- Email: [email protected]
Protective effects of grape seed proanthocyanidins against iron overload-induced renal oxidative damage in rats
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Journal of Trace Elements in Medicine and Biology journal homepage: www.elsevier.com/locate/jtemb
Protective effects of grape seed proanthocyanidins against iron overloadinduced renal oxidative damage in rats Shaojun Yun, Dongyang Chu, Xingshuai He, Wenfang Zhang, Cuiping Feng
⁎
College of Food Science and Engineering, Shanxi Agricultural University, Taigu 030801, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Grape seed proanthocyanidins Iron overload Kidney Oxidative stress Apoptosis
Background: Excessive exposure to iron can cause kidney damage, and chelating drugs such as deferoxamine and deferiprone have limited usefulness in treating iron poisoning. This study was designed to investigate the protective effects of grape seed proanthocyanidins (GSPAs) against iron overload induced nephrotoxicity in rats. The roles of GSPAs in chelating iron, antioxidant activity, renal function, pathological section, and apoptosisrelated gene expression were assessed. Methods: Newly weaned male Sprague–Dawley rats aged 21 days (weight, 65 ± 5 g) were randomly divided into four groups containing 10 rats each: normal control (negative) group, iron overload (positive) group, GSPAs group, and GSPAs + iron overload (test) group. Iron dextran injections (2.5 mg⋅ kg−1) and GSPAs (25 mg⋅ kg−1) were intraperitoneally and intragastrically administered to rats daily for 7 weeks, respectively. Measurements included red blood cell (RBC) count and hemoglobin (Hb) level, serum total iron-binding capacity (TIBC), renal iron content, glutathione peroxidase (GSH-Px) activity, superoxide dismutase (SOD) activity, malondialdehyde (MDA) content, total antioxidant activity (T-AOC), creatinine (CR) and blood urea nitrogen (BUN) levels, pathological changes, and apoptotic Fas, Bax expressions in the kidney tissue. Differences among the dietary groups were determined using one-way analysis of variance with post-hoc Tukey’s test. P < 0.05 was considered statistically significant. Results: RBC count, Hb level, renal iron content, MDA content, CR and BUN levels, and Fas, Bax expressions significantly increased in the positive group than in the negative group; contrarily, TIBC, GSH-Px activity, and TAOC significantly decreased in the positive group than in the negative group (P < 0.05). Although not statistically significant, SOD activity was slightly reduced in the positive group than in the negative group. Inflammatory cell infiltration and fibrous tissue proliferation were observed in the kidney tissue of the rats in the positive group; in contrast, the rats exhibited better recovery when GSPAs were used instead of iron alone. Compared with the positive group, RBC counts, Hb levels, renal iron contents, the MDA content, CR and BUN levels, and Fas, Bax expressions significantly decreased, whereas the TIBC, the GSH-Px and SOD activities as well as T-AOC significantly increased in the test group rats (P < 0.05). There were no significant differences in the RBC counts, Hb levels, TIBC, renal iron contents, the SOD activity and MDA content, CR and BUN levels, and Fas expression between the GSPAs and negative groups. The GSH-Px activity and T-AOC were significantly increased whereas Bax expression was significantly decreased in the GSPAs group rats than in the negative group rats (P < 0.05). The rats in the GSPAs, test, and negative groups displayed glomeruli and tubules with a clear structure; further, the epithelial cells in the renal tubules were neatly arranged. Conclusions: GSPAs have protective effects on nephrotoxicity in rats with iron overload. Thus, further investigation of GSPAs as a new and natural phytochemo-preventive agent against iron overload is warranted.
Abbreviations: GSPAs, grape seed proanthocyanidins; RBC, red blood cell; Hb, hemoglobin; ICP-MS, inductively coupled plasma mass spectrometry; TIBC, total ironbinding capacity; GSH-Px, glutathione peroxidase; SOD, superoxide dismutase; MDA, malondialdehyde; T-AOC, total antioxidant activity; CR, creatinine; BUN, blood urea nitrogen; H&E, hematoxylin and eosin; qRT-PCR, quantitative real-time polymerase chain reaction ⁎ Corresponding author. E-mail address: [email protected] (C. Feng). https://doi.org/10.1016/j.jtemb.2019.126407 Received 12 April 2019; Received in revised form 4 September 2019; Accepted 18 September 2019 0946-672X/ © 2019 Elsevier GmbH. All rights reserved.
Please cite this article as: Shaojun Yun, et al., Journal of Trace Elements in Medicine and Biology, https://doi.org/10.1016/j.jtemb.2019.126407
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
samples were lyophilized, powdered, and frozen at −80 °C until use. Total iron-binding capacity (TIBC), glutathione peroxidase (GSH-Px) activity, superoxide dismutase (SOD) activity, malondialdehyde (MDA), total antioxidant activity (T-AOC), creatinine (CR), blood urea nitrogen (BUN) assay kits were obtained from the Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). Standard solutions for elements (Fe, 1000 μg/mL, GSB 04-1726-2004) were obtained from the National Nonferrous Metals and Electronic Materials Analysis and Testing Center. RNAiso™ Plus, PrimeScript™ RT Master Mix, and QuantiFast®SYBR®Green polymerase chain reaction kits were obtained from Qiagen Co. (Germany). DNA marker, agarose, ethidium bromide, loading buffer, and diethyl pyrocarbonate were provided by Takara Biomedical Technology Co. (Beijing, China). All other reagents used were of analytical grade or purer.
1. Introduction Iron is a crucial micronutrient present in cells and plays an important role in many metabolic and biological processes [1]; however, excessive exposure to iron can cause various toxic effects, including kidney damage. An increasing number of studies have also indicated the pathogenic mechanisms underlying iron overload and its unexpected effects on renal function abnormalities, such as renal toxicity [2] and renal carcinoma [3]. Among the various pathogenic mechanisms of renal injury, oxidative stress influences glomerular structure and function primarily depending on the effects of reactive oxygen species (ROS) on mesangial and endothelial cells [4]. Previous studies have demonstrated that unliganded or incompletely liganded iron ions can participate in “Fenton-type” redox reactions—these involve reactions with hydrogen peroxide (H2O2) or lipid peroxides to generate highly reactive hydroxyl (OH•) or lipid (LO• and LOO•) radicals [5]. Furthermore, iron overload can affect antioxidant enzyme levels and activities, thereby resulting in apoptotic effects in the kidney [6,7]. This leads to a series of pathological changes, in turn causing biochemical and physiological dysfunction in the body. To protect against the deleterious effects of iron accumulation, potential strategies include protecting the body from iron-induced oxidative stress. Currently, chelation therapy using deferoxamine and deferiprone is widely used to treat iron overload diseases [8]. Despite the therapeutic effectiveness of these drugs, some disadvantages such as hepatic dysfunction, allergy, agranulocytosis, and poor patient compliance exist [9,10]; thus, chelating drugs have limited usefulness in treating iron poisoning. Phytochemicals present in vegetables, fruit, spices, and medicinal plants have a wide range of health-beneficial effects, including heart-, kidney-, liver-, and brain-protective ones [11]. Some tannin-like compounds, such as proanthocyanidins (PAs), are widely found in black tea and red wine. PAs share some common structural features (e.g., phenolic nature and high molecular weight) with phenolic polymers [12] and reportedly possess a wide range of pharmacological and medicinal properties against oxidative stress. PAs’ antioxidant capacity essentially relies on their bioavailability and, in particular, on their absorption through the gut barrier and their metabolism [13]. PAs have all-round antioxidative mechanisms, including a radical scavenging action, singlet oxygen quenching action, chelating action, and inhibitory action on polyphenol oxidase [14]. Polyphenols with catechol or gallol groups are also effective metal chelators. On deprotonation, which is essential for metal binding, the catechol and gallol functionalities are referred to as catecholate and gallate groups, respectively. Octahedral geometry is preferred by metal ions, such as Fe2+ and Fe3+, which can coordinate up to three catecholate or gallate groups. Because of this ability, polyphenols with catechol or gallol groups are expected to always bind iron in a 3:1 fashion [15]. By comparison, maximal inhibition of iron uptake by phytic acid occurred at a 1:10 ratio of Fe to phytic acid [16]. Further, we recently found that PAs from grape seed (a class of naturally occurring active phenols) can inhibit iron uptake from soybean seed ferritin in rats and are toxic to rats with iron deficiency anemia [17]. Although previous studies have strongly suggested that grape seed proanthocyanidins (GSPAs) are useful in treating oxidative stress, their protective effects against kidney damage caused by iron overload have not yet been reported. Therefore, this study aimed to investigate the effects of GSPAs supplementation on iron overload-induced nephrotoxicity and the potential mechanism of this process in rats.
2.2. Animals and diets Male Sprague–Dawley rats aged 21 days were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China. All animal experiments and procedures were conducted in compliance with the Guide for the Care and Use of Laboratory Animals (U.S. National Academy of Sciences, National Institutes of Health Publication 6–23, revised 1985) and the principles and procedures of the European Communities Council Directives (86/609/EEC). Moreover, all the experimental protocols were approved by the ethics committee of Shanxi Agricultural University. After 1 week of adaptive feeding, the rats were randomly divided into four groups comprising 10 rats each: control group (negative group), iron overload (positive) group, GSPAs group, and GSPAs + iron overload (test) group. Throughout the study period, the rats had ad libitum access to an AIN-93 G diet [19] and deionized water through the MilliQ Plus system (Millipore Corp.; Sao Paulo, SP, Brazil). All rats were maintained in stainless steel cages and were subjected to a 12-h light cycle and a temperature of 23 °C ± 2 °C. The model and test group rats were intraperitoneally administered iron dextran injections (2.5 mg⋅ kg−1) daily. The GSPAs and test group rats were daily intragastrically administered GSPAs solubilized in same amount of saline (25 mg⋅ kg−1). Normal saline was used to eliminate the error of physiological stress, and the experiment was conducted for 7 weeks. The rats in the NC group were intraperitoneally and gastrically injected equal doses of saline; the doses were equivalent to those of dextran iron and GSPCs solvents, respectively (1 mL/100 g body weight). At the end of the experiment, the rats’ kidneys were removed and frozen at −80 °C for further analysis. 2.3. Red blood cell (RBC) count, hemoglobin (Hb) content, and TIBC in rats At the end of the experiment, blood samples were collected into heparinized microcapillary tubes. Hb levels and RBC counts were measured using the Spotchem II kit (Arkray Inc., Japan). For serum TIBC detection, based on the manufacturer’s instructions, 1 mL of iron standard solution (179.1 μmol/L, provided by the kit) was added to 1 mL of rat serum; the sample was thoroughly mixed and incubated at room temperature for 10 min. Next, 50 mg of iron adsorbent (provided by the kit) was added to the sample. The sample was then thoroughly mixed and incubated at room temperature for 5 min (repeated for three additional times). The sample was then centrifuged at 3500 rpm at 25 °C for 10 min. The blank tube contained 1 mL of distilled water, the standard tube contained 1 mL of iron standard application solution (17.91 μmol/L), and the test tube contained 1 mL of the supernatant after centrifugation. Two milliliters of iron chromogenic agent was added to all the three tubes. After through mixing, the samples were incubated in a boiling water bath for 5 min. The samples were then cooled and centrifuged at 3500 rpm for 10 min, after which absorbance was measured at 520 nm using double-distilled water. Using the absorbance values obtained, the serum TIBC was calculated on the basis of
2. Materials and methods 2.1. Materials PAs from grape seeds were extracted and purified as previously described [18]. The purity of the PA extracts was 95%. The resulting 2
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
the formula provided in the kit instructions.
