- Email: [email protected]
Protective effects of pyrrolidine dithiocarbamate on myocardium apoptosis induced by adriamycin in rats
International Journal of Cardiology 114 (2007) 159 – 165 www.elsevier.com/locate/ijcard
Protective effects of pyrrolidine dithiocarbamate on myocardium apoptosis induced by adriamycin in rats Hongli Li a, Hongyue Gu b, Baogui Sun a,* a
Department of Cardiology, Shanghai Jiaotong University Affiliated First People’s Hospital, 85 Wujin Road, Shanghai, 200080, PR China b Department of Cardiology, Harbin Medical University Affiliated First Hospital, Harbin, 150001, PR China Received 11 September 2005; received in revised form 31 December 2005; accepted 8 January 2006 Available online 18 May 2006
Abstract Background: Effects of pyrrolidine dithiocarbamate (PDTC) on programmed cell death are controversial. It is unclear if PDTC has the protective effects on myocardial apoptosis induced by adriamycin (ADR) in rats. The present study was undertaken to study the protective effects of pyrrolidine dithiocarbamate (PDTC) on myocardium apoptosis induced by adriamycin (ADR) in rats and its mechanisms. Methods: Forty male Wistar rats were randomly divided into five groups: control, ADR, ADR + PDTC 50 mg/kg, ADR + PDTC 100 mg/kg and ADR + PDTC 200 mg/kg group. Myocardial apoptosis was detected by electron microscopic examination and TUNEL assay. Myocardium p53 gene expression was examined by RT-PCR analysis. Location and distribution of p53 was observed by immunohistochemical assay. Myocardial expression of p53 protein was assessed by Western blot analysis. Activity of NF-nB was evaluated by Electrophoretic Mobility Shift Assay. Results: Myocardial apoptotic index, expression of p53 mRNA, expression of p53 protein and the binding activity of NF-nB decreased significantly in ADR + PDTC groups compared with ADR group. All these change were significantly correlated with dose of PDTC. Conclusion: PDTC has preventive effects on myocardial apoptosis induced by ADR, which is probably associated with inhibiting binding activity of NF-n B and further regulating apoptosis-related gene expression and translation, and inhibiting myocardial apoptosis. D 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Pyrrolidine dithiocarbamate; Adriamycin; Myocardium; Apoptosis; Nuclear factor-nB
1. Introduction The anthracycline antibiotic adriamycin (ADR) is one of the most effective and useful antineoplastic agents for the treatment of hematological as well as solid malignancies [1,2]. However, its practical therapeutic use is sometimes limited by the frequent induction of acute and chronic cardiotoxicity [3,4]. Antioxidants have been shown to have beneficial effects on the pathogenesis observed in ADRinduced acute and chronic cardiac damage [5,6]. However, underlying mechanisms of these antioxidants are largely unknown. * Corresponding author. Tel.: +86 21 6324 0090 3052; fax: +86 21 6324 0825. E-mail address: [email protected] (B. Sun). 0167-5273/$ - see front matter D 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.ijcard.2006.01.010
Pyrrolidine dithiocarbamate (PDTC) has been shown as a potent antioxidant and inhibitor of NF-nB in vivo and in vitro studies [7,8]. This complex is low-molecular weight thiol compounds that possess a (R1)(R2)N-C(S)-S-R3 functional group. Recent studies have shown that PDTC stimulates apoptosis via suppressing activation of NF-nB in various cancer cells (e.g. acute myelogenous leukemia, prostate cancer, and gastric cancer) [9– 11]. In contrast, PDTC has also been shown to reduce endothelial cell apoptosis induced by hypoxia [12]. However, little is known about effects of PDTC on ADR-induced myocardial apoptosis. Apoptosis-related genes govern commitment of apoptosis. p53 plays an important role in the cellular response to DNA damage by managing a cell cycle checkpoint that is critical for preserving the integrity of the genome. Recent studies showed that PDTC regulated expression of bcl-2 and
160
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
translocation of bax, probably through inhibiting NF-nB activation [12]. However, conflicting results have also been reported on the effect of PDTC on p53 gene [12,13]. The objective of this study is to investigate the antiapoptotic role of PDTC in ADR-induced myocardial apoptosis. To further elucidate the effect of PDTC on the expressions of apoptosis-related genes via suppressing activity of NF-nB, we have examined its effect on the regulation of p53 gene expression in rat hearts.
2. Materials and methods 2.1. Animal model Adult male Wistar rats weighing 150 – 170 g (total n = 40) were purchased from the Central Animal Laboratory, Harbin Medical University second affiliated hospital, P.R. China. Wistar rats were randomly divided into five groups: control (n = 8), ADR (n = 8), ADR plus PDTC 50 mg/kg (n = 8), ADR plus PDTC 100 mg/kg (n = 8) and ADR plus PDTC 200 mg/kg (n = 8) group. The rats had free access to standard rodent chow and water. The rats were given 10 mg/ kg of ADR (Wanle Co. Ltd. Shenzhen, P.R. China) by i.p. in ADR group. Instead of ADR, the same volume of physiological saline was injected into control rats. Rats in the ADR plus PDTC groups were injected with 50, 100 or 200 mg/kg PDTC (Sigma, USA) i.p. 1 h before administration of ADR, respectively. Rats were killed by exsanguination 12 h after the beginning of administration of ADR or saline. 2.2. Electron microscopic examination of apoptotic myocytes The samples taken from the free wall of left ventricles were cut into about 1 mm3. Tissues were fixed in 2.5% glutaraldehyde in 0.1 M sodium phosphate buffer, pH 7.3, for 3 h at 4 -C and routinely osmicated in 1% osmium tetroxide. After dehydration with graded ethanol series, the samples were embedded in Araldite. Ultrathin sections were stained with lead citrate and uranyl acetate and were viewed with under H-600A transmission electron microscope. 2.3. In situ terminal deoxynucleotidyl transferase assay The fragmented DNA on the 3-mm sections was labeled with the ApopTag apoptosis detection kit (Roche, USA). Briefly, after pretreatment with proteinase K, paraffin-fixed slides were incubated with the reaction mixture containing working solution of TdT and digoxigenin-conjugated dUTP for 1 h at 37 -C. Labeled DNA was detected by peroxidaseconjugated anti-digoxigenin conjugate antibody. The bound complex stained with a DAB based substrate. To quantitate the degree of apoptosis, apoptotic cells were counted by three independent observers blinded to the experimental
