid, D., Keimling, M., Ricci, C., Leitzmann, M.F., 2015. Physical activity and risk of pancreatic cancer: a systematic review and meta-analysis. Eur J Epidemiol 30, 279-298. Buendia, I., Michalska, P., Navarro, E., Gameiro, I., Egea, J., Leon, R., 2016. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther 157, 84-104. Cao, A.T., Yao, S., Stefka, A.T., Liu, Z., Qin, H., Liu, H., Evans-Marin, H.L., Elson, C.O., Nagler, C.R., Cong, Y., 2014. TLR4 regulates IFN-gamma and IL-17 production by both thymic and induced Foxp3+ Tregs during intestinal inflammation. J Leukoc Biol 96, 895-905. Catana, C.S., Berindan Neagoe, I., Cozma, V., Magdas, C., Tabaran, F., Dumitrascu, D.L., 2015. Contribution of the IL-17/IL-23 axis to the pathogenesis of inflammatory bowel disease. World J Gastroenterol 21, 5823-5830. Chen, M.H., Lo, D.Y., Liao, J.W., Hsuan, S.L., Chien, M.S., Lin, C.C., Chen, T.H., Lee, W.C., 2012. Immunostimulation of sugar cane extract on neutrophils to Salmonella typhimurium infection in mice. Phytother Res 26, 1062-1067. Choi, A.-J., Buisson, N., Kim, C.-T., 2015. Digestion characteristics and kinetic analysis of bio-molecules in a simulated human intestinal system. Integr Food Nutr Metab 2, 189-192. Chung, Y.M., Wang, H.C., El-Shazly, M., Leu, Y.L., Cheng, M.C., Lee, C.L., Chang, F.R., Wu, Y.C., 2011. Antioxidant and tyrosinase inhibitory constituents from a desugared sugar cane extract, a byproduct of sugar production. J Agric Food Chem 59, 9219-9225. El-Abasy, M., Motobu, M., Shimura, K., Na, K.J., Kang, C.B., Koge, K., Onodera, T., Hirota, Y., 2002. Immunostimulating and growth-promoting effects of sugar cane extract (SCE) in chickens. J Vet Med Sci 64, 1061-1063. Fitzpatrick, L.R., 2013. Inhibition of IL-17 as a Pharmacological Approach for IBD. International Reviews of Immunology 32, 544-555. Gooderham, M., Posso-De Los Rios, C.J., Rubio-Gomez, G.A., Papp, K., 2015. Interleukin-17 (IL-17)
inhibitors in the treatment of plaque psoriasis: a review. Skin Therapy Lett 20, 1-5. Hendy, H.A.-R.E., Gemeai, A.R.O.A.-. 2014. Effect of broccoli intake on antioxidant in the liver and kidney tissues of hyperglycemic rats. Integr Food Nutr Metab 1, 1-6. Hikosaka, K., El-Abasy, M., Koyama, Y., Motobu, M., Koge, K., Isobe, T., Kang, C.B., Hayashidani, H., Onodera, T., Wang, P.C., Matsumura, M., Hirota, Y., 2007. Immunostimulating effects of the polyphenol-rich fraction of sugar cane (Saccharum officinarum L.) extract in chickens. Phytother Res 21, 120-125. Hikosaka, K., Koyama, Y., Motobu, M., Yamada, M., Nakamura, K., Koge, K., Shimura, K., Isobe, T., Tsuji, N., Kang, C.B., Hayashidani, H., Wang, P.C., Matsumura, M., Hirota, Y., 2006. Reduced lipopolysaccharide (LPS)-induced nitric oxide production in peritoneal macrophages and inhibited LPS-induced lethal shock in mice by a sugar cane (Saccharum officinarum L.) extract. Biosci Biotechnol Biochem 70, 2853-2858. Hirai, F., Matsui, T., 2015. Status of food intake and elemental nutrition in patients with Crohn’s disease. Integr Food Nutr Metab 2, 148-150. Hu, C.