2.7. Kidney histology
2.4. Renal iron content
Kidney tissue was fixed in 10% (v/v) formaldehyde, processed by successive dehydrations in ethanol, and embedded in paraffin. Serial 5–μm–thick sections were cut, and the sections were stained with hematoxylin and eosin (H&E) using standard procedures to identify the kidney histology. Images of the positively stained sections were obtained using an Olympus BX40 microscope and CC-12 Soft-Imaging System with Olympus MicroSuite (TM)-B3SV software (Olympus, Tokyo, Japan).
The renal iron content was determined using inductively coupled plasma mass spectrometry (ICP-MS). Concentrated HNO3 (8 mL) and HClO4 (2 mL) were added to 0.1 g of kidney tissue in a tube; the sample was shaken, sealed, and allowed to stand overnight at room temperature. The following day, the sample was heated until the liquid became transparent and then cooled. Subsequently, the sample was filtered, and the renal iron content was determined after adjusting the volume to 25 mL with 1% HNO3. The standard solution for elements (Fe, 1000 μg/ mL, GSB 04-1726-2004) was diluted to establish the standard curve. An inductively coupled plasma mass spectrometer (iCAP-Q; Thermo Fisher Scientific, American) in the KED mode was employed for determining the iron concentration. The RF power was set to 1050 W and the nebulizer gas to 0.86 L/min. The sample lifting rate was 1.2 L/min. The cooling air flow rate was 13.8 L/min, and the carrier flow rate was 0.98 L/min. The dwell time was set to 50 ms. These parameters were the optimal conditions for this instrument.
2.8. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted from the kidney using Trizol reagent, following the manufacturer’s instructions. Further, 2 μL of the extracted RNA was subjected to agarose gel electrophoresis for RNA integrity detection, and 1 μL of the RNA was used for qualitative and quantitative analysis performed using a Nanodrop ND-2000 spectrophotometer. The integrity of the extracted RNA was electrophoretically assessed by ethidium bromide staining, and the purity of the RNA was evaluated by checking the absorbances at 260 and 280 nm (OD260 nm/OD280 nm > 1.9 indicates the purity of RNA). The extracted RNA was stored at −80 °C until further use. The qPCR assays were performed according to MIQE standards [23]. According to some previous studies [24,25], the kidney showed the lowest variation with β-actin, and this result corroborates our pre-experimental results. Hence, β-actin was selected as a reference gene in this study. qRT-PCR primers for β-actin, Fas and Bax (sequences presented in Table 1) were designed using the Primer 5.0 software. Each of the primer pairs was tested for specificity using conventional reverse transcription-PCR before qRT-PCR. qRT-PCR was performed using the Mx3000P™ qPCR system (Stratagene, La Jolla, CA, USA) and a two-step SYBR qRT-PCR kit (Takara, Dalian, China). After initial denaturation at 95 °C for 30 s, qRT-PCR was performed under the following thermocycling conditions: 42 cycles at 95 °C for 5 s and 62 °C for 34 s. A dissociation curve was obtained using the reaction conditions of 95 °C for 15 s, 62.8 °C for 1 min, and 95 °C for 15 s to verify the specificity of the amplified products. mRNA abundance of β-actin, Fas, and Bax was calculated using the comparative △△CT method provided by the Mx3000P™ qPCR system.
2.5. Oxidative stress in rat kidney The frozen kidney tissue samples were weighed and homogenized (1:10, w/v) in 50 mmol⋅L−1 phosphate buffer (pH 7.4) and then the mixture was placed in an ice bath. The homogenate and supernatant were frozen at −20 °C and stored as aliquots until further use during the biochemical assays. The MDA content, GSH-Px and SOD activities, and T-AOC were determined according to the manufacturer’s instructions provided in the respective kits. GSH-Px was estimated based on the following principle: GSH-Px catalyzes glutathione oxidation with cumene hydroperoxide [20]. In the presence of glutathione reductase and nicotinamide adenine dinucleotide phosphate hydrogen (NADPH), oxidized glutathione is immediately converted to its reduced form with concomitant oxidation of NADPH to NADP+. The decrease in absorbance at 340 nm was measured at 37 °C. Total SOD activity (U/mg of protein) was determined following the method reported by Sun et al. [21]. This method is based on the inhibition of nitroblue tetrazolium (NBT) reduction using the xanthine–xanthine oxidase system as a superoxide generator. One unit of SOD was defined as the amount of enzyme that causes 50% inhibition in the reduction rate of NBT. The MDA content, which is an indicator of free radical generation, was estimated following the double heating method reported by Draper and Hadley [22]. This method is based on the spectrophotometric measurement of the color generated via the reaction of thiobarbituric acid with MDA. The T-AOC was determined following the kit instructions. The principle of the T-AOC detecting method is based on the ability of many antioxidants, such as GSH and SOD, in the body to reduce Fe3+ to Fe2+. The latter can form a stable complex with phenanthrolines, and its antioxidant capacity can be measured by colorimetry.
2.9. Statistical analysis Statistical Package for the Social Sciences software (SPSS, Inc.; Chicago, IL, USA) was used for statistical analysis. Data were expressed as mean ± the standard error of the mean (SEM). Differences among the dietary groups were determined using one-way analysis of variance with a post-hoc Tukey’s test. P < 0.05 indicated statistical significance.
2.6. CR and BUN levels Table 1 Primer sequences and corresponding PCR product size.
The total serum CR activity was detected using a CR kit. The principle of this kit is based on the Jaffe reaction. In this reaction, in the presence of picric acid, serum CR generates a jacinth compound that can be measured at 510 nm. The BUN level was measured with the BUN kit, the principle of which is based on the Fearon reaction. Briefly, under acidic conditions with heating, BUN and diacetyldioxime react to generate a red condensate, the absorbance values of which can be obtained at 520 nm to determine the BUN level. All procedures were performed following the manufacturer’s instructions. 3
序号
Gene
Primers (5' > 3')
Product Size (bP)
1
β-actin
110
2
Fas
3
Bax
TACCCAGGCATTGCTGACAG AGCCACCAATCCACACAGAG CGCAGCGGTTAGCTTTTCTG ATTTGCTCGGCAGCACAAGA TGGCGATGAACTGGACAACA CCCAGTTGAAGTTGCCGTCT
173 125
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
3. Results
sections. In the GSPAs, test, and negative group rats, the glomeruli and tubules displayed a clear structure; further, the epithelial cells of the renal tubules were neatly arranged (Fig. 5).
3.1. General condition of rats
3.7. Fas and Bax gene expressions in the rat kidney
During the period in which the rats received the intraperitoneal iron dextran injections, their general nutritional status and behavior were characterized by rough and sparse fur, loss of luster, loss of appetite, and susceptibility to be frightened; as the experiment progressed, these symptoms worsened. By the end of the experiment, the entire positive group exhibited such symptoms. Moreover, GSPAs ameliorated these symptoms. In the test group, all the rats did not show the above symptoms; however, they did not return to normal at all. There was no significant difference between the GSPAs group and negative group.
The Fas expression significantly increased by 96.15% in the positive group rats compared with that in the negative group rats; further, its expression in the test group rats was significantly increased by 49.65% (P < 0.05). The Fas expression was significantly reduced by 23.71% and 36.90% in the test and GSPAs group rats, respectively, compared with that in the positive group rats (P < 0.05). The Fas expressions in the GSPAs and negative groups were similar. The Bax expression was significantly increased by 57.43% in the positive group rats compared with that in the negative group rats (P < 0.05). Further, the Bax expressions in the kidney tissues of the test and GSPAs group rats were significantly decreased by 30.20% and 43.03%, respectively, compared with those in the kidney tissues of the negative group (P < 0.05). The Bax expressions in the test and GSPAs group rats were significantly decreased by 55.67% and 63.82%, respectively, compared with that in the positive group rats (P < 0.05) (Fig. 6).
3.2. Effects of GSPAs on RBC counts, Hb levels, and TIBC in rats The positive group rats had significantly greater RBC counts and Hb levels than the negative group rats (P < 0.05). The serum TIBC was significantly lower in the positive group rats than in the negative group rats (P < 0.05). There were no significant differences in these parameters between the GSPAs and negative groups. Compared with the negative group, RBC counts and Hb levels significantly increased (P < 0.05), whereas the TIBC slightly decreased in the test group rats (P > 0.05). Compared with the positive group, RBC counts and Hb levels significantly decreased, whereas the TIBC significantly increased in the test group rats (P < 0.05). These findings indicate that the rats recovered better when GSPAs were used instead of iron alone (Fig. 1).
4. Discussion and conclusion The successful establishment of an iron overload model is important for research on iron metabolism-associated diseases. In the present study, an intraperitoneal dextran iron injection was used to develop the iron overload rat model [26,27]. After administering the injection for 7 weeks, the general nutritional status and behavior of the rats were observed to have been severely impaired due to iron deposits, and the symptoms mentioned earlier continued to increase in severity as the experiment progressed. However, it was noted that GSPAs can relieve the above symptoms to a certain extent. Growing evidence suggests that increased body iron levels induce a variety of different pathological conditions, which lead to cellular and tissue damages [28,29]. With respect to emotional behavior, iron overload appears to alter anxietylike behavior and mood [30,31]. The generation of ROS mediated by excess body iron has been implicated in these diseases [32,33]. GSPAs exert a significantly high protection against cellular and tissue damages induced by oxygen free radicals [34]. Thus, in this rat model, GSPAs showed a protective effect on the impaired general state of rats treated with iron dextran. The iron status was further evaluated in rats by studying the numbers of RBCs, the Hb content, and the TIBC in serum. The results showed that iron overload increased the number of RBC, the Hb content and decreased the TIBC. GSPAs can alleviate the above symptoms. Polyphenol extracts which have a strong metal chelating ability can regulate iron metabolism-related protein and transferrin receptor expression [35]. Our previous study also showed that GSPAs can inhibit the absorption of iron from soybean ferritin in iron-deficient rats [17]. Thus, it is speculated that the GSPAs’ ability to chelate iron caused the number of RBCs and Hb content to significantly decrease in the rats with iron overload and the TIBC to significantly increase. The results of this study suggest that GSPAs supplementation for at least seven weeks does not influence iron-related blood indices in the control group. Similar findings were also obtained in previous animal and epidemiological studies [36,37]. Only a few single-meal studies have noted reductions in iron bioavailability; the total iron absorption differences were within 10% between tannin consumers and non-consumers, which may not affect the iron status in the long term [38]. This may be an important normalizing factor given the wide variability of iron absorption, but it may point to significant outcomes that have little meaningful impact on iron status when tannin-rich diets are consumed over time. The results also showed that although GSPAs could interfere with iron overload, the TIBC that actually reflects the level of
3.3. Renal iron content Changes in the renal iron content in the iron-overloaded rats with or without treatment are illustrated in Fig. 2. Compared with the negative group rats, the renal iron contents of the positive group rats were significantly increased (P < 0.05). The GSPAs, test, and negative group rats exhibited no changes in their renal iron contents. Compare with the positive group, the renal iron content of the test group rats significantly decreased (P < 0.05). 3.4. Measurement of oxidative stress The GSH-Px activity and T-AOC was significantly decreased in the positive group rats than in the negative group rats (P < 0.05). There were no changes in the SOD activity between the two groups. The MDA content was significantly increased in the positive group rats than in the negative group rats (P < 0.05). Conversely, compared with the positive group rats, the GSH-Px and SOD activities as well as T-AOC were all significantly increased and the MDA content was significantly decreased (P < 0.05) in the test group rats. The GSH-Px activity and TAOC were significantly increased in the GSPAs group rats than in the negative group rats (P < 0.05); the SOD activity and MDA content exhibited no obvious changes in any of the groups (Fig. 3). 3.5. Serum CR and BUN levels The serum CR and BUN levels were significantly increased in the positive group rats than in the negative group rats (P < 0.05). The CR and BUN levels were significantly decreased in the test and GSPAs group rats than in the positive group rats (P < 0.05) but were similar to the levels in the negative group rats (Fig. 4). 3.6. Effect of GSPAs on renal histological changes Inflammatory cell infiltration and fibrous tissue proliferation (see blue arrow in Fig. 5) were observed in the positive group rats but not in the negative group rats. The GSPAs and test group rats exhibited no obvious histological changes upon H&E staining of the kidney tissue 4
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 1. Effects of GSPAs on the RBC count, Hb level, and TIBC in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
above blood indices. In fact, because iron dextran was intraperitoneally injected, the absorbed iron also affected other tissues, such as the brain [40]. However, whether in brain or kidney tissue, GSPAs have some inhibitory effects on the adverse reactions caused by iron overload. An excess of iron deposits in renal cells can lead to kidney oxidative injury and dysfunction [41]. MDA is a major product of lipid peroxidation, and it can indirectly reflect the degree of damage to cells [42]. In our study, we observed that the MDA level was markedly increased in rats with iron overload, thus suggesting the induction of renal lipid peroxidation. As potent enzymatic antioxidants, SOD and GSH-Px can bring the first line of defense against free radicals by converting toxic superoxide into the less toxic hydrogen peroxide [43]. T-AOC depends on the various antioxidant substances in the body. Except for the increased concentration of MDA, decreased GSH-Px activity and T-AOC were also observed in this study. Thus, at the current dose of iron dextran, the defense system in the kidneys was insufficient to provide complete protection against the induced free radical damage. The response of the kidneys to the toxic iron was an escalation in lipid peroxidation. Our results provided convincing evidence that GSPAs exert robust protective effects against lipid peroxidation induced by iron overload. An interventional study has demonstrated that the oral administration of grape seed extract lowers ROS generation and plasma
transferrin was slightly lower in the test group than in the normal group, indicating that the iron binding capacity of transferrin was somewhat lower than that of the normal group. Consistent with this result, the RBC number and Hb content in the test group did not recover to normal during the 7-week experimental period. We speculate this to be so owing to the intervention time of GSPAs. If the time of intervention is more than 7 weeks, it is possible for these indicators to return to normal levels. Iron deposits lead to excessive iron content in the kidneys, which leads to nephrotoxicity and promotes the occurrence of acute and chronic kidney diseases [38]. Therefore, we further evaluated the iron content in the kidneys. The results showed that compared with the control group, the iron content in the kidney tissues of the model rat group increased significantly, demonstrating that a nephritic ironloaded rat model had been established. The complex formation between polyphenols and iron depends on the polyphenol structure, as well as the pH and concentrations of polyphenols and iron in the solution [15]. As major polyphenols, tannins form insoluble complexes with iron, thereby inhibiting its absorption [39]. After GSPAs and iron dextran were together administered to rats, we observed that GSPAs played a role in decreasing the iron levels in the test group through their ironchelating characteristics. The results displayed the same trend with the 5
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
antioxidant properties. Polyphenolic phytochemicals can reportedly directly scavenge ROS and chelate divalent metal ions to reduce the oxidative activity [45]. Further, polyphenolic phytochemicals exert indirect antioxidant effects via induction of endogenous protective antioxidative enzymes. Of note, these indirect activities involve the upregulation of antioxidant enzymes or cytoprotective proteins [46] and provide more efficient antioxidant actions in vivo [47,48]; our results reconfirm this effect. The changes in CR and BUN levels can be used to estimate the degree of renal function impairment. The serum CR level can reflect the glomerular filtration rate in the blood to some extent. The plasma CR level significantly increases when the kidney is damaged [49]. Protein metabolism in vivo produces BUN primarily via excretion from the kidney, and impaired glomerular filtration can lead to an increase in the plasma BUN level [49]. In vivo iron levels are directly related to the degree of damage from proteinuria, tubulointerstitial lesions, and other diseases [50]. Our results demonstrated that the CR and BUN levels of rats with iron overload were significantly increased, and this finding was consistent with a previously reported finding [51]. PAs, like all phenolic compounds, are reducing agents and excellent chelators of iron(III) [13]. Thus, it can be said that GSPAs act as chelators and antioxidants to alleviate renal function damage. Similar results were noted in terms of the pathological changes in the kidney. Consistent with previous result [51], we observed interstitial inflammatory cell infiltration and fibrous tissue proliferation in the kidney tissues of the positive group rats, and these findings were alleviated after the GSPAs intervention. These results suggest that GSPAs can interfere with pathological changes in the kidney tissue induced by iron overload via its roles of iron reduction and oxidation resistance. Apoptosis is a necessary biological process that eliminates unwanted cells in the disease process. Apoptosis caused by oxidative stress has been demonstrated in a previous study [52]. Extrinsic apoptosis is
Fig. 2. Effects of GSPAs on renal iron content in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
protein carbonylation while simultaneously enhancing the endogenous antioxidant system activity [44]. Our results suggest that iron deposition in the kidneys negatively affects the oxidase system. GSPAs induce considerable protective effects on oxidative stress-induced lipid peroxidation injuries in rat kidney tissues. In other words, GSPAs induce protective effects against renal damage via both their chelating role and
Fig. 3. Effects of GSPAs on the GSH-Px and SOD activities, MDA content, and T-AOC in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
6
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 4. Effects of GSPAs on CR and BUN levels in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
triggered by so-called “death receptors” (such as the FAS receptor) upon interactions with their cognate death ligands (such as the FAS-ligand FASLG). The intrinsic apoptosis pathway relies on the intracellular release of pro-apoptotic members of the BCL2 family in response to deprivation of growth factors or exposure to genotoxic agents [53]. Fas and Bax are important components of apoptotic proteins that are associated with cell death, and their overexpression promotes apoptosis [53]. Our results demonstrated that in the kidney tissue, the increase of iron content could promote Fas and Bax expression and that GSPAs could significantly down-regulate these genes. Previous research has indicated that excessive ROS production may be an early response of intracellular iron overload that manifests prior to morphological changes of apoptosis [54]. Our results reconfirmed that excessive iron deposits promote apoptosis via inducing oxidative stress in the kidneys; however, the apoptosis was then inhibited by GSPAs treatment.
Administration of medicinal plant antioxidants is considered to mitigate the pathology of oxidative stress [55]. Recent studies have also suggested PAs may help prevent cancer growth by inducing apoptosis and inhibiting proliferation [56,57]. Thus, it is suggested that PAs can be used to prevent and manage renal injury induced by iron overload. Although not statistically significant, GSPAs also exhibited slightly upregulated Fas expression, indicating pro-apoptotic signaling. Further, polyphenolic phytochemicals can be oxidized to generate ROS in cell culture media and may result in death of the cells grown in the media [58]; however, the pro-apoptotic effect is also related to the bioavailability of polyphenolic phytochemicals, and the specific mechanism needs to be studied further. In summary, our study is the first to demonstrate the protective effects of GSPAs in rats with iron overload-induced nephrotoxicity by improving the general condition of rats, reducing the iron content in the Fig. 5. Effects of GSPAs on renal H&E staining of the kidney tissue sections obtained from the rats in each group. Note: A: negative group (intraperitoneal injection of saline + intragastric administration of saline); B: test group (intraperitoneal injection of iron dextran + intragastric administration of GSPAs); C: positive group (intraperitoneal injection of iron dextran + intragastric administration of saline); D: GSPAs group (intraperitoneal injection of saline + intragastric administration of GSPAs). Black arrows indicate renal corpuscles; red arrows indicate renal tubules (magnification, 400×).
7
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 6. Effects of GSPAs on Fas and Bax expression levels in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
blood and kidneys, enhancing the antioxidant defense system, ameliorating renal function and structure, and inhibiting renal apoptosis. The underlying mechanism may be relevant to the antioxidant and ironchelating capacity of GSPAs.
BioFactors 13 (2000) 115–120. [14] T. Ariga, The antioxidative function, preventive action on disease and utilization of proanthocyanidins, BioFactors 21 (2004) 197–201. [15] N.R. Perron, J.L. Brumaghim, A review of the antioxidant mechanisms of polyphenol compounds related to Iron binding, Cell Biochem. Biophys. 53 (2009) 75–100. [16] R.P. Glahn, G.M. Wortley, P.K. South, D.D. Miller, Inhibition of Iron uptake by phytic acid, tannic acid, and ZnCl2 : studies using an in vitro Digestion/Caco-2 cell model, J. Agric. Food Chem. 50 (2002) 390–395. [17] S.J. Yun, T. Zhang, M.L. Li, B. Chen, G.H. Zhao, Proanthocyanidins inhibit iron absorption from soybean (Glycine max) seed ferritin in rats with iron deficiency anemia, Plant Foods Hum. Nutr. 66 (2011) 212–217. [18] J.J. Deng, M.L. Li, T. Zhang, B. Chen, X.J. Leng, G.H. Zhao, Binding of proanthocyanidins to soybean (Glycine max) seed ferritin inhibiting protein degradation by protease in vitro, Food Res. Int. 44 (2011) 33–38. [19] P.G. Reeves, F.H. Nielsen, G.C. Fahey, AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet, J. Nutr. 123 (1993) 1939–1951. [20] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase, J. Lab. Clin. Med. 70 (1967) 158–170. [21] Y. Sun, L.W. Oberley, Y. Li, A simple method for clinical assay of superoxide dismutase, Clin. Chem. 34 (1988) 497–500. [22] H.H. Draper, M. Hadley, Malondialdehyde determination as index of lipid peroxidation, Methods Enzymol. 86 (1990) 421–431. [23] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments, Clin. Chem. 55 (2009) 611–622. [24] S. Klenke, K. Renckhoff, A. Engler, J. Peters, U.H. Frey, Easy-to-use strategy for reference gene selection in quantitative real-time PCR experiments, NaunynSchmiedeberg’s Arch. Pharmacol. 389 (2016) 1353–1366. [25] H.J. Kim, J.I. Na, B.W. Min, J.Y. Na, K.H. Lee, J.H. Lee, Y.J. Lee, H.S. Kim, J.T. Park, Evaluation of protein expression in housekeeping genes across multiple tissues in rats, Korean J. Pathol. 48 (2014) 193–200. [26] C.J. Dillard, J.E. Downey, A.L. Tappel, Effect of antioxidants on lipidperoxidation in iron-loaded rats, Lipids 19 (1984) 127–133. [27] M. Galleano, S. Puntarulo, Hepatic chemiluminescence and lipid peroxidation in mild iron overload, Toxicology 76 (1992) 27–38. [28] E.D. Weinberg, Cellular iron metabolism in health and disease, Drug Metab. Rev. 22 (1990) 531–579. [29] R.B. Lauffer, Preventive measures for the maintenance of low but adequate iron stores, Iron and Human Disease, CRC Press, Boca Raton, 1992, pp. 459–474. [30] T.J. Sobotka, P. Whittaker, J.M. Sobotka, R.E. Brodie, D.Y. Wander, M. Robl, M. Bryant, C.N. Barton, Neurobehavioral dysfunctions associated with dietary iron overload, Physiol. Behav. 59 (1996) 213–219. [31] K. Maaroufi, M. Ammari, M. Jeljeli, V. Roy, M. Sakly, H. Abdelmelek, Impairment of emotional behavior and spatial learning in adult Wistar rats by ferrous sulfate, Physiol. Behav. 96 (2009) 343–349. [32] W. Nandar, E.B. Neely, E. Unger, J.R. Connor, A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta 1832 (2013) 729–741. [33] T.P. Tuomainen, S. Loft, K. Nyyssönen, K. Punnonen, J.T. Salonen, H.E. Poulsen, Body iron is a contributor to oxidative damage of DNA, Free Radic. Res. 41 (2007) 324–328. [34] E.M. EI-Sayed, A.M. Mansour, W.S. EI-Sawy, Protective effect of proanthocyanidins against doxorubicin-induced nephrotoxicity in rats, J. Biochem. Mol. Toxicol. 31 (2017) e21965. [35] L. Reznichenko, T. Amit, H. Zheng, Y. Avramovich‐Tirosh, M.B.H. Youdim, S. Mandel, Reduction of iron regulated amyloid precursor protein and β-amyloid peptide by (-)-epigallocatechin-3-gallate in cell cultures: implications for iron
Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgements This project was supported by a grant from the National Natural Science Foundation of China (31801551), Research Startup Funds from Shanxi Agricultural University (2013YJ30), and the Science and Technology Innovation Project of Higher Education in Shanxi Province (2016150). References [1] G.H. Zhao, Phytoferritin and its implications for human health and nutrition, Biochim. Biophys. Acta 1800 (2010) 815–823. [2] C.J. Dillard, J.E. Downey, A.L. Tappel, Effect of antioxidants on lipid peroxidation in iron-loaded rats, Lipids 19 (1984) 127–133. [3] J.L. Li, S. Okada, S. Hamazaki, Y. Ebina, O. Midorikawa, Subacute nephrotoxicity and induction of renal cell carcinoma in mice treated with ferric nitrilotriacetate, Cancer Res. 47 (1987) 1867–1869. [4] S. Thamilselvan, S.R. Khan, Oxalate and calcium oxalate crystals are injurious to renal epithelial cells: results of in vivo and in vitro studies, J. Nephrol. 11 (1998) 66–69. [5] D. Galaris, K. Pantopoulos, Oxidative stress and iron homeostasis: mechanistic and health aspects, Crit. Rev. Clin. Lab. Sci. 45 (2008) 1–23. [6] L. He, G.A. Perkins, A.T. Poblenz, J.B. Harris, M. Hung, M.H. Ellisman, D.A. Fox, Bcl-xL over expression blocks bax-mediated mitochondrial contact site formation and apoptosis in rod photoreceptors of lead-exposed mice, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 1022–1027. [7] G.P. Yuan, S.J. Dai, Z.Q. Yin, H.K. Lu, R.Y. Jia, J. Xu, et al., Sub-chronic lead and cadmium co-induce apoptosis protein expression in liver and kidney of rats, Int. J. Clin. Exp. Pathol. 7 (2014) 2905–2914. [8] H. Miyajima, Y. Takahashi, T. Kamata, H. Shimizu, N. Sakai, J.D. Gitlin, Use of desferrioxamine in the treatment of aceruloplasminemia, Ann. Neurol. 41 (1997) 404–407. [9] V. Berdoukas, K. Farmaki, S. Carson, J. Wood, T. Coates, Treating thalassemia major-related iron overload: the role of deferiprone, J. Blood Med. 3 (2012) 119–129. [10] F.N. Al-Refaie, B. Wonke, A.V. Hoffbrand, D.G. Wickens, P. Nortey, G.J. Kontoghiorghes, Efficacy and possible adverse effects of the oral iron chelator 1,2-dimethyl-3-hydroxypyrid-4-one (L1) in thalassemia major, Blood 80 (1992) 593–599. [11] M. Nassiri-Asl, H. Hosseinzadeh, Review of the pharmacological effects of Vitis vinifera (grape) and its bioactive compounds, Phytother. Res. 23 (2009) 1197–1204. [12] M. Nassiri-Asl, H. Hosseinzadeh, Review of the pharmacological effects of Vitis vinifera (grape) and its bioactive constituents: an update, Phytother. Res. 30 (2016) 1392–1403. [13] A. Scalbert, S. Déprez, I. Mila, A.M. Albrecht, J.F. Huneau, S. Rabot, Proanthocyanidins and human health: systemic effects and local effects in the gut,
8
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
[47] M.L. Hu, Dietary polyphenols as antioxidants and anticancer agents: more questions than answers, Chang Gung Med. J. 34 (2011) 449–460. [48] G. Celik, A. Semiz, S. Karakurt, S. Arslan, O. Adali, A. Sen, A comparative study for the evaluation of two doses of ellagic acid on hepatic drug metabolizing and antioxidant enzymes in the rat, Biomed Res. Int. 2013 (2013) 1–9. [49] S. Gowda, P.B. Desai, S.S. Kulkarni, V.V. Hull, A.A. Math, S.N. Vernekar, Markers of renal function tests, N. Am. J. Med. Sci. 2 (2010) 170–173. [50] S.V. Shah, R. Baliga, M. Rajapurkar, V.A. Fonseca, Oxidants in chronic kidney disease, J. Am. Soc. Nephrol. 18 (2007) 16–28. [51] S. Guan, J. Ma, Y. Zhang, Y. Gao, Y. Zhang, X. Zhang, Danshen (Salvia miltiorrhiza) injection suppresses kidney injury induced by iron overload in mice, PLoS One 8 (2013) e74318. [52] M. Jazvinšćak Jembrek, P.R. Hof, G. Šimić, Ceramides in Alzheimer’s disease: key mediators of neuronal apoptosis induced by oxidative stress and Aβ accumulation, Oxid. Med. Cell. Longev. 2015 (2015) 346783. [53] S. Meynier, F. Rieux-Laucat, FAS and RAS related apoptosis defects: from autoimmunity to leukemia, Immunol. Rev. 287 (2019) 50–61. [54] Y. Kohgo, K. Ikuta, T. Ohtake, Y. Torimoto, J. Kato, Body iron metabolism and pathophysiology of iron overload, Int. J. Hematol. 88 (2008) 7–15. [55] M. Rafieian-Kopaei, Medicinal plants for renal injury prevention, J. Renal Inj. Prev. 2 (2013) 63–65. [56] L.A. Kresty, A.B. Howell, M. Baird, Cranberry proanthocyanidins induce apoptosis and inhibit acid-induced proliferation of human esophageal adenocarcinoma cells, J. Agric. Food Chem. 56 (2008) 676–680. [57] L.A. Kresty, A.B. Howell, M. Baird, Cranberry proanthocyanidins mediate growth arrest of lung cancer cells through modulation of gene expression and rapid induction of apoptosis, Molecules 16 (2011) 2375–2390. [58] G.Y. Yang, J. Liao, K. Kim, E.J. Yurkow, C.S. Yang, Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols, Carcinogenesis 19 (1998) 611–616.
chelation in Alzheimer’s disease, J. Neurochem. 97 (2006) 527–536. [36] N.M. Delimont, M.D. Haub, B.L. Lindshield, The impact of tannin consumption on iron bioavailability and status: a narrative review, Curr. Dev. Nutr. 1 (2017) 1–12. [37] N.M. Delimont, N.M. Fiorentino, K.A. Kimmel, M.D. Haub, S.K. Rosenkranz, B.L. Lindshield, Long-term dose-response condensed tannin supplementation does not affect Iron status or bioavailability, Curr. Dev. Nutr. 1 (2017) e001081. [38] P. Ferrari, H. Kulkarni, S. Dheda, S. Betti, C. Harrison, T.G.S. Pierre, J.K. Olynyk, Serum iron markers are inadequate for guiding iron repletion in chronic kidney disease, Clin. J. Am. Soc. Nephrol. 6 (2011) 77–83. [39] P.K. South, W.A. House, D.D. Miller, Tea consumption does not affect iron absorption in rats unless tea and iron are consumed together, Nutr. Res. 17 (1997) 1303–1310. [40] S.J. Yun, X.S. He, W.F. Zhang, D.Y. Chu, C.P. Feng, Alleviation effect of grape seed proanthocyanidins on neuronal apoptosis in rats with Iron overload, Biol. Trace Elem. Res. (2019), https://doi.org/10.1007/s12011-019-01766-8. [41] H. Kudo, S. Suzuki, A. Watanabe, H. Kikuchi, S. Sassa, S. Sakamoto, Effects of colloidal iron overload on renal and hepatic siderosis and the femur in male rats, Toxicology 246 (2008) 143–147. [42] R.R. Parks, C.C. Huang, J. Haddad, Evidence of oxygen radical injury in experimental otitis media, Laryngoscope 104 (1994) 1389–1392. [43] P. Geisser, Iron therapy and oxidative stress, Met. Based Drugs 4 (1997) 137–152. [44] M. Balu, P. Sangeetha, G. Murali, C. Panneerselvam, Age-related oxidative protein damages in central nervous system of rats: modulatory role of grape seedextract, Int. J. Dev. Neurosci. 23 (2005) 501–507. [45] K.O. Chu, S.O. Chan, C.P. Pang, C.C. Wang, Pro-oxidative and antioxidative controls and signaling modification of polyphenolic phytochemicals: contribution to health promotion and disease prevention? J. Agric. Food Chem. 62 (2014) 4026–4038. [46] D. Vauzour, Dietary polyphenols as modulators of brainfunctions: biological actions and molecular mechanisms underpinning their beneficial effects, Oxid. Med. Cell. Longev. 2012 (2012) 1–16.
9
Contents lists available at ScienceDirect
Journal of Trace Elements in Medicine and Biology journal homepage: www.elsevier.com/locate/jtemb
Protective effects of grape seed proanthocyanidins against iron overloadinduced renal oxidative damage in rats Shaojun Yun, Dongyang Chu, Xingshuai He, Wenfang Zhang, Cuiping Feng
⁎
College of Food Science and Engineering, Shanxi Agricultural University, Taigu 030801, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Grape seed proanthocyanidins Iron overload Kidney Oxidative stress Apoptosis
Background: Excessive exposure to iron can cause kidney damage, and chelating drugs such as deferoxamine and deferiprone have limited usefulness in treating iron poisoning. This study was designed to investigate the protective effects of grape seed proanthocyanidins (GSPAs) against iron overload induced nephrotoxicity in rats. The roles of GSPAs in chelating iron, antioxidant activity, renal function, pathological section, and apoptosisrelated gene expression were assessed. Methods: Newly weaned male Sprague–Dawley rats aged 21 days (weight, 65 ± 5 g) were randomly divided into four groups containing 10 rats each: normal control (negative) group, iron overload (positive) group, GSPAs group, and GSPAs + iron overload (test) group. Iron dextran injections (2.5 mg⋅ kg−1) and GSPAs (25 mg⋅ kg−1) were intraperitoneally and intragastrically administered to rats daily for 7 weeks, respectively. Measurements included red blood cell (RBC) count and hemoglobin (Hb) level, serum total iron-binding capacity (TIBC), renal iron content, glutathione peroxidase (GSH-Px) activity, superoxide dismutase (SOD) activity, malondialdehyde (MDA) content, total antioxidant activity (T-AOC), creatinine (CR) and blood urea nitrogen (BUN) levels, pathological changes, and apoptotic Fas, Bax expressions in the kidney tissue. Differences among the dietary groups were determined using one-way analysis of variance with post-hoc Tukey’s test. P < 0.05 was considered statistically significant. Results: RBC count, Hb level, renal iron content, MDA content, CR and BUN levels, and Fas, Bax expressions significantly increased in the positive group than in the negative group; contrarily, TIBC, GSH-Px activity, and TAOC significantly decreased in the positive group than in the negative group (P < 0.05). Although not statistically significant, SOD activity was slightly reduced in the positive group than in the negative group. Inflammatory cell infiltration and fibrous tissue proliferation were observed in the kidney tissue of the rats in the positive group; in contrast, the rats exhibited better recovery when GSPAs were used instead of iron alone. Compared with the positive group, RBC counts, Hb levels, renal iron contents, the MDA content, CR and BUN levels, and Fas, Bax expressions significantly decreased, whereas the TIBC, the GSH-Px and SOD activities as well as T-AOC significantly increased in the test group rats (P < 0.05). There were no significant differences in the RBC counts, Hb levels, TIBC, renal iron contents, the SOD activity and MDA content, CR and BUN levels, and Fas expression between the GSPAs and negative groups. The GSH-Px activity and T-AOC were significantly increased whereas Bax expression was significantly decreased in the GSPAs group rats than in the negative group rats (P < 0.05). The rats in the GSPAs, test, and negative groups displayed glomeruli and tubules with a clear structure; further, the epithelial cells in the renal tubules were neatly arranged. Conclusions: GSPAs have protective effects on nephrotoxicity in rats with iron overload. Thus, further investigation of GSPAs as a new and natural phytochemo-preventive agent against iron overload is warranted.
Abbreviations: GSPAs, grape seed proanthocyanidins; RBC, red blood cell; Hb, hemoglobin; ICP-MS, inductively coupled plasma mass spectrometry; TIBC, total ironbinding capacity; GSH-Px, glutathione peroxidase; SOD, superoxide dismutase; MDA, malondialdehyde; T-AOC, total antioxidant activity; CR, creatinine; BUN, blood urea nitrogen; H&E, hematoxylin and eosin; qRT-PCR, quantitative real-time polymerase chain reaction ⁎ Corresponding author. E-mail address: [email protected] (C. Feng). https://doi.org/10.1016/j.jtemb.2019.126407 Received 12 April 2019; Received in revised form 4 September 2019; Accepted 18 September 2019 0946-672X/ © 2019 Elsevier GmbH. All rights reserved.
Please cite this article as: Shaojun Yun, et al., Journal of Trace Elements in Medicine and Biology, https://doi.org/10.1016/j.jtemb.2019.126407
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
samples were lyophilized, powdered, and frozen at −80 °C until use. Total iron-binding capacity (TIBC), glutathione peroxidase (GSH-Px) activity, superoxide dismutase (SOD) activity, malondialdehyde (MDA), total antioxidant activity (T-AOC), creatinine (CR), blood urea nitrogen (BUN) assay kits were obtained from the Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). Standard solutions for elements (Fe, 1000 μg/mL, GSB 04-1726-2004) were obtained from the National Nonferrous Metals and Electronic Materials Analysis and Testing Center. RNAiso™ Plus, PrimeScript™ RT Master Mix, and QuantiFast®SYBR®Green polymerase chain reaction kits were obtained from Qiagen Co. (Germany). DNA marker, agarose, ethidium bromide, loading buffer, and diethyl pyrocarbonate were provided by Takara Biomedical Technology Co. (Beijing, China). All other reagents used were of analytical grade or purer.
1. Introduction Iron is a crucial micronutrient present in cells and plays an important role in many metabolic and biological processes [1]; however, excessive exposure to iron can cause various toxic effects, including kidney damage. An increasing number of studies have also indicated the pathogenic mechanisms underlying iron overload and its unexpected effects on renal function abnormalities, such as renal toxicity [2] and renal carcinoma [3]. Among the various pathogenic mechanisms of renal injury, oxidative stress influences glomerular structure and function primarily depending on the effects of reactive oxygen species (ROS) on mesangial and endothelial cells [4]. Previous studies have demonstrated that unliganded or incompletely liganded iron ions can participate in “Fenton-type” redox reactions—these involve reactions with hydrogen peroxide (H2O2) or lipid peroxides to generate highly reactive hydroxyl (OH•) or lipid (LO• and LOO•) radicals [5]. Furthermore, iron overload can affect antioxidant enzyme levels and activities, thereby resulting in apoptotic effects in the kidney [6,7]. This leads to a series of pathological changes, in turn causing biochemical and physiological dysfunction in the body. To protect against the deleterious effects of iron accumulation, potential strategies include protecting the body from iron-induced oxidative stress. Currently, chelation therapy using deferoxamine and deferiprone is widely used to treat iron overload diseases [8]. Despite the therapeutic effectiveness of these drugs, some disadvantages such as hepatic dysfunction, allergy, agranulocytosis, and poor patient compliance exist [9,10]; thus, chelating drugs have limited usefulness in treating iron poisoning. Phytochemicals present in vegetables, fruit, spices, and medicinal plants have a wide range of health-beneficial effects, including heart-, kidney-, liver-, and brain-protective ones [11]. Some tannin-like compounds, such as proanthocyanidins (PAs), are widely found in black tea and red wine. PAs share some common structural features (e.g., phenolic nature and high molecular weight) with phenolic polymers [12] and reportedly possess a wide range of pharmacological and medicinal properties against oxidative stress. PAs’ antioxidant capacity essentially relies on their bioavailability and, in particular, on their absorption through the gut barrier and their metabolism [13]. PAs have all-round antioxidative mechanisms, including a radical scavenging action, singlet oxygen quenching action, chelating action, and inhibitory action on polyphenol oxidase [14]. Polyphenols with catechol or gallol groups are also effective metal chelators. On deprotonation, which is essential for metal binding, the catechol and gallol functionalities are referred to as catecholate and gallate groups, respectively. Octahedral geometry is preferred by metal ions, such as Fe2+ and Fe3+, which can coordinate up to three catecholate or gallate groups. Because of this ability, polyphenols with catechol or gallol groups are expected to always bind iron in a 3:1 fashion [15]. By comparison, maximal inhibition of iron uptake by phytic acid occurred at a 1:10 ratio of Fe to phytic acid [16]. Further, we recently found that PAs from grape seed (a class of naturally occurring active phenols) can inhibit iron uptake from soybean seed ferritin in rats and are toxic to rats with iron deficiency anemia [17]. Although previous studies have strongly suggested that grape seed proanthocyanidins (GSPAs) are useful in treating oxidative stress, their protective effects against kidney damage caused by iron overload have not yet been reported. Therefore, this study aimed to investigate the effects of GSPAs supplementation on iron overload-induced nephrotoxicity and the potential mechanism of this process in rats.
2.2. Animals and diets Male Sprague–Dawley rats aged 21 days were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China. All animal experiments and procedures were conducted in compliance with the Guide for the Care and Use of Laboratory Animals (U.S. National Academy of Sciences, National Institutes of Health Publication 6–23, revised 1985) and the principles and procedures of the European Communities Council Directives (86/609/EEC). Moreover, all the experimental protocols were approved by the ethics committee of Shanxi Agricultural University. After 1 week of adaptive feeding, the rats were randomly divided into four groups comprising 10 rats each: control group (negative group), iron overload (positive) group, GSPAs group, and GSPAs + iron overload (test) group. Throughout the study period, the rats had ad libitum access to an AIN-93 G diet [19] and deionized water through the MilliQ Plus system (Millipore Corp.; Sao Paulo, SP, Brazil). All rats were maintained in stainless steel cages and were subjected to a 12-h light cycle and a temperature of 23 °C ± 2 °C. The model and test group rats were intraperitoneally administered iron dextran injections (2.5 mg⋅ kg−1) daily. The GSPAs and test group rats were daily intragastrically administered GSPAs solubilized in same amount of saline (25 mg⋅ kg−1). Normal saline was used to eliminate the error of physiological stress, and the experiment was conducted for 7 weeks. The rats in the NC group were intraperitoneally and gastrically injected equal doses of saline; the doses were equivalent to those of dextran iron and GSPCs solvents, respectively (1 mL/100 g body weight). At the end of the experiment, the rats’ kidneys were removed and frozen at −80 °C for further analysis. 2.3. Red blood cell (RBC) count, hemoglobin (Hb) content, and TIBC in rats At the end of the experiment, blood samples were collected into heparinized microcapillary tubes. Hb levels and RBC counts were measured using the Spotchem II kit (Arkray Inc., Japan). For serum TIBC detection, based on the manufacturer’s instructions, 1 mL of iron standard solution (179.1 μmol/L, provided by the kit) was added to 1 mL of rat serum; the sample was thoroughly mixed and incubated at room temperature for 10 min. Next, 50 mg of iron adsorbent (provided by the kit) was added to the sample. The sample was then thoroughly mixed and incubated at room temperature for 5 min (repeated for three additional times). The sample was then centrifuged at 3500 rpm at 25 °C for 10 min. The blank tube contained 1 mL of distilled water, the standard tube contained 1 mL of iron standard application solution (17.91 μmol/L), and the test tube contained 1 mL of the supernatant after centrifugation. Two milliliters of iron chromogenic agent was added to all the three tubes. After through mixing, the samples were incubated in a boiling water bath for 5 min. The samples were then cooled and centrifuged at 3500 rpm for 10 min, after which absorbance was measured at 520 nm using double-distilled water. Using the absorbance values obtained, the serum TIBC was calculated on the basis of
2. Materials and methods 2.1. Materials PAs from grape seeds were extracted and purified as previously described [18]. The purity of the PA extracts was 95%. The resulting 2
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
the formula provided in the kit instructions.
2.7. Kidney histology
2.4. Renal iron content
Kidney tissue was fixed in 10% (v/v) formaldehyde, processed by successive dehydrations in ethanol, and embedded in paraffin. Serial 5–μm–thick sections were cut, and the sections were stained with hematoxylin and eosin (H&E) using standard procedures to identify the kidney histology. Images of the positively stained sections were obtained using an Olympus BX40 microscope and CC-12 Soft-Imaging System with Olympus MicroSuite (TM)-B3SV software (Olympus, Tokyo, Japan).
The renal iron content was determined using inductively coupled plasma mass spectrometry (ICP-MS). Concentrated HNO3 (8 mL) and HClO4 (2 mL) were added to 0.1 g of kidney tissue in a tube; the sample was shaken, sealed, and allowed to stand overnight at room temperature. The following day, the sample was heated until the liquid became transparent and then cooled. Subsequently, the sample was filtered, and the renal iron content was determined after adjusting the volume to 25 mL with 1% HNO3. The standard solution for elements (Fe, 1000 μg/ mL, GSB 04-1726-2004) was diluted to establish the standard curve. An inductively coupled plasma mass spectrometer (iCAP-Q; Thermo Fisher Scientific, American) in the KED mode was employed for determining the iron concentration. The RF power was set to 1050 W and the nebulizer gas to 0.86 L/min. The sample lifting rate was 1.2 L/min. The cooling air flow rate was 13.8 L/min, and the carrier flow rate was 0.98 L/min. The dwell time was set to 50 ms. These parameters were the optimal conditions for this instrument.
2.8. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted from the kidney using Trizol reagent, following the manufacturer’s instructions. Further, 2 μL of the extracted RNA was subjected to agarose gel electrophoresis for RNA integrity detection, and 1 μL of the RNA was used for qualitative and quantitative analysis performed using a Nanodrop ND-2000 spectrophotometer. The integrity of the extracted RNA was electrophoretically assessed by ethidium bromide staining, and the purity of the RNA was evaluated by checking the absorbances at 260 and 280 nm (OD260 nm/OD280 nm > 1.9 indicates the purity of RNA). The extracted RNA was stored at −80 °C until further use. The qPCR assays were performed according to MIQE standards [23]. According to some previous studies [24,25], the kidney showed the lowest variation with β-actin, and this result corroborates our pre-experimental results. Hence, β-actin was selected as a reference gene in this study. qRT-PCR primers for β-actin, Fas and Bax (sequences presented in Table 1) were designed using the Primer 5.0 software. Each of the primer pairs was tested for specificity using conventional reverse transcription-PCR before qRT-PCR. qRT-PCR was performed using the Mx3000P™ qPCR system (Stratagene, La Jolla, CA, USA) and a two-step SYBR qRT-PCR kit (Takara, Dalian, China). After initial denaturation at 95 °C for 30 s, qRT-PCR was performed under the following thermocycling conditions: 42 cycles at 95 °C for 5 s and 62 °C for 34 s. A dissociation curve was obtained using the reaction conditions of 95 °C for 15 s, 62.8 °C for 1 min, and 95 °C for 15 s to verify the specificity of the amplified products. mRNA abundance of β-actin, Fas, and Bax was calculated using the comparative △△CT method provided by the Mx3000P™ qPCR system.
2.5. Oxidative stress in rat kidney The frozen kidney tissue samples were weighed and homogenized (1:10, w/v) in 50 mmol⋅L−1 phosphate buffer (pH 7.4) and then the mixture was placed in an ice bath. The homogenate and supernatant were frozen at −20 °C and stored as aliquots until further use during the biochemical assays. The MDA content, GSH-Px and SOD activities, and T-AOC were determined according to the manufacturer’s instructions provided in the respective kits. GSH-Px was estimated based on the following principle: GSH-Px catalyzes glutathione oxidation with cumene hydroperoxide [20]. In the presence of glutathione reductase and nicotinamide adenine dinucleotide phosphate hydrogen (NADPH), oxidized glutathione is immediately converted to its reduced form with concomitant oxidation of NADPH to NADP+. The decrease in absorbance at 340 nm was measured at 37 °C. Total SOD activity (U/mg of protein) was determined following the method reported by Sun et al. [21]. This method is based on the inhibition of nitroblue tetrazolium (NBT) reduction using the xanthine–xanthine oxidase system as a superoxide generator. One unit of SOD was defined as the amount of enzyme that causes 50% inhibition in the reduction rate of NBT. The MDA content, which is an indicator of free radical generation, was estimated following the double heating method reported by Draper and Hadley [22]. This method is based on the spectrophotometric measurement of the color generated via the reaction of thiobarbituric acid with MDA. The T-AOC was determined following the kit instructions. The principle of the T-AOC detecting method is based on the ability of many antioxidants, such as GSH and SOD, in the body to reduce Fe3+ to Fe2+. The latter can form a stable complex with phenanthrolines, and its antioxidant capacity can be measured by colorimetry.
2.9. Statistical analysis Statistical Package for the Social Sciences software (SPSS, Inc.; Chicago, IL, USA) was used for statistical analysis. Data were expressed as mean ± the standard error of the mean (SEM). Differences among the dietary groups were determined using one-way analysis of variance with a post-hoc Tukey’s test. P < 0.05 indicated statistical significance.
2.6. CR and BUN levels Table 1 Primer sequences and corresponding PCR product size.
The total serum CR activity was detected using a CR kit. The principle of this kit is based on the Jaffe reaction. In this reaction, in the presence of picric acid, serum CR generates a jacinth compound that can be measured at 510 nm. The BUN level was measured with the BUN kit, the principle of which is based on the Fearon reaction. Briefly, under acidic conditions with heating, BUN and diacetyldioxime react to generate a red condensate, the absorbance values of which can be obtained at 520 nm to determine the BUN level. All procedures were performed following the manufacturer’s instructions. 3
序号
Gene
Primers (5' > 3')
Product Size (bP)
1
β-actin
110
2
Fas
3
Bax
TACCCAGGCATTGCTGACAG AGCCACCAATCCACACAGAG CGCAGCGGTTAGCTTTTCTG ATTTGCTCGGCAGCACAAGA TGGCGATGAACTGGACAACA CCCAGTTGAAGTTGCCGTCT
173 125
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
3. Results
sections. In the GSPAs, test, and negative group rats, the glomeruli and tubules displayed a clear structure; further, the epithelial cells of the renal tubules were neatly arranged (Fig. 5).
3.1. General condition of rats
3.7. Fas and Bax gene expressions in the rat kidney
During the period in which the rats received the intraperitoneal iron dextran injections, their general nutritional status and behavior were characterized by rough and sparse fur, loss of luster, loss of appetite, and susceptibility to be frightened; as the experiment progressed, these symptoms worsened. By the end of the experiment, the entire positive group exhibited such symptoms. Moreover, GSPAs ameliorated these symptoms. In the test group, all the rats did not show the above symptoms; however, they did not return to normal at all. There was no significant difference between the GSPAs group and negative group.
The Fas expression significantly increased by 96.15% in the positive group rats compared with that in the negative group rats; further, its expression in the test group rats was significantly increased by 49.65% (P < 0.05). The Fas expression was significantly reduced by 23.71% and 36.90% in the test and GSPAs group rats, respectively, compared with that in the positive group rats (P < 0.05). The Fas expressions in the GSPAs and negative groups were similar. The Bax expression was significantly increased by 57.43% in the positive group rats compared with that in the negative group rats (P < 0.05). Further, the Bax expressions in the kidney tissues of the test and GSPAs group rats were significantly decreased by 30.20% and 43.03%, respectively, compared with those in the kidney tissues of the negative group (P < 0.05). The Bax expressions in the test and GSPAs group rats were significantly decreased by 55.67% and 63.82%, respectively, compared with that in the positive group rats (P < 0.05) (Fig. 6).
3.2. Effects of GSPAs on RBC counts, Hb levels, and TIBC in rats The positive group rats had significantly greater RBC counts and Hb levels than the negative group rats (P < 0.05). The serum TIBC was significantly lower in the positive group rats than in the negative group rats (P < 0.05). There were no significant differences in these parameters between the GSPAs and negative groups. Compared with the negative group, RBC counts and Hb levels significantly increased (P < 0.05), whereas the TIBC slightly decreased in the test group rats (P > 0.05). Compared with the positive group, RBC counts and Hb levels significantly decreased, whereas the TIBC significantly increased in the test group rats (P < 0.05). These findings indicate that the rats recovered better when GSPAs were used instead of iron alone (Fig. 1).
4. Discussion and conclusion The successful establishment of an iron overload model is important for research on iron metabolism-associated diseases. In the present study, an intraperitoneal dextran iron injection was used to develop the iron overload rat model [26,27]. After administering the injection for 7 weeks, the general nutritional status and behavior of the rats were observed to have been severely impaired due to iron deposits, and the symptoms mentioned earlier continued to increase in severity as the experiment progressed. However, it was noted that GSPAs can relieve the above symptoms to a certain extent. Growing evidence suggests that increased body iron levels induce a variety of different pathological conditions, which lead to cellular and tissue damages [28,29]. With respect to emotional behavior, iron overload appears to alter anxietylike behavior and mood [30,31]. The generation of ROS mediated by excess body iron has been implicated in these diseases [32,33]. GSPAs exert a significantly high protection against cellular and tissue damages induced by oxygen free radicals [34]. Thus, in this rat model, GSPAs showed a protective effect on the impaired general state of rats treated with iron dextran. The iron status was further evaluated in rats by studying the numbers of RBCs, the Hb content, and the TIBC in serum. The results showed that iron overload increased the number of RBC, the Hb content and decreased the TIBC. GSPAs can alleviate the above symptoms. Polyphenol extracts which have a strong metal chelating ability can regulate iron metabolism-related protein and transferrin receptor expression [35]. Our previous study also showed that GSPAs can inhibit the absorption of iron from soybean ferritin in iron-deficient rats [17]. Thus, it is speculated that the GSPAs’ ability to chelate iron caused the number of RBCs and Hb content to significantly decrease in the rats with iron overload and the TIBC to significantly increase. The results of this study suggest that GSPAs supplementation for at least seven weeks does not influence iron-related blood indices in the control group. Similar findings were also obtained in previous animal and epidemiological studies [36,37]. Only a few single-meal studies have noted reductions in iron bioavailability; the total iron absorption differences were within 10% between tannin consumers and non-consumers, which may not affect the iron status in the long term [38]. This may be an important normalizing factor given the wide variability of iron absorption, but it may point to significant outcomes that have little meaningful impact on iron status when tannin-rich diets are consumed over time. The results also showed that although GSPAs could interfere with iron overload, the TIBC that actually reflects the level of
3.3. Renal iron content Changes in the renal iron content in the iron-overloaded rats with or without treatment are illustrated in Fig. 2. Compared with the negative group rats, the renal iron contents of the positive group rats were significantly increased (P < 0.05). The GSPAs, test, and negative group rats exhibited no changes in their renal iron contents. Compare with the positive group, the renal iron content of the test group rats significantly decreased (P < 0.05). 3.4. Measurement of oxidative stress The GSH-Px activity and T-AOC was significantly decreased in the positive group rats than in the negative group rats (P < 0.05). There were no changes in the SOD activity between the two groups. The MDA content was significantly increased in the positive group rats than in the negative group rats (P < 0.05). Conversely, compared with the positive group rats, the GSH-Px and SOD activities as well as T-AOC were all significantly increased and the MDA content was significantly decreased (P < 0.05) in the test group rats. The GSH-Px activity and TAOC were significantly increased in the GSPAs group rats than in the negative group rats (P < 0.05); the SOD activity and MDA content exhibited no obvious changes in any of the groups (Fig. 3). 3.5. Serum CR and BUN levels The serum CR and BUN levels were significantly increased in the positive group rats than in the negative group rats (P < 0.05). The CR and BUN levels were significantly decreased in the test and GSPAs group rats than in the positive group rats (P < 0.05) but were similar to the levels in the negative group rats (Fig. 4). 3.6. Effect of GSPAs on renal histological changes Inflammatory cell infiltration and fibrous tissue proliferation (see blue arrow in Fig. 5) were observed in the positive group rats but not in the negative group rats. The GSPAs and test group rats exhibited no obvious histological changes upon H&E staining of the kidney tissue 4
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 1. Effects of GSPAs on the RBC count, Hb level, and TIBC in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
above blood indices. In fact, because iron dextran was intraperitoneally injected, the absorbed iron also affected other tissues, such as the brain [40]. However, whether in brain or kidney tissue, GSPAs have some inhibitory effects on the adverse reactions caused by iron overload. An excess of iron deposits in renal cells can lead to kidney oxidative injury and dysfunction [41]. MDA is a major product of lipid peroxidation, and it can indirectly reflect the degree of damage to cells [42]. In our study, we observed that the MDA level was markedly increased in rats with iron overload, thus suggesting the induction of renal lipid peroxidation. As potent enzymatic antioxidants, SOD and GSH-Px can bring the first line of defense against free radicals by converting toxic superoxide into the less toxic hydrogen peroxide [43]. T-AOC depends on the various antioxidant substances in the body. Except for the increased concentration of MDA, decreased GSH-Px activity and T-AOC were also observed in this study. Thus, at the current dose of iron dextran, the defense system in the kidneys was insufficient to provide complete protection against the induced free radical damage. The response of the kidneys to the toxic iron was an escalation in lipid peroxidation. Our results provided convincing evidence that GSPAs exert robust protective effects against lipid peroxidation induced by iron overload. An interventional study has demonstrated that the oral administration of grape seed extract lowers ROS generation and plasma
transferrin was slightly lower in the test group than in the normal group, indicating that the iron binding capacity of transferrin was somewhat lower than that of the normal group. Consistent with this result, the RBC number and Hb content in the test group did not recover to normal during the 7-week experimental period. We speculate this to be so owing to the intervention time of GSPAs. If the time of intervention is more than 7 weeks, it is possible for these indicators to return to normal levels. Iron deposits lead to excessive iron content in the kidneys, which leads to nephrotoxicity and promotes the occurrence of acute and chronic kidney diseases [38]. Therefore, we further evaluated the iron content in the kidneys. The results showed that compared with the control group, the iron content in the kidney tissues of the model rat group increased significantly, demonstrating that a nephritic ironloaded rat model had been established. The complex formation between polyphenols and iron depends on the polyphenol structure, as well as the pH and concentrations of polyphenols and iron in the solution [15]. As major polyphenols, tannins form insoluble complexes with iron, thereby inhibiting its absorption [39]. After GSPAs and iron dextran were together administered to rats, we observed that GSPAs played a role in decreasing the iron levels in the test group through their ironchelating characteristics. The results displayed the same trend with the 5
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
antioxidant properties. Polyphenolic phytochemicals can reportedly directly scavenge ROS and chelate divalent metal ions to reduce the oxidative activity [45]. Further, polyphenolic phytochemicals exert indirect antioxidant effects via induction of endogenous protective antioxidative enzymes. Of note, these indirect activities involve the upregulation of antioxidant enzymes or cytoprotective proteins [46] and provide more efficient antioxidant actions in vivo [47,48]; our results reconfirm this effect. The changes in CR and BUN levels can be used to estimate the degree of renal function impairment. The serum CR level can reflect the glomerular filtration rate in the blood to some extent. The plasma CR level significantly increases when the kidney is damaged [49]. Protein metabolism in vivo produces BUN primarily via excretion from the kidney, and impaired glomerular filtration can lead to an increase in the plasma BUN level [49]. In vivo iron levels are directly related to the degree of damage from proteinuria, tubulointerstitial lesions, and other diseases [50]. Our results demonstrated that the CR and BUN levels of rats with iron overload were significantly increased, and this finding was consistent with a previously reported finding [51]. PAs, like all phenolic compounds, are reducing agents and excellent chelators of iron(III) [13]. Thus, it can be said that GSPAs act as chelators and antioxidants to alleviate renal function damage. Similar results were noted in terms of the pathological changes in the kidney. Consistent with previous result [51], we observed interstitial inflammatory cell infiltration and fibrous tissue proliferation in the kidney tissues of the positive group rats, and these findings were alleviated after the GSPAs intervention. These results suggest that GSPAs can interfere with pathological changes in the kidney tissue induced by iron overload via its roles of iron reduction and oxidation resistance. Apoptosis is a necessary biological process that eliminates unwanted cells in the disease process. Apoptosis caused by oxidative stress has been demonstrated in a previous study [52]. Extrinsic apoptosis is
Fig. 2. Effects of GSPAs on renal iron content in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
protein carbonylation while simultaneously enhancing the endogenous antioxidant system activity [44]. Our results suggest that iron deposition in the kidneys negatively affects the oxidase system. GSPAs induce considerable protective effects on oxidative stress-induced lipid peroxidation injuries in rat kidney tissues. In other words, GSPAs induce protective effects against renal damage via both their chelating role and
Fig. 3. Effects of GSPAs on the GSH-Px and SOD activities, MDA content, and T-AOC in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
6
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 4. Effects of GSPAs on CR and BUN levels in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
triggered by so-called “death receptors” (such as the FAS receptor) upon interactions with their cognate death ligands (such as the FAS-ligand FASLG). The intrinsic apoptosis pathway relies on the intracellular release of pro-apoptotic members of the BCL2 family in response to deprivation of growth factors or exposure to genotoxic agents [53]. Fas and Bax are important components of apoptotic proteins that are associated with cell death, and their overexpression promotes apoptosis [53]. Our results demonstrated that in the kidney tissue, the increase of iron content could promote Fas and Bax expression and that GSPAs could significantly down-regulate these genes. Previous research has indicated that excessive ROS production may be an early response of intracellular iron overload that manifests prior to morphological changes of apoptosis [54]. Our results reconfirmed that excessive iron deposits promote apoptosis via inducing oxidative stress in the kidneys; however, the apoptosis was then inhibited by GSPAs treatment.
Administration of medicinal plant antioxidants is considered to mitigate the pathology of oxidative stress [55]. Recent studies have also suggested PAs may help prevent cancer growth by inducing apoptosis and inhibiting proliferation [56,57]. Thus, it is suggested that PAs can be used to prevent and manage renal injury induced by iron overload. Although not statistically significant, GSPAs also exhibited slightly upregulated Fas expression, indicating pro-apoptotic signaling. Further, polyphenolic phytochemicals can be oxidized to generate ROS in cell culture media and may result in death of the cells grown in the media [58]; however, the pro-apoptotic effect is also related to the bioavailability of polyphenolic phytochemicals, and the specific mechanism needs to be studied further. In summary, our study is the first to demonstrate the protective effects of GSPAs in rats with iron overload-induced nephrotoxicity by improving the general condition of rats, reducing the iron content in the Fig. 5. Effects of GSPAs on renal H&E staining of the kidney tissue sections obtained from the rats in each group. Note: A: negative group (intraperitoneal injection of saline + intragastric administration of saline); B: test group (intraperitoneal injection of iron dextran + intragastric administration of GSPAs); C: positive group (intraperitoneal injection of iron dextran + intragastric administration of saline); D: GSPAs group (intraperitoneal injection of saline + intragastric administration of GSPAs). Black arrows indicate renal corpuscles; red arrows indicate renal tubules (magnification, 400×).
7
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
Fig. 6. Effects of GSPAs on Fas and Bax expression levels in each group of rats. Mean levels are shown as barplots with the standard error of the mean (SEM). Different letters denote significant differences (P < 0.05) in the index levels between groups (negtive group: intraperitoneal injection of saline + intragastric administration of saline; test group: intraperitoneal injection of iron dextran + intragastric administration of GSPAs; positive group: intraperitoneal injection of iron dextran + intragastric administration of saline; GSPAs group: intraperitoneal injection of saline + intragastric administration of GSPAs).
blood and kidneys, enhancing the antioxidant defense system, ameliorating renal function and structure, and inhibiting renal apoptosis. The underlying mechanism may be relevant to the antioxidant and ironchelating capacity of GSPAs.
BioFactors 13 (2000) 115–120. [14] T. Ariga, The antioxidative function, preventive action on disease and utilization of proanthocyanidins, BioFactors 21 (2004) 197–201. [15] N.R. Perron, J.L. Brumaghim, A review of the antioxidant mechanisms of polyphenol compounds related to Iron binding, Cell Biochem. Biophys. 53 (2009) 75–100. [16] R.P. Glahn, G.M. Wortley, P.K. South, D.D. Miller, Inhibition of Iron uptake by phytic acid, tannic acid, and ZnCl2 : studies using an in vitro Digestion/Caco-2 cell model, J. Agric. Food Chem. 50 (2002) 390–395. [17] S.J. Yun, T. Zhang, M.L. Li, B. Chen, G.H. Zhao, Proanthocyanidins inhibit iron absorption from soybean (Glycine max) seed ferritin in rats with iron deficiency anemia, Plant Foods Hum. Nutr. 66 (2011) 212–217. [18] J.J. Deng, M.L. Li, T. Zhang, B. Chen, X.J. Leng, G.H. Zhao, Binding of proanthocyanidins to soybean (Glycine max) seed ferritin inhibiting protein degradation by protease in vitro, Food Res. Int. 44 (2011) 33–38. [19] P.G. Reeves, F.H. Nielsen, G.C. Fahey, AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet, J. Nutr. 123 (1993) 1939–1951. [20] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase, J. Lab. Clin. Med. 70 (1967) 158–170. [21] Y. Sun, L.W. Oberley, Y. Li, A simple method for clinical assay of superoxide dismutase, Clin. Chem. 34 (1988) 497–500. [22] H.H. Draper, M. Hadley, Malondialdehyde determination as index of lipid peroxidation, Methods Enzymol. 86 (1990) 421–431. [23] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments, Clin. Chem. 55 (2009) 611–622. [24] S. Klenke, K. Renckhoff, A. Engler, J. Peters, U.H. Frey, Easy-to-use strategy for reference gene selection in quantitative real-time PCR experiments, NaunynSchmiedeberg’s Arch. Pharmacol. 389 (2016) 1353–1366. [25] H.J. Kim, J.I. Na, B.W. Min, J.Y. Na, K.H. Lee, J.H. Lee, Y.J. Lee, H.S. Kim, J.T. Park, Evaluation of protein expression in housekeeping genes across multiple tissues in rats, Korean J. Pathol. 48 (2014) 193–200. [26] C.J. Dillard, J.E. Downey, A.L. Tappel, Effect of antioxidants on lipidperoxidation in iron-loaded rats, Lipids 19 (1984) 127–133. [27] M. Galleano, S. Puntarulo, Hepatic chemiluminescence and lipid peroxidation in mild iron overload, Toxicology 76 (1992) 27–38. [28] E.D. Weinberg, Cellular iron metabolism in health and disease, Drug Metab. Rev. 22 (1990) 531–579. [29] R.B. Lauffer, Preventive measures for the maintenance of low but adequate iron stores, Iron and Human Disease, CRC Press, Boca Raton, 1992, pp. 459–474. [30] T.J. Sobotka, P. Whittaker, J.M. Sobotka, R.E. Brodie, D.Y. Wander, M. Robl, M. Bryant, C.N. Barton, Neurobehavioral dysfunctions associated with dietary iron overload, Physiol. Behav. 59 (1996) 213–219. [31] K. Maaroufi, M. Ammari, M. Jeljeli, V. Roy, M. Sakly, H. Abdelmelek, Impairment of emotional behavior and spatial learning in adult Wistar rats by ferrous sulfate, Physiol. Behav. 96 (2009) 343–349. [32] W. Nandar, E.B. Neely, E. Unger, J.R. Connor, A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta 1832 (2013) 729–741. [33] T.P. Tuomainen, S. Loft, K. Nyyssönen, K. Punnonen, J.T. Salonen, H.E. Poulsen, Body iron is a contributor to oxidative damage of DNA, Free Radic. Res. 41 (2007) 324–328. [34] E.M. EI-Sayed, A.M. Mansour, W.S. EI-Sawy, Protective effect of proanthocyanidins against doxorubicin-induced nephrotoxicity in rats, J. Biochem. Mol. Toxicol. 31 (2017) e21965. [35] L. Reznichenko, T. Amit, H. Zheng, Y. Avramovich‐Tirosh, M.B.H. Youdim, S. Mandel, Reduction of iron regulated amyloid precursor protein and β-amyloid peptide by (-)-epigallocatechin-3-gallate in cell cultures: implications for iron
Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgements This project was supported by a grant from the National Natural Science Foundation of China (31801551), Research Startup Funds from Shanxi Agricultural University (2013YJ30), and the Science and Technology Innovation Project of Higher Education in Shanxi Province (2016150). References [1] G.H. Zhao, Phytoferritin and its implications for human health and nutrition, Biochim. Biophys. Acta 1800 (2010) 815–823. [2] C.J. Dillard, J.E. Downey, A.L. Tappel, Effect of antioxidants on lipid peroxidation in iron-loaded rats, Lipids 19 (1984) 127–133. [3] J.L. Li, S. Okada, S. Hamazaki, Y. Ebina, O. Midorikawa, Subacute nephrotoxicity and induction of renal cell carcinoma in mice treated with ferric nitrilotriacetate, Cancer Res. 47 (1987) 1867–1869. [4] S. Thamilselvan, S.R. Khan, Oxalate and calcium oxalate crystals are injurious to renal epithelial cells: results of in vivo and in vitro studies, J. Nephrol. 11 (1998) 66–69. [5] D. Galaris, K. Pantopoulos, Oxidative stress and iron homeostasis: mechanistic and health aspects, Crit. Rev. Clin. Lab. Sci. 45 (2008) 1–23. [6] L. He, G.A. Perkins, A.T. Poblenz, J.B. Harris, M. Hung, M.H. Ellisman, D.A. Fox, Bcl-xL over expression blocks bax-mediated mitochondrial contact site formation and apoptosis in rod photoreceptors of lead-exposed mice, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 1022–1027. [7] G.P. Yuan, S.J. Dai, Z.Q. Yin, H.K. Lu, R.Y. Jia, J. Xu, et al., Sub-chronic lead and cadmium co-induce apoptosis protein expression in liver and kidney of rats, Int. J. Clin. Exp. Pathol. 7 (2014) 2905–2914. [8] H. Miyajima, Y. Takahashi, T. Kamata, H. Shimizu, N. Sakai, J.D. Gitlin, Use of desferrioxamine in the treatment of aceruloplasminemia, Ann. Neurol. 41 (1997) 404–407. [9] V. Berdoukas, K. Farmaki, S. Carson, J. Wood, T. Coates, Treating thalassemia major-related iron overload: the role of deferiprone, J. Blood Med. 3 (2012) 119–129. [10] F.N. Al-Refaie, B. Wonke, A.V. Hoffbrand, D.G. Wickens, P. Nortey, G.J. Kontoghiorghes, Efficacy and possible adverse effects of the oral iron chelator 1,2-dimethyl-3-hydroxypyrid-4-one (L1) in thalassemia major, Blood 80 (1992) 593–599. [11] M. Nassiri-Asl, H. Hosseinzadeh, Review of the pharmacological effects of Vitis vinifera (grape) and its bioactive compounds, Phytother. Res. 23 (2009) 1197–1204. [12] M. Nassiri-Asl, H. Hosseinzadeh, Review of the pharmacological effects of Vitis vinifera (grape) and its bioactive constituents: an update, Phytother. Res. 30 (2016) 1392–1403. [13] A. Scalbert, S. Déprez, I. Mila, A.M. Albrecht, J.F. Huneau, S. Rabot, Proanthocyanidins and human health: systemic effects and local effects in the gut,
8
Journal of Trace Elements in Medicine and Biology xxx (xxxx) xxxx
S. Yun, et al.
[47] M.L. Hu, Dietary polyphenols as antioxidants and anticancer agents: more questions than answers, Chang Gung Med. J. 34 (2011) 449–460. [48] G. Celik, A. Semiz, S. Karakurt, S. Arslan, O. Adali, A. Sen, A comparative study for the evaluation of two doses of ellagic acid on hepatic drug metabolizing and antioxidant enzymes in the rat, Biomed Res. Int. 2013 (2013) 1–9. [49] S. Gowda, P.B. Desai, S.S. Kulkarni, V.V. Hull, A.A. Math, S.N. Vernekar, Markers of renal function tests, N. Am. J. Med. Sci. 2 (2010) 170–173. [50] S.V. Shah, R. Baliga, M. Rajapurkar, V.A. Fonseca, Oxidants in chronic kidney disease, J. Am. Soc. Nephrol. 18 (2007) 16–28. [51] S. Guan, J. Ma, Y. Zhang, Y. Gao, Y. Zhang, X. Zhang, Danshen (Salvia miltiorrhiza) injection suppresses kidney injury induced by iron overload in mice, PLoS One 8 (2013) e74318. [52] M. Jazvinšćak Jembrek, P.R. Hof, G. Šimić, Ceramides in Alzheimer’s disease: key mediators of neuronal apoptosis induced by oxidative stress and Aβ accumulation, Oxid. Med. Cell. Longev. 2015 (2015) 346783. [53] S. Meynier, F. Rieux-Laucat, FAS and RAS related apoptosis defects: from autoimmunity to leukemia, Immunol. Rev. 287 (2019) 50–61. [54] Y. Kohgo, K. Ikuta, T. Ohtake, Y. Torimoto, J. Kato, Body iron metabolism and pathophysiology of iron overload, Int. J. Hematol. 88 (2008) 7–15. [55] M. Rafieian-Kopaei, Medicinal plants for renal injury prevention, J. Renal Inj. Prev. 2 (2013) 63–65. [56] L.A. Kresty, A.B. Howell, M. Baird, Cranberry proanthocyanidins induce apoptosis and inhibit acid-induced proliferation of human esophageal adenocarcinoma cells, J. Agric. Food Chem. 56 (2008) 676–680. [57] L.A. Kresty, A.B. Howell, M. Baird, Cranberry proanthocyanidins mediate growth arrest of lung cancer cells through modulation of gene expression and rapid induction of apoptosis, Molecules 16 (2011) 2375–2390. [58] G.Y. Yang, J. Liao, K. Kim, E.J. Yurkow, C.S. Yang, Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols, Carcinogenesis 19 (1998) 611–616.
chelation in Alzheimer’s disease, J. Neurochem. 97 (2006) 527–536. [36] N.M. Delimont, M.D. Haub, B.L. Lindshield, The impact of tannin consumption on iron bioavailability and status: a narrative review, Curr. Dev. Nutr. 1 (2017) 1–12. [37] N.M. Delimont, N.M. Fiorentino, K.A. Kimmel, M.D. Haub, S.K. Rosenkranz, B.L. Lindshield, Long-term dose-response condensed tannin supplementation does not affect Iron status or bioavailability, Curr. Dev. Nutr. 1 (2017) e001081. [38] P. Ferrari, H. Kulkarni, S. Dheda, S. Betti, C. Harrison, T.G.S. Pierre, J.K. Olynyk, Serum iron markers are inadequate for guiding iron repletion in chronic kidney disease, Clin. J. Am. Soc. Nephrol. 6 (2011) 77–83. [39] P.K. South, W.A. House, D.D. Miller, Tea consumption does not affect iron absorption in rats unless tea and iron are consumed together, Nutr. Res. 17 (1997) 1303–1310. [40] S.J. Yun, X.S. He, W.F. Zhang, D.Y. Chu, C.P. Feng, Alleviation effect of grape seed proanthocyanidins on neuronal apoptosis in rats with Iron overload, Biol. Trace Elem. Res. (2019), https://doi.org/10.1007/s12011-019-01766-8. [41] H. Kudo, S. Suzuki, A. Watanabe, H. Kikuchi, S. Sassa, S. Sakamoto, Effects of colloidal iron overload on renal and hepatic siderosis and the femur in male rats, Toxicology 246 (2008) 143–147. [42] R.R. Parks, C.C. Huang, J. Haddad, Evidence of oxygen radical injury in experimental otitis media, Laryngoscope 104 (1994) 1389–1392. [43] P. Geisser, Iron therapy and oxidative stress, Met. Based Drugs 4 (1997) 137–152. [44] M. Balu, P. Sangeetha, G. Murali, C. Panneerselvam, Age-related oxidative protein damages in central nervous system of rats: modulatory role of grape seedextract, Int. J. Dev. Neurosci. 23 (2005) 501–507. [45] K.O. Chu, S.O. Chan, C.P. Pang, C.C. Wang, Pro-oxidative and antioxidative controls and signaling modification of polyphenolic phytochemicals: contribution to health promotion and disease prevention? J. Agric. Food Chem. 62 (2014) 4026–4038. [46] D. Vauzour, Dietary polyphenols as modulators of brainfunctions: biological actions and molecular mechanisms underpinning their beneficial effects, Oxid. Med. Cell. Longev. 2012 (2012) 1–16.
9