protocol. The apoptotic index was expressed as the percent of the total number of myocardial cells. 2.4. Reverse transcription-polymerase chain reaction analysis Total RNA was extracted from fresh-frozen myocardium using the Trizol Reagent (USA Invitrogen). cDNA was synthesized according to Reverse Transcription kit manufacturer’s instructions (Promega Corp., USA), and then cDNA was amplified with a Multiplex polymerase chain reaction (PCR) kit (TaKaRa Corp., Japan) with the following primers: h-actin: sense: 5V gcccctgaggagcaccctgt 3V; antisense: 5V acgctcggtcaggatcttca 3V(300 bp products); p53: sense: 5V attctgcccaccacagcgac 3V; antisense: 5V ccgtcaccatcagagcaacg 3V (464 bp products). Cycling parameters were as follows: 30 s for annealing at 56 -C, PCR amplification for 30 cycles. 8 Al of the PCR products was analyzed by electrophoresis on a 1.5% agarose gel. Further semiquantity of PCR product was determined by Kodak 2.0 software. 2.5. Immunohistochemical assay Paraffin sections of the heart were deparaffinized, endogenous peroxidase activity was inactivated with 3% H2O2 for 10 min. The primary antibody (rabbit anti-rat p53, Santa Cruz, USA) or normal blocking serum was added and incubated overnight. Biotinconjugated goat anti-rabbit immunoglobulin G (IgG) was used as the secondary antibody and incubated for 30 min. An avidin– biotin enzyme reagent was sequentially added and incubated for 20 min. A peroxidase substrate was added and incubated until desired stain intensity developed. Finally, cover sections with a glass coverslip and observe by light microscope. 2.6. Western blotting analysis Proteins were extracted from fresh-frozen left ventricle myocardium. Heart tissues were homogenized and then lysed in a lysis buffer (0.5% Nonidet P-40, 10 mM Tris – HCl (pH 7.5), 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride and 5 mM aprotinin) for 1 h at 4 -C. Protein extract (100 ng per lane) was run on a 10% SDS-PAGE gel, and then transferred to a nitrocellulose membrane (Shanghai Huashun Corp., China). The membrane was incubated with polyclonal rabbit anti-rat p53 antibody or h-actin antibody (Santa Cruz Biotechnology, USA, diluted at 1:1000), and visualized by the ProtoBlotRII AP system (Promega Corp., USA). 2.7. Electrophoretic mobility shift assay Nuclear extract was prepared according to Nuclear Extract Kit manufacturer’s instructions (Active Motif Corp.,
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
161
USA). TTo detect NF-kB binding activity, LightShiftR Chemiluminescent EMSA Kit (Pierce Corp., 20148) was used. A double-stranded oligonucleotide with the sequence 5V-AGT TGA GGG GAC TTT CCC AGG C-3V; 3V-TCA ACT CCC CTG AAA GGG TCC G-5V that was endlabeled with digoxin was obtained from Shanghai Shenggong Company. Gel Shift Assay was carried out as Gel Shift Assay Systems protocol (Pierce Corp., USA). 2.8. Statistical analysis The data were analyzed using the program SPSS 11.5 for Window. Quantitative data were presented as mean T SD. For comparison between multiple groups, data was analyzed by ANOVA, and with the Student-Newman-Keuls post hoc analysis. Values of p < 0.05 were considered significant. Spearman’s correlation analyses were conducted to assess statistical relationships between two variables.
3. Results 3.1. Ultrastructure changes An electron microscopic examination of heart tissues was performed. Normal morphological features were shown in the control group (Fig. 1A). The features of typical apoptosis of myocardium were found in the ADR group (Fig. 1B). Apoptotic cardiac myocytes showed cytoplasmic shrinkage, nuclear chromatin margination with many condensed pieces of coarse chromatin clumping, the accumulation of intracytoplasmic vacuoles, focal swelling and loss of mitochondrial cristae, and unruptured plasma membrane. In contrast to these findings, characteristic morphological changes were seldom observed in the ADR + PDTC groups (Fig. 1C). 3.2. TUNEL assay for apoptosis TUNEL methods were used to identify myocardial apoptosis in all experimental rat hearts. Apoptotic cells were seldom seen in the control group (Fig. 2A,F). The animal hearts treated with ADR alone manifested many
Fig. 2. Myocardial apoptosis of rats. (A and F) Control group, (B and G) ADR group, (C and H) ADR + PDTC 50 mg/kg group, (D and I) ADR + PDTC 100 mg/kg group, (E and J) ADR + PDTC 200 mg/kg group. (A – E) Representatives of tunnel analysis in the sections of cardiac tissue in five groups (magnified by 10 times). (F, G, H, I, J) Representatives of tunnel analysis in the sections of cardiac tissue in high magnification (40 times) of A, B, C, D, E, respectively.
Fig. 1. Electron micrographs showing morphological alterations of hearts from experimental rats. (A) Control; (B) ADR group; (C) ADR + PDTC group. ADR caused myocardial damage, characterized by cytoplasmic vacuolization (arrow), mitochondrial swelling (5 point star), and myofibril disarrangement (magnified by 8000 times).
162
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
apoptotic cells, which were mainly distributed under epicardium (Fig. 2B,G). While apoptotic cells were occasionally found in the ADR + PDTC groups (Fig. 2C – E, H – J). The number of apoptotic cells in TUNEL-stained sections was counted by use of light microscopy. The results were expressed as the percentage of apoptotic nuclei of the total number of cell nuclei. Treatment with ADR caused a significantly increase in apoptotic index in ADR group as compared to the control group. There was no difference in apoptotic index between control and ADR + PDTC 200 mg/ kg group. Compared with the ADR group, apoptotic index was significantly reduced in each of ADR + PDTC groups. PDTC suppressed ADR-induced myocardial apoptosis in a dose-related manner (Table 1). 3.3. Expression of p53 gene A semiquantitative study disclosed a significance of difference in expression of p53 mRNA between the control and the ADR groups. Furthermore, there was no difference in expression of the p53 gene between the control and the ADR + PDTC 200 mg/kg group (Fig. 3 and Table 2). Increases in mRNA level of p53 gene after ADR injection were prevented by pretreatment of PDTC in a dosedependent manner. These results indicate that PDTC inhibit ADR-induced p53 production at the mRNA level. 3.4. Location and distribution of p53 protein Immunohistochemistry showed that p53 protein with staining intensity were seldom detected in the cytoplasm in the control group (Fig. 4A,F). In contrast, p53 was found at high staining intensities in majority of myocardium especially under epicardium where myocardial apoptosis was evident after treatment with ADR (Fig. 4B,G). p53 protein with staining intensity was occasionally localized in the cytoplasm in ADR + PDTC groups (Fig. 4C –E, H – J). 3.5. Expression of p53 protein The Western blot assay for p53 protein was performed to determine the level of p53 protein in heart tissues. Western blot bands were quantified by densitometry. Compared with the control group, ADR injection significantly increased Table 1 Change of apoptotic index in heart tissues (mean T SD)
Fig. 3. The gene expressions of p53 and h-actin mRNA extracted from rat hearts: M: marker, Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, p53 mRNA decreased significantly in ADR + PDTC group in dose-dependent manner.