-A.A., Hou, Y., Yi, D., Qiu, Y., Wu, G., Kong, X., Yin, Y., 2015. Autophagy and tight junction proteins in the intestine and intestinal diseases. Animal Nutrition 1, 123-127. James, A.M., Collins, Y., Logan, A., Murphy, M.P., 2012. Mitochondrial oxidative stress and the metabolic syndrome. Trends Endocrinol Metab 23, 429-434. Ledon, N., Casaco, A., Remirez, D., Gonzalez, A., Cruz, J., Gonzalez, R., Capote, A., Tolon, Z., Rojas, E., Rodriguez, V.J., Merino, N., Rodriguez, S., Ancheta, O., Cano, M.C., 2007. Effects of a mixture of fatty acids from sugar cane (Saccharum officinarum L.) wax oil in two models of inflammation: zymosan-induced arthritis and mice tail test of psoriasis. Phytomedicine 14, 690-695. Lee, S.H., 2015. Intestinal permeability regulation by tight junction: implication on inflammatory bowel diseases. Intest Res 13, 11-18. Li, X., Wang, Q., Xu, H., Tao, L., Lu, J., Cai, L., Wang, C., 2014. Somatostatin regulates tight junction proteins expression in colitis mice. Int J Clin Exp Pathol 7, 2153-2162. Li, Y., Liu, Y., Chu, C.Q., 2015. Th17 Cells in Type 1 Diabetes: Role in the Pathogenesis and Regulation by Gut Microbiome. Mediators Inflamm 2015, 638470. Lo, D.Y., Chen, T.H., Chien, M.S., Koge, K., Hosono, A., Kaminogawa, S., Lee, W.C., 2005. Effects of sugar cane extract on the modulation of immunity in pigs. J Vet Med Sci 67, 591-597. Lo, D.Y., Chien, M.S., Yeh, K.S., Koge, K., Lin, C.C., Hsuan, S.L., Lee, W.C., 2006. Effects of sugar cane extract on pseudorabies virus challenge of pigs. J Vet Med Sci 68, 219-225. Ma, W., Wang, J., Li, Y., Hu, X., Shi, F., Wang, X., 2015. Enhancing pentose phosphate pathway in Corynebacterium glutamicum to improve l-isoleucine production. Biotechnol Appl Biochem. Rao, P.V.L.N.S., Kiranmayi, V.S., Swathi, P., Jeyseelan, L., Suchitra, M.M., Bitla, A.R., 2015. Comparison Of Two Analytical Methods Used For The Measurement Of Total Antioxidant Status. Journal of antioxidant activity 1, 22-28. Rashti, Z., Koohsari, H., 2015. Antibacterial effects of supernatant of lactic acid bacteria isolated from different Dough's in Gorgan city in north of Iran. Integr Food Nutr Metab 2, 193-196. Ren, W., Yin, J., Wu, M., Liu, G., Yang, G., Xion, Y., Su, D., Wu, L., Li, T., Chen, S., Duan, J., Yin, Y., Wu, G., 2014. Serum amino acids profile and the beneficial effects of L-arginine or L-glutamine supplementation in dextran sulfate sodium colitis. PLoS One 9, e88335. Resta-Lenert, S.C., Maruggi, M., Ho, C., 2008. Synbiotics protect against oxidative stress in inflammatory bowel disease (IBD) by inducing phase 2 response enzymes. Gastroenterology 134,
A89-A89. Sann, H., Erichsen, J., Hessmann, M., Pahl, A., Hoffmeyer, A., 2013. Efficacy of drugs used in the treatment of IBD and combinations thereof in acute DSS-induced colitis in mice. Life Sci 92, 708-718. Shahandeh, A., Purushothuman, S., Martin, K., Graham, M., Johnstone, D.M., Milward, E.A., 2015. Anti-Oxidant Phytochemicals As Potential Treatments For Age-Related Macular Degeneration. Journal of antioxidant activity 1, 29-41. Utrilla, M.P., Peinado, M.J., Ruiz, R., Rodriguez-Nogales, A., Algieri, F., Rodriguez-Cabezas, M.E., Clemente, A., Galvez, J., Rubio, L.A., 2015. Pea (Pisum sativum L.) seed albumin extracts show anti-inflammatory effect in the DSS model of mouse colitis. Molecular Nutrition & Food Research 59, 807-819. Valli, V., Gomez-Caravaca, A.M., Di Nunzio, M., Danesi, F., Caboni, M.F., Bordoni, A., 2012. Sugar cane and sugar beet molasses, antioxidant-rich alternatives to refined sugar. J Agric Food Chem 60, 12508-12515. Wang, Y., Wang, H., Qian, C., Tang, J., Zhou, W., Liu, X., You, Q., Hu, R., 2016. 3-(2-Oxo-2-phenylethylidene)-2,3,6,7-tetrahydro-1H-pyrazino[2,1-a]isoquinolin-4(1
1bH)-one
(compound 1), a novel potent Nrf2/ARE inducer, protects against DSS-induced colitis via inhibiting NLRP3 inflammasome. Biochem Pharmacol 101, 71-86. Wurth, R., Lagkouvardos, I., Clavel, T., Wilke, J., Foerst, P., Kulozik, U., Haller, D., Hormannsperger, G., 2015. Physiological relevance of food grade microcapsules: Impact of milk protein based microcapsules on inflammation in mouse models for inflammatory bowel diseases. Molecular Nutrition & Food Research 59, 1629-1634. Xiong, Y.J., Chen, D.P., Yu, C.C., Lv, B.C., Peng, J.Y., Wang, J.Y., Lin, Y., 2015. Citrus nobiletin ameliorates experimental colitis by reducing inflammation and restoring impaired intestinal barrier function. Molecular Nutrition & Food Research 59, 829-842. Yamauchi, K., Buwjoom, T., Koge, K., Ebashi, T., 2006a. Histological alterations of the intestinal villi and epithelial cells in chickens fed dietary sugar cane extract. Br Poult Sci 47, 544-553. Yamauchi, K., Buwjoom, T., Koge, K., Ebashi, T., 2006b. Histological intestinal recovery in chickens refed dietary sugar cane extract. Poult Sci 85, 645-651. Yin, J., Liu, M., Ren, W., Duan, J., Yang, G., Zhao, Y., Fang, R., Chen, L., Li, T., Yin, Y., 2015. Effects of dietary supplementation with glutamate and aspartate on diquat-induced oxidative stress in piglets. PLoS One 10, e0122893. Yin, J., Ren, W.K., Wu, X.S., Yang, G., Wang, J., Li, T.J., Ding, J.N., Cai, L.C., Su, D.D., 2013. Oxidative stress-mediated signaling pathways: A review. Journal of Food Agriculture & Environment 11, 132-139. Yin, J., Wu, M.M., Xiao, H., Ren, W.K., Duan, J.L., Yang, G., Li, T.J., Yin, Y.L., 2014. Development of an antioxidant system after early weaning in piglets. J Anim Sci 92, 612-619. Zhou, J., Liu, B., Liang, C., Li, Y., Song, Y.H., 2016. Cytokine Signaling in Skeletal Muscle Wasting. Trends Endocrinol Metab 27, 335-347. Zhu, L., Sun, Y., Zhang, G., Yu, P., Wang, Y., Zhang, Z., 2015. Radical-Scavenging And Anti-Oxidative Activities Of TBN In Cell-Free System And Murine H9c2 Cardiomyoblast Cells. Journal of antioxidant activity 1, 55-68.
Figure Legends
Fig. 1. Effects of dietary SCE on colonic histological structure after DSS exposure in mice via HE staining (×100 and ×400). A significant infiltration of inflammatory cells were noticed in the DSS group compared with the control. Colon in the DSS+SCE group showed only mild infiltration of inflammatory cells to the mucosa compared with the DSS group. Black arrows indicate the infiltration of inflammatory cells. Fig. 2. Effects of dietary SCE on colonic tight junctions after DSS exposure in mice. Data are presented as mean ± SEM. (A). ZO-1 expression; (B). Occludin expression; (C). Claudin1 expression. Fig. 3. Effects of dietary SCE on colonic p65 and Nrf2 after DSS exposure in mice. Data are presented as mean ± SEM. (A). p65 expression; (B). Nrf2 expression. Fig. 4. Schema showing how SCE may attenuate the DSS-induced colonic inflammation, oxidative stress, and tight junction dysfunction in the mouse colon. Red arrows: up-regulated or down-regulated expression; Black arrows: direct stimulatory modification; Dull arrows: direct inhibitory modification. SCE, sugar cane extract; DSS, dextran sulfate sodium; Nrf2, nuclear factor E2-related factor 2; SOD1, superoxide dismutase 1; GPX1, glutathione peroxidase 1; GPX4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha; GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability; ZO-1, zona occludens-1.
Table 1. Composition of the basal diet Ingredients
Amount, g/kg diet
Nutrient level
Amount
Corn meal Soybean meal Wheat bran Wheat flour Fish meal NaCl CaHPO4 CaCO3 Lard L-Lysine L-Methionine Mineral mix1 Vitamin mix2
520 200 110 90 30 2 10 12 20 2.5 2.7 0.6 0.2
Total energy, MJ/kg diet Crude protein, % Crude fat, % Starch, % Crude fiber, % Crude ash, % Calcium, % Phosphorus, %
15.2 21.9 4.2 50.1 4.4 6.3 1.07 0.69
1
Provided the following amount (mg/kg diet): 1) cobalt (as cyanococobalamin), 0.6; 2) copper (as CuSO4-5H2O), 5.0; 3) iodine (as CaI2), 0.48; 4) iron (as FeSO4), 75.0; 5) manganese (as MnO), 20.0; 6) selenium (as Na2SeO3), 0.40; and 7) zinc (as ZnO), 10.0 2
Provided the following amount (mg/kg diet): 1) all-rac-a-tocopheryl acetate, 64.0; 2) D-biotin,
0.2; 3) calcium d-pantothenate, 24.0; 4) cholecalciferol, 5.5; 5) folic acid, 6.0; 6) menadione sodium bisulfate, 2.2; 7) nicotinic acid, 30.3; 8) pyridoxine-HCL, 12.0; 9) retinyl acetate, 1.9; 10) riboflavin, 5.5; 11) thiamin-HCL, 13.0; 12) vitamin B-12, 0.022.
Table 2. PCR primer sequences: the forward primers (F) and the reverse primers (R) used in this study Gene
Accession No.
Nucleotide sequence of primers (5′–3′)
Size (bp)
β-Actin
NM_007393.3
117
CAT
XM_006498624.1
SOD1
NM_011434.1
Gpx1
NM_008160.6
Gpx4
NM_001037741.3
IL-1β
NM_008361.3
IL-10
NM_010548.2
IL-17
NM_010552.3
TNF-α
NM_013693.2
F:GTCCACCTTCCAGCAGATGT R:GAAAGGGTGTAAAACGCAGC F:AATATCGTGGGTGACCTCAA R:CAGATGAAGCAGTGGAAGGA F:CCACTGCAGGACCTCATTTT R:CACCTTTGCCCAAGTCATCT F:GGTTCGAGCCCAATTTTACA R:CCCACCAGGAACTTCTCAAA F:CTCCATGCACGAATTCTCAG R:ACGTCAGTTTTGCCTCATTG F:CTGTGACTCGTGGGATGATG R:GGGATTTTGTCGTTGCTTGT F: ACAGCCGGGAAGACAATAAC R: CAGCTGGTCCTTTGTTTGAAAG F:TACCTCAACCGTTCCACGTC R:TTTCCCTCCGCATTGACAC F:AGGCACTCCCCCAAAAGAT R:TGAGGGTCTGGGCCATAGAA
243 216 199 117 213 116 119 192
CAT, catalase; SOD1, superoxide dismutase 1; Gpx1, glutathione peroxidase 1; Gpx4, glutathione peroxidase 4; TNF-α, tumor necrosis factor-alpha.
Table 3. Effects of SCE on average daily weight gain and relative organ weights Item
Cont
Average daily weight gain (g) Day 0-7 0.16+0.05b Day 8-14 0.17+0.03b Organ relative weight (‰) Liver 45.80+2.53 Kidney 12.99+1.14 Spleen 3.24+0.19b
DSS
DSS+SCE
SCE
0.15+0.06b 0.07+0.04c
0.38+0.04a 0.36+0.05a
0.30+0.04a 0.35+0.12ab
45.50+4.32 13.05+0.84 4.35+0.67a
41.63+2.61 12.71+1.35 3.47+0.21b
41.99+2.96 13.28+1.04 3.54+0.25b
Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P< 0.05; n = 10).
Table 4. Effects of SCE on colonic weight and length after DSS exposure Item
Cont
DSS
DSS+SCE
SCE
Colonic weight (g) Colonic length (cm) W/L (100g/cm)
0.29+0.01 7.91+0.29ab 3.66+0.72
0.32+0.01 7.30+0.22b 3.94+0.22
0.30+0.01 9.19+0.26a 3.29+0.11
0.29+0.02 8.46+0.37ab 3.41+0.23
W/L, colonic weight versus colonic length. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 10).
Table 5. Effects of dietary SCE on colonic genes expression after DSS exposure in mice Item IL-1β Il-10 IL-17 TNF-α SOD1 GPX1 GPX4 CAT ZO-1 Occludin Claudin1
Cont
DSS b
1.03+0.07 1.08+0.45 1.09+0.18b 0.90+0.30b 0.64+0.13b 0.86+0.15ab 1.01+0.28a 0.92+0.22b 1.02+0.08a 0.97+0.26b 0.94+0.21
DSS+SCE a
2.09+0.26 1.51+0.42 1.78+0.26a 1.51+0.10a 0.75+0.11b 0.47+0.14b 0.73+0.14b 0.87+0.22b 0.64+0.11b 0.99+0.21b 0.72+0.17
ab
1.58+0.43 1.19+0.34 1.23+0.21b 1.23+0.18ab 1.14+0.15a 0.60+0.16b 0.85+0.19b 0.69+0.21b 0.52+0.10b 1.02+0.23b 0.68+0.14
SCE 1.42+0.17ab 1.39+0.10 1.24+0.18b 1.09+0.26b 1.16+0.13a 1.25+0.28a 1.21+0.21a 1.40+0.26a 0.91+0.14a 1.65+0.25a 0.85+0.18
ZO-1, zona occludens-1. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 8).
Table 6. Effects of dietary SCE on serum oxidative stress after DSS exposure in mice Item
Cont
DSS
DSS+SCE
SCE
GSH-PX U/L MDA nmol/mL T-AOC U/ML
91.86+3.70 63.53+2.97b 25.54+1.09a
84.17+3.47 75.15+5.57a 17.38+0.61b
87.96+3.97 77.79+5.30a 19.41+1.58ab
84.44+1.85 64.85+4.98b 21.97+0.57a
GSH-PX, glutathione peroxidase; MDA, malondialdehyde; T-AOC, total antioxidant capability. Data are presented as mean ± SEM. The values having different superscript letters were significantly different (P<0.05; n = 8).