53-kDa p53 protein level (Fig. 5 and Table 3). Pretreatment with PDTC suppressed the expression of this protein, and suppression by PDTC of ADR-induced expression of p53 protein showed dose-related manner. The data suggest that PDTC inhibit ADR-induced p53 protein expression in rats. 3.6. Electrophoretic mobility shift assay of NF-jB activation Compared with the control group, NF-nB binding activity increased significantly in the ADR group, but not in the ADR + PDTC 200 mg/kg group (Fig. 6 and Table 4). Pretreatment with PDTC suppressed NF-nB binding activity induced by ADR, and suppression by PDTC of ADRinduced NF-nB binding activity showed dose-related manner. Thus ADR was able to lead to the activation of NF-nB, which is able to bind to NF-nB-dependent promoters. PDTC was able to inhibit the NF-nB binding activity. 3.7. Correlation analysis Spearman’s correlation analyses were conducted to assess statistical relationships between two variables. A highly significant positive correlation was revealed between NF-nB binding activity and expression of p53 mRNA, r = 0.870, F = 96.52, p < 0.001 (Fig. 7A). Expression of p53 mRNA and apoptotic index has a highly significant positive correlation, r = 0.841, F = 76.17, p < 0.001 (Fig. 7B). NF-nB Table 2 Ratio of p53 to h-actin mRNA expression in heart (mean T SD)
Group
Number
Apoptotic index
Group
Number
p53/h-actin
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
0.03 T 0.02 0.17 T 0.03a,b 0.12 T 0.04a 0.08 T 0.03a 0.03 T 0.03c 33.43
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
0.10 T 0.05 0.72 T 0.13a,b 0.50 T 0.13a 0.29 T 0.13a 0.11 T 0.07c 44.92
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
163
Table 3 Ratio of p53 to h-actin protein expression in heart tissues (mean T SD) Group
Number
p53/h-actin
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
1.01 T 0.31 7.25 T 0.84a,b 4.95 T 0.85a 1.86 T 0.50a 1.07 T 0.32c 165.21
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
binding activity and apoptotic index has a highly significant positive correlation, r = 0.862, F = 87.36, p < 0.001.
4. Discussion
Fig. 4. p53 immunohistochemistry of heart tissue in groups. (A and F) Control group, (B and G) ADR group, (C and H) ADR + PDTC 50 mg/kg group, (D and I) ADR + PDTC 100 mg/kg group, (E and J) ADR + PDTC 200 mg/kg group. (A – E) Representatives of p53 immunohistochemistry in the sections of cardiac tissue in five groups (magnified by 10 times). (F, G, H, I, J) Representatives of p53 immunohistochemistry in the sections of cardiac tissue in high magnification (40 times) of A, B, C, D, E, respectively.
1
2
3
4
In the present study, we determined a significant induction of myocardial apoptosis in the early phase following ADR administration, which correlated to abnormal expression and translation of p53. PDTC as a nonspecific inhibitor of NF-nB protected myocardium from apoptosis by inhibiting NF-nB activation, and further regulating expression and translation of apoptosis-related gene p53. The anthracycline antibiotic adriamycin (ADR) is one of the most effective and useful antineoplastic agents for the treatment of hematological as well as solid malignancies [1,2]. However, its practical therapeutic use is sometimes limited by the frequent induction of acute and chronic cardiotoxicity [3,4]. The molecular basis of ADR cardiotoxicity is still poorly understood. Previous studies on ADR cardiotoxicity have reported that the formation of free reactive oxygen radicals [14,15], release of cardiotoxic cytokines [16,17], cytoskeletal changes [18] and intracellular calcium overload [19,20] might be involved in ADR 1
2
3
4
5
NF-kB
5
A
B free probe
Fig. 5. The protein products of p53(A) and h-actin(B) extracted from rat hearts. Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, p53 protein decreased significantly in ADR + PDTC groups in dose-related manner.
Fig. 6. NF-nB binding activity in rat hearts. Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, NF-nB activity decreased significantly in ADR + PDTC groups in dose-dependent manner.
164
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
Table 4 Nuclear N F-nB binding activity in hearts (mean T SD) Group
Number
N F-nB binding activity
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
782.63 T 188.20 3627.25 T 346.49a,b 2230.50 T 288.96a 1172.25 T 260.58a 788.88 T 227.46c 165.75
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
cardiotoxicity. Recently, evidence is accumulating that apoptotic mechanism is involved in acute and chronic myocytes loss in various heart disorders [21,22]. In this study, during electron microscopic examination, typical nuclear and cellular morphological features of apoptosis were found in association with TUNEL positively after ADR injection. Compared with control group, apoptotic index increased significantly in ADR group. These results showed that apoptosis was involved in ADR acute cardiotoxicity. These results in present study are accordance with other researches [21]. Pyrrolidine dithiocarbamate (PDTC) is low-molecular weight thiol compounds. Previous studies show that PDTC stimulates programmed cell death via suppressing activation of NF-nB in various cancer cells (e.g. acute myelogenous leukemia, prostate cancer, and gastric cancer) [9 –11]. The present study indicates that PDTC play anti-apoptotic role in adriamycin-induced myocardial apoptosis in rats. We found that pretreatment of rats with PDTC inhibited ADR-induced myocardial apoptosis confirmed by electron microscopic examination and TUNEL assay. PDTC suppressed ADRinduced myocardial apoptosis in a dose-related manner. The activation of PDTC either promotes or inhibits programmed cell death, probably depending on the cell type and the nature of stimuli. The dual role of PDTC in regulating apoptosis may be used to enhance the therapeutic efficacy of ADR. PDTC have been shown to systemically suppress LPS-induced NF-nB activation and prevented expression of proinflammatory cytokines mRNA and their products as well as neutrophil sequestration in heart, lungs and liver [23]. We also demonstrated that PDTC suppressed ADRinduced NF-nB/DNA-binding activity in dose-related manner. Meanwhile, the correlation analyses suggested a linkage between NF-nB activation and apoptotic index. It is conceivable that the anti-apoptotic and anti-inflammatory effects of PDTC stem from their ability to inhibit NF-nB activation. Several studies have reported that thiol-modifying, metal-chelating, and oxygen radical-scavenging antioxidative character of PDTC regulate the activity of NF-nB [24]. Other research indicated that inhibiting elevation in [Ca2+]i and decreasing formation of H2O2 by PDTC, in the cerebral vascular cells, prevents ethanol-induced NF-kB activation [25]. The present results suggest that PDTC may be therapeutically used to mitigate ADR-induced apoptosis
and cardiotoxicity via inhibiting activation of NF-nB. There is abundant evidence that wild-type p53 plays an important role in the cellular response to DNA damage by managing a cell cycle checkpoint that is critical for maintaining the integrity of the genome. p53 levels increase in cells exposed to DNA damaging agents such as UV light, anticancer drugs and g-irradiation. Here, we have reported that ADR is a potent inducer of p53 and NF-kB transcription factors in myocardium. The increased levels of the p53 mRNA and p53 protein manifested the activation of p53 in response to ADR. Pretreatment of rats with PDTC inhibited p53 mRNA and protein expression induced by ADR in dose-dependent manner. Meanwhile, the correlation analyses suggested a linkage between NF-nB activation and the expression of p53 gene. Inhibition of NF-nB by PDTC was shown to inhibit the activity of p53 that are critical to mediating apoptotic signaling. These results showed that anti-apoptotic character of PDTC might be due to its downregulation of p53 gene via suppressing NF-nB binding activity. However, other research pointed out that the anti-apoptotic character of PDTC might be due to its downregulation of apoptotic genes, including bax and c-Myc via inhibiting activation of NF-nB [26,27]. Another proposed mechanism is that PDTC up-regulates the activities of some anti-apoptotic factors, e.g. Bcl-2 [12]. The effect of PDTC on different apoptoticrelated genes probably depended on the cell type. The present results suggested that PDTC protected myocardium from apoptosis by inhibiting NF-nB activation, and further
Fig. 7. Correlation between the level of p53mRNA with NF-nB binding activity or apoptotic index: (A) illustrates the correlation between NF-nB binding activity and expression of p53mRNA. (B) illustrates the correlation between expression of p53 mRNA with apoptotic index.
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
regulating expression and translation of apoptosis-related gene p53. In a word, we demonstrated that PDTC protects against ADR-induced myocardial apoptosis. The exact mechanism of its cardioprotective effect needs to be explored further; however, TPDTC may be an effective approach to the control of cardiovascular apoptosis.
Acknowledgements We are grateful to Prof. Ailian Liu for critical reading of the manuscript.
References [1] Morabito A, Gattuso D, Stani SC, et al. Safety and activity of the combination of pegylated liposomal doxorubicin and weekly docetaxel in advanced breast cancer. Breast Cancer Res Treat 2004; 86:249 – 57. [2] Novitzky N, Thomas V, Abrahams L, Toit C, Donald M. Increasing dose intensity of anthracycline antibiotics improves outcome in patients with acute myelogenous leukemia. Am J Hematol 2004; 76:319 – 29. [3] Hequet O, Le QH, Moullet I, et al. Subclinical late cardiomyopathy after doxorubicin therapy for lymphoma in adults. J Clin Oncol 2004; 22:1864 – 71. [4] Lipshultz SE, Rifai N, Dalton VM, et al. The effect of dexrazoxane on myocardial injury in doxorubicin-treated children with acute lymphoblastic leukemia. N Engl J Med 2004;351:145 – 53. [5] Liu Xuwan, Chen Zhongyi, Chua Chu Chang, et al. Melatonin as an effective protector against doxorubicin-induced cardiotoxicity. Am J Physiol Heart Circ Physiol 2002;283:H254 – 63. [6] Nazeyrollas P, Prevost A, Baccard N, Manot L, Devillier P, Millart H. Effects of amifostine on perfused isolated rat heart and on acute doxorubicin-induced cardiotoxicity. Cancer Chemother Pharmacol 1999;43:227 – 32. [7] Muller DN, Dechend R, Mervaala E, et al. NF-kB inhibition ameliorates angiotensin II-induced inflammatory damage in rats. Hypertension 2000;35:193 – 201. [8] Beswick RA, Zhang H, Marable D, Catravas JD, Hill WD, Webb RC. Long-term antioxidant administration attenuates mineralocorticoid hypertension and renal inflammatory response. Hypertension 2001; 37:781 – 6. [9] Malaguarnera L, Pilastro MR, Vicari L, et al. Pyrrolidinedithiocarbamate induces apoptosis in human acute myelogenous leukemic cells affecting NF-nB activity. Cancer Invest 2005;23:404 – 12. [10] Chen D, Peng F, Cui QC, et al. Inhibition of prostate cancer cellular proteasome activity by a pyrrolidine dithiocarbamate-copper complex is associated with suppression of proliferation and induction of apoptosis. Front Biosci 2005;10:2932 – 9.
165
[11] Li Q, Yu YY, Zhu ZG, et al. Effect of NF-nB constitutive activation on proliferation and apoptosis of gastric cancer cell lines. Eur Surg Res 2005;37:105 – 10. [12] Aoki M, Nata T, Morishita R, et al. Endothelial apoptosis induced by oxidative stress through activation of NF-nB: antiapoptotic effect of antioxidant agents on endothelial cells. Hypertension 2001;38:48 – 55. [13] El Eter E, Hagar HH, Al-Tuwaijiri A, Arafa M. Nuclear factor-nB inhibition by pyrrolidinedithiocarbamate attenuates gastric ischemiareperfusion injury in rats. Can J Physiol Pharmacol 2005;83:483 – 92. [14] Zhou S, Palmeira CM, Wallace KB. Doxorubicin-induced persistent oxidative stress to cardiac myocytes. Toxicol Lett 2001;121:151 – 7. [15] Koutinos G, Stathopoulos GP, Dontas I, et al. The effect of doxorubicin and its analogue mitoxantrone on cardiac muscle and on serum lipids: an experimental study. Anticancer Res 2002;22:815 – 20. [16] Mukherjee S, Banerjee SK, Maulik M, Dinda AK, Talwar KK, Maulik SK. Protection against acute adriamycin-induced cardiotoxicity by garlic: role of endogenous antioxidants and inhibition of TNF-alpha expression. BMC Pharmacol 2003;3:16. [17] Mohamed HE, Asker ME, Ali SI, Fattah TM. Protection against doxorubicin cardiomyopathy in rats: role of phosphodiesterase inhibitors type 4. Pharm Pharmacol 2004;56:757 – 68. [18] Dudnakova TV, Lakomkin VL, Tsyplenkova VG, Shekhonin BV, Shirinsky VP, Kapelko VI. Alterations in myocardial cytoskeletal and regulatory protein expression following a single doxorubicin injection. J Cardiovasc Pharmacol 2003;41:788 – 94. [19] RVitelli M, Filippelli A, Rinaldi B, et al. Effects of docosahexaenoic acid on [Ca(2+)](i) increase induced by doxorubicin in ventricular rat cardiomyocytes. Life Sci 2002;71:1905 – 16. [20] Zhou S, Heller LJ, Wallace KB. Interference with calcium-dependent mitochondrial bioenergetics in cardiac myocytes isolated from doxorubicin-treated rats. Toxicol Appl Pharmacol 2001;175:60 – 7. [21] Wu S, Ko YS, Teng MS, et al. Adriamycin-induced cardiomyocyte and endothelial cell apoptosis: in vitro and in vivo studies. J Mol Cell Cardiol 2002;34:1595 – 607. [22] Zhao W, Lu L, Chen SS, Sun Y. Temporal and spatial characteristics of apoptosis in the infarcted rat heart. Biochem Biophys Res Commun 2004;325:605 – 11. [23] Liu SF, Ye X, Malik AB. Inhibition of NF-kB activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes. Circulation 1999;100:1330 – 7. [24] Rangan GK, Wang Y, Tay YC, Harris DC. Early administration of PDTC in adriamycin nephropathy: effect on proteinuria, cortical tubulointerstitial injury, and NF-nB activation. Ren Fail 2001; 23:773 – 80. [25] Li Wenyan, Zheng Tao, Wang Jun, Altura Bella T., Altura Burton M.. Pyrrolidine dithiocarbamate prevents ethanol-induced elevation of [Ca2+]i in cultured canine cerebral vascular smooth muscle cells. Neurosci Lett 1999;266:205 – 8. [26] Han S, Sidell N. RU486-induced growth inhibition of human endometrial cells involves the nuclear factor-nB signaling pathway. J Clin Endocrinol Metab 2003;88:713 – 9. [27] Gupta Sudhiranjan, Purcell Nicole H., Lin Anning, Sen Subha. Activation of nuclear factor-kB is necessary for myotrophin-induced cardiac hypertrophy. JCB 2002;159:1019 – 28.
Protective effects of pyrrolidine dithiocarbamate on myocardium apoptosis induced by adriamycin in rats Hongli Li a, Hongyue Gu b, Baogui Sun a,* a
Department of Cardiology, Shanghai Jiaotong University Affiliated First People’s Hospital, 85 Wujin Road, Shanghai, 200080, PR China b Department of Cardiology, Harbin Medical University Affiliated First Hospital, Harbin, 150001, PR China Received 11 September 2005; received in revised form 31 December 2005; accepted 8 January 2006 Available online 18 May 2006
Abstract Background: Effects of pyrrolidine dithiocarbamate (PDTC) on programmed cell death are controversial. It is unclear if PDTC has the protective effects on myocardial apoptosis induced by adriamycin (ADR) in rats. The present study was undertaken to study the protective effects of pyrrolidine dithiocarbamate (PDTC) on myocardium apoptosis induced by adriamycin (ADR) in rats and its mechanisms. Methods: Forty male Wistar rats were randomly divided into five groups: control, ADR, ADR + PDTC 50 mg/kg, ADR + PDTC 100 mg/kg and ADR + PDTC 200 mg/kg group. Myocardial apoptosis was detected by electron microscopic examination and TUNEL assay. Myocardium p53 gene expression was examined by RT-PCR analysis. Location and distribution of p53 was observed by immunohistochemical assay. Myocardial expression of p53 protein was assessed by Western blot analysis. Activity of NF-nB was evaluated by Electrophoretic Mobility Shift Assay. Results: Myocardial apoptotic index, expression of p53 mRNA, expression of p53 protein and the binding activity of NF-nB decreased significantly in ADR + PDTC groups compared with ADR group. All these change were significantly correlated with dose of PDTC. Conclusion: PDTC has preventive effects on myocardial apoptosis induced by ADR, which is probably associated with inhibiting binding activity of NF-n B and further regulating apoptosis-related gene expression and translation, and inhibiting myocardial apoptosis. D 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Pyrrolidine dithiocarbamate; Adriamycin; Myocardium; Apoptosis; Nuclear factor-nB
1. Introduction The anthracycline antibiotic adriamycin (ADR) is one of the most effective and useful antineoplastic agents for the treatment of hematological as well as solid malignancies [1,2]. However, its practical therapeutic use is sometimes limited by the frequent induction of acute and chronic cardiotoxicity [3,4]. Antioxidants have been shown to have beneficial effects on the pathogenesis observed in ADRinduced acute and chronic cardiac damage [5,6]. However, underlying mechanisms of these antioxidants are largely unknown. * Corresponding author. Tel.: +86 21 6324 0090 3052; fax: +86 21 6324 0825. E-mail address: [email protected] (B. Sun). 0167-5273/$ - see front matter D 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.ijcard.2006.01.010
Pyrrolidine dithiocarbamate (PDTC) has been shown as a potent antioxidant and inhibitor of NF-nB in vivo and in vitro studies [7,8]. This complex is low-molecular weight thiol compounds that possess a (R1)(R2)N-C(S)-S-R3 functional group. Recent studies have shown that PDTC stimulates apoptosis via suppressing activation of NF-nB in various cancer cells (e.g. acute myelogenous leukemia, prostate cancer, and gastric cancer) [9– 11]. In contrast, PDTC has also been shown to reduce endothelial cell apoptosis induced by hypoxia [12]. However, little is known about effects of PDTC on ADR-induced myocardial apoptosis. Apoptosis-related genes govern commitment of apoptosis. p53 plays an important role in the cellular response to DNA damage by managing a cell cycle checkpoint that is critical for preserving the integrity of the genome. Recent studies showed that PDTC regulated expression of bcl-2 and
160
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
translocation of bax, probably through inhibiting NF-nB activation [12]. However, conflicting results have also been reported on the effect of PDTC on p53 gene [12,13]. The objective of this study is to investigate the antiapoptotic role of PDTC in ADR-induced myocardial apoptosis. To further elucidate the effect of PDTC on the expressions of apoptosis-related genes via suppressing activity of NF-nB, we have examined its effect on the regulation of p53 gene expression in rat hearts.
2. Materials and methods 2.1. Animal model Adult male Wistar rats weighing 150 – 170 g (total n = 40) were purchased from the Central Animal Laboratory, Harbin Medical University second affiliated hospital, P.R. China. Wistar rats were randomly divided into five groups: control (n = 8), ADR (n = 8), ADR plus PDTC 50 mg/kg (n = 8), ADR plus PDTC 100 mg/kg (n = 8) and ADR plus PDTC 200 mg/kg (n = 8) group. The rats had free access to standard rodent chow and water. The rats were given 10 mg/ kg of ADR (Wanle Co. Ltd. Shenzhen, P.R. China) by i.p. in ADR group. Instead of ADR, the same volume of physiological saline was injected into control rats. Rats in the ADR plus PDTC groups were injected with 50, 100 or 200 mg/kg PDTC (Sigma, USA) i.p. 1 h before administration of ADR, respectively. Rats were killed by exsanguination 12 h after the beginning of administration of ADR or saline. 2.2. Electron microscopic examination of apoptotic myocytes The samples taken from the free wall of left ventricles were cut into about 1 mm3. Tissues were fixed in 2.5% glutaraldehyde in 0.1 M sodium phosphate buffer, pH 7.3, for 3 h at 4 -C and routinely osmicated in 1% osmium tetroxide. After dehydration with graded ethanol series, the samples were embedded in Araldite. Ultrathin sections were stained with lead citrate and uranyl acetate and were viewed with under H-600A transmission electron microscope. 2.3. In situ terminal deoxynucleotidyl transferase assay The fragmented DNA on the 3-mm sections was labeled with the ApopTag apoptosis detection kit (Roche, USA). Briefly, after pretreatment with proteinase K, paraffin-fixed slides were incubated with the reaction mixture containing working solution of TdT and digoxigenin-conjugated dUTP for 1 h at 37 -C. Labeled DNA was detected by peroxidaseconjugated anti-digoxigenin conjugate antibody. The bound complex stained with a DAB based substrate. To quantitate the degree of apoptosis, apoptotic cells were counted by three independent observers blinded to the experimental
protocol. The apoptotic index was expressed as the percent of the total number of myocardial cells. 2.4. Reverse transcription-polymerase chain reaction analysis Total RNA was extracted from fresh-frozen myocardium using the Trizol Reagent (USA Invitrogen). cDNA was synthesized according to Reverse Transcription kit manufacturer’s instructions (Promega Corp., USA), and then cDNA was amplified with a Multiplex polymerase chain reaction (PCR) kit (TaKaRa Corp., Japan) with the following primers: h-actin: sense: 5V gcccctgaggagcaccctgt 3V; antisense: 5V acgctcggtcaggatcttca 3V(300 bp products); p53: sense: 5V attctgcccaccacagcgac 3V; antisense: 5V ccgtcaccatcagagcaacg 3V (464 bp products). Cycling parameters were as follows: 30 s for annealing at 56 -C, PCR amplification for 30 cycles. 8 Al of the PCR products was analyzed by electrophoresis on a 1.5% agarose gel. Further semiquantity of PCR product was determined by Kodak 2.0 software. 2.5. Immunohistochemical assay Paraffin sections of the heart were deparaffinized, endogenous peroxidase activity was inactivated with 3% H2O2 for 10 min. The primary antibody (rabbit anti-rat p53, Santa Cruz, USA) or normal blocking serum was added and incubated overnight. Biotinconjugated goat anti-rabbit immunoglobulin G (IgG) was used as the secondary antibody and incubated for 30 min. An avidin– biotin enzyme reagent was sequentially added and incubated for 20 min. A peroxidase substrate was added and incubated until desired stain intensity developed. Finally, cover sections with a glass coverslip and observe by light microscope. 2.6. Western blotting analysis Proteins were extracted from fresh-frozen left ventricle myocardium. Heart tissues were homogenized and then lysed in a lysis buffer (0.5% Nonidet P-40, 10 mM Tris – HCl (pH 7.5), 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride and 5 mM aprotinin) for 1 h at 4 -C. Protein extract (100 ng per lane) was run on a 10% SDS-PAGE gel, and then transferred to a nitrocellulose membrane (Shanghai Huashun Corp., China). The membrane was incubated with polyclonal rabbit anti-rat p53 antibody or h-actin antibody (Santa Cruz Biotechnology, USA, diluted at 1:1000), and visualized by the ProtoBlotRII AP system (Promega Corp., USA). 2.7. Electrophoretic mobility shift assay Nuclear extract was prepared according to Nuclear Extract Kit manufacturer’s instructions (Active Motif Corp.,
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
161
USA). TTo detect NF-kB binding activity, LightShiftR Chemiluminescent EMSA Kit (Pierce Corp., 20148) was used. A double-stranded oligonucleotide with the sequence 5V-AGT TGA GGG GAC TTT CCC AGG C-3V; 3V-TCA ACT CCC CTG AAA GGG TCC G-5V that was endlabeled with digoxin was obtained from Shanghai Shenggong Company. Gel Shift Assay was carried out as Gel Shift Assay Systems protocol (Pierce Corp., USA). 2.8. Statistical analysis The data were analyzed using the program SPSS 11.5 for Window. Quantitative data were presented as mean T SD. For comparison between multiple groups, data was analyzed by ANOVA, and with the Student-Newman-Keuls post hoc analysis. Values of p < 0.05 were considered significant. Spearman’s correlation analyses were conducted to assess statistical relationships between two variables.
3. Results 3.1. Ultrastructure changes An electron microscopic examination of heart tissues was performed. Normal morphological features were shown in the control group (Fig. 1A). The features of typical apoptosis of myocardium were found in the ADR group (Fig. 1B). Apoptotic cardiac myocytes showed cytoplasmic shrinkage, nuclear chromatin margination with many condensed pieces of coarse chromatin clumping, the accumulation of intracytoplasmic vacuoles, focal swelling and loss of mitochondrial cristae, and unruptured plasma membrane. In contrast to these findings, characteristic morphological changes were seldom observed in the ADR + PDTC groups (Fig. 1C). 3.2. TUNEL assay for apoptosis TUNEL methods were used to identify myocardial apoptosis in all experimental rat hearts. Apoptotic cells were seldom seen in the control group (Fig. 2A,F). The animal hearts treated with ADR alone manifested many
Fig. 2. Myocardial apoptosis of rats. (A and F) Control group, (B and G) ADR group, (C and H) ADR + PDTC 50 mg/kg group, (D and I) ADR + PDTC 100 mg/kg group, (E and J) ADR + PDTC 200 mg/kg group. (A – E) Representatives of tunnel analysis in the sections of cardiac tissue in five groups (magnified by 10 times). (F, G, H, I, J) Representatives of tunnel analysis in the sections of cardiac tissue in high magnification (40 times) of A, B, C, D, E, respectively.
Fig. 1. Electron micrographs showing morphological alterations of hearts from experimental rats. (A) Control; (B) ADR group; (C) ADR + PDTC group. ADR caused myocardial damage, characterized by cytoplasmic vacuolization (arrow), mitochondrial swelling (5 point star), and myofibril disarrangement (magnified by 8000 times).
162
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
apoptotic cells, which were mainly distributed under epicardium (Fig. 2B,G). While apoptotic cells were occasionally found in the ADR + PDTC groups (Fig. 2C – E, H – J). The number of apoptotic cells in TUNEL-stained sections was counted by use of light microscopy. The results were expressed as the percentage of apoptotic nuclei of the total number of cell nuclei. Treatment with ADR caused a significantly increase in apoptotic index in ADR group as compared to the control group. There was no difference in apoptotic index between control and ADR + PDTC 200 mg/ kg group. Compared with the ADR group, apoptotic index was significantly reduced in each of ADR + PDTC groups. PDTC suppressed ADR-induced myocardial apoptosis in a dose-related manner (Table 1). 3.3. Expression of p53 gene A semiquantitative study disclosed a significance of difference in expression of p53 mRNA between the control and the ADR groups. Furthermore, there was no difference in expression of the p53 gene between the control and the ADR + PDTC 200 mg/kg group (Fig. 3 and Table 2). Increases in mRNA level of p53 gene after ADR injection were prevented by pretreatment of PDTC in a dosedependent manner. These results indicate that PDTC inhibit ADR-induced p53 production at the mRNA level. 3.4. Location and distribution of p53 protein Immunohistochemistry showed that p53 protein with staining intensity were seldom detected in the cytoplasm in the control group (Fig. 4A,F). In contrast, p53 was found at high staining intensities in majority of myocardium especially under epicardium where myocardial apoptosis was evident after treatment with ADR (Fig. 4B,G). p53 protein with staining intensity was occasionally localized in the cytoplasm in ADR + PDTC groups (Fig. 4C –E, H – J). 3.5. Expression of p53 protein The Western blot assay for p53 protein was performed to determine the level of p53 protein in heart tissues. Western blot bands were quantified by densitometry. Compared with the control group, ADR injection significantly increased Table 1 Change of apoptotic index in heart tissues (mean T SD)
Fig. 3. The gene expressions of p53 and h-actin mRNA extracted from rat hearts: M: marker, Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, p53 mRNA decreased significantly in ADR + PDTC group in dose-dependent manner.
53-kDa p53 protein level (Fig. 5 and Table 3). Pretreatment with PDTC suppressed the expression of this protein, and suppression by PDTC of ADR-induced expression of p53 protein showed dose-related manner. The data suggest that PDTC inhibit ADR-induced p53 protein expression in rats. 3.6. Electrophoretic mobility shift assay of NF-jB activation Compared with the control group, NF-nB binding activity increased significantly in the ADR group, but not in the ADR + PDTC 200 mg/kg group (Fig. 6 and Table 4). Pretreatment with PDTC suppressed NF-nB binding activity induced by ADR, and suppression by PDTC of ADRinduced NF-nB binding activity showed dose-related manner. Thus ADR was able to lead to the activation of NF-nB, which is able to bind to NF-nB-dependent promoters. PDTC was able to inhibit the NF-nB binding activity. 3.7. Correlation analysis Spearman’s correlation analyses were conducted to assess statistical relationships between two variables. A highly significant positive correlation was revealed between NF-nB binding activity and expression of p53 mRNA, r = 0.870, F = 96.52, p < 0.001 (Fig. 7A). Expression of p53 mRNA and apoptotic index has a highly significant positive correlation, r = 0.841, F = 76.17, p < 0.001 (Fig. 7B). NF-nB Table 2 Ratio of p53 to h-actin mRNA expression in heart (mean T SD)
Group
Number
Apoptotic index
Group
Number
p53/h-actin
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
0.03 T 0.02 0.17 T 0.03a,b 0.12 T 0.04a 0.08 T 0.03a 0.03 T 0.03c 33.43
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
0.10 T 0.05 0.72 T 0.13a,b 0.50 T 0.13a 0.29 T 0.13a 0.11 T 0.07c 44.92
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
163
Table 3 Ratio of p53 to h-actin protein expression in heart tissues (mean T SD) Group
Number
p53/h-actin
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
1.01 T 0.31 7.25 T 0.84a,b 4.95 T 0.85a 1.86 T 0.50a 1.07 T 0.32c 165.21
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
binding activity and apoptotic index has a highly significant positive correlation, r = 0.862, F = 87.36, p < 0.001.
4. Discussion
Fig. 4. p53 immunohistochemistry of heart tissue in groups. (A and F) Control group, (B and G) ADR group, (C and H) ADR + PDTC 50 mg/kg group, (D and I) ADR + PDTC 100 mg/kg group, (E and J) ADR + PDTC 200 mg/kg group. (A – E) Representatives of p53 immunohistochemistry in the sections of cardiac tissue in five groups (magnified by 10 times). (F, G, H, I, J) Representatives of p53 immunohistochemistry in the sections of cardiac tissue in high magnification (40 times) of A, B, C, D, E, respectively.
1
2
3
4
In the present study, we determined a significant induction of myocardial apoptosis in the early phase following ADR administration, which correlated to abnormal expression and translation of p53. PDTC as a nonspecific inhibitor of NF-nB protected myocardium from apoptosis by inhibiting NF-nB activation, and further regulating expression and translation of apoptosis-related gene p53. The anthracycline antibiotic adriamycin (ADR) is one of the most effective and useful antineoplastic agents for the treatment of hematological as well as solid malignancies [1,2]. However, its practical therapeutic use is sometimes limited by the frequent induction of acute and chronic cardiotoxicity [3,4]. The molecular basis of ADR cardiotoxicity is still poorly understood. Previous studies on ADR cardiotoxicity have reported that the formation of free reactive oxygen radicals [14,15], release of cardiotoxic cytokines [16,17], cytoskeletal changes [18] and intracellular calcium overload [19,20] might be involved in ADR 1
2
3
4
5
NF-kB
5
A
B free probe
Fig. 5. The protein products of p53(A) and h-actin(B) extracted from rat hearts. Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, p53 protein decreased significantly in ADR + PDTC groups in dose-related manner.
Fig. 6. NF-nB binding activity in rat hearts. Lane 1: control group, Lane 2: ADR group, Lane 3: ADR + PDTC 50 mg/kg group, Lane 4: ADR + PDTC 100 mg/kg group, Lane 5: ADR + PDTC 200 mg/kg group. Compared with ADR group, NF-nB activity decreased significantly in ADR + PDTC groups in dose-dependent manner.
164
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
Table 4 Nuclear N F-nB binding activity in hearts (mean T SD) Group
Number
N F-nB binding activity
Control group ADR group ADR + PDTC 50 mg/kg group ADR + PDTC 100 mg/kg group ADR + PDTC 200 mg/kg group F
8 8 8 8 8
782.63 T 188.20 3627.25 T 346.49a,b 2230.50 T 288.96a 1172.25 T 260.58a 788.88 T 227.46c 165.75
a b c
Compared with control group p < 0.05. Compared with each of ADR + PDTC groups p < 0.05. Compared with control group p > 0.05.
cardiotoxicity. Recently, evidence is accumulating that apoptotic mechanism is involved in acute and chronic myocytes loss in various heart disorders [21,22]. In this study, during electron microscopic examination, typical nuclear and cellular morphological features of apoptosis were found in association with TUNEL positively after ADR injection. Compared with control group, apoptotic index increased significantly in ADR group. These results showed that apoptosis was involved in ADR acute cardiotoxicity. These results in present study are accordance with other researches [21]. Pyrrolidine dithiocarbamate (PDTC) is low-molecular weight thiol compounds. Previous studies show that PDTC stimulates programmed cell death via suppressing activation of NF-nB in various cancer cells (e.g. acute myelogenous leukemia, prostate cancer, and gastric cancer) [9 –11]. The present study indicates that PDTC play anti-apoptotic role in adriamycin-induced myocardial apoptosis in rats. We found that pretreatment of rats with PDTC inhibited ADR-induced myocardial apoptosis confirmed by electron microscopic examination and TUNEL assay. PDTC suppressed ADRinduced myocardial apoptosis in a dose-related manner. The activation of PDTC either promotes or inhibits programmed cell death, probably depending on the cell type and the nature of stimuli. The dual role of PDTC in regulating apoptosis may be used to enhance the therapeutic efficacy of ADR. PDTC have been shown to systemically suppress LPS-induced NF-nB activation and prevented expression of proinflammatory cytokines mRNA and their products as well as neutrophil sequestration in heart, lungs and liver [23]. We also demonstrated that PDTC suppressed ADRinduced NF-nB/DNA-binding activity in dose-related manner. Meanwhile, the correlation analyses suggested a linkage between NF-nB activation and apoptotic index. It is conceivable that the anti-apoptotic and anti-inflammatory effects of PDTC stem from their ability to inhibit NF-nB activation. Several studies have reported that thiol-modifying, metal-chelating, and oxygen radical-scavenging antioxidative character of PDTC regulate the activity of NF-nB [24]. Other research indicated that inhibiting elevation in [Ca2+]i and decreasing formation of H2O2 by PDTC, in the cerebral vascular cells, prevents ethanol-induced NF-kB activation [25]. The present results suggest that PDTC may be therapeutically used to mitigate ADR-induced apoptosis
and cardiotoxicity via inhibiting activation of NF-nB. There is abundant evidence that wild-type p53 plays an important role in the cellular response to DNA damage by managing a cell cycle checkpoint that is critical for maintaining the integrity of the genome. p53 levels increase in cells exposed to DNA damaging agents such as UV light, anticancer drugs and g-irradiation. Here, we have reported that ADR is a potent inducer of p53 and NF-kB transcription factors in myocardium. The increased levels of the p53 mRNA and p53 protein manifested the activation of p53 in response to ADR. Pretreatment of rats with PDTC inhibited p53 mRNA and protein expression induced by ADR in dose-dependent manner. Meanwhile, the correlation analyses suggested a linkage between NF-nB activation and the expression of p53 gene. Inhibition of NF-nB by PDTC was shown to inhibit the activity of p53 that are critical to mediating apoptotic signaling. These results showed that anti-apoptotic character of PDTC might be due to its downregulation of p53 gene via suppressing NF-nB binding activity. However, other research pointed out that the anti-apoptotic character of PDTC might be due to its downregulation of apoptotic genes, including bax and c-Myc via inhibiting activation of NF-nB [26,27]. Another proposed mechanism is that PDTC up-regulates the activities of some anti-apoptotic factors, e.g. Bcl-2 [12]. The effect of PDTC on different apoptoticrelated genes probably depended on the cell type. The present results suggested that PDTC protected myocardium from apoptosis by inhibiting NF-nB activation, and further
Fig. 7. Correlation between the level of p53mRNA with NF-nB binding activity or apoptotic index: (A) illustrates the correlation between NF-nB binding activity and expression of p53mRNA. (B) illustrates the correlation between expression of p53 mRNA with apoptotic index.
H. Li et al. / International Journal of Cardiology 114 (2007) 159 – 165
regulating expression and translation of apoptosis-related gene p53. In a word, we demonstrated that PDTC protects against ADR-induced myocardial apoptosis. The exact mechanism of its cardioprotective effect needs to be explored further; however, TPDTC may be an effective approach to the control of cardiovascular apoptosis.
Acknowledgements We are grateful to Prof. Ailian Liu for critical reading of the manuscript.
References [1] Morabito A, Gattuso D, Stani SC, et al. Safety and activity of the combination of pegylated liposomal doxorubicin and weekly docetaxel in advanced breast cancer. Breast Cancer Res Treat 2004; 86:249 – 57. [2] Novitzky N, Thomas V, Abrahams L, Toit C, Donald M. Increasing dose intensity of anthracycline antibiotics improves outcome in patients with acute myelogenous leukemia. Am J Hematol 2004; 76:319 – 29. [3] Hequet O, Le QH, Moullet I, et al. Subclinical late cardiomyopathy after doxorubicin therapy for lymphoma in adults. J Clin Oncol 2004; 22:1864 – 71. [4] Lipshultz SE, Rifai N, Dalton VM, et al. The effect of dexrazoxane on myocardial injury in doxorubicin-treated children with acute lymphoblastic leukemia. N Engl J Med 2004;351:145 – 53. [5] Liu Xuwan, Chen Zhongyi, Chua Chu Chang, et al. Melatonin as an effective protector against doxorubicin-induced cardiotoxicity. Am J Physiol Heart Circ Physiol 2002;283:H254 – 63. [6] Nazeyrollas P, Prevost A, Baccard N, Manot L, Devillier P, Millart H. Effects of amifostine on perfused isolated rat heart and on acute doxorubicin-induced cardiotoxicity. Cancer Chemother Pharmacol 1999;43:227 – 32. [7] Muller DN, Dechend R, Mervaala E, et al. NF-kB inhibition ameliorates angiotensin II-induced inflammatory damage in rats. Hypertension 2000;35:193 – 201. [8] Beswick RA, Zhang H, Marable D, Catravas JD, Hill WD, Webb RC. Long-term antioxidant administration attenuates mineralocorticoid hypertension and renal inflammatory response. Hypertension 2001; 37:781 – 6. [9] Malaguarnera L, Pilastro MR, Vicari L, et al. Pyrrolidinedithiocarbamate induces apoptosis in human acute myelogenous leukemic cells affecting NF-nB activity. Cancer Invest 2005;23:404 – 12. [10] Chen D, Peng F, Cui QC, et al. Inhibition of prostate cancer cellular proteasome activity by a pyrrolidine dithiocarbamate-copper complex is associated with suppression of proliferation and induction of apoptosis. Front Biosci 2005;10:2932 – 9.
165
[11] Li Q, Yu YY, Zhu ZG, et al. Effect of NF-nB constitutive activation on proliferation and apoptosis of gastric cancer cell lines. Eur Surg Res 2005;37:105 – 10. [12] Aoki M, Nata T, Morishita R, et al. Endothelial apoptosis induced by oxidative stress through activation of NF-nB: antiapoptotic effect of antioxidant agents on endothelial cells. Hypertension 2001;38:48 – 55. [13] El Eter E, Hagar HH, Al-Tuwaijiri A, Arafa M. Nuclear factor-nB inhibition by pyrrolidinedithiocarbamate attenuates gastric ischemiareperfusion injury in rats. Can J Physiol Pharmacol 2005;83:483 – 92. [14] Zhou S, Palmeira CM, Wallace KB. Doxorubicin-induced persistent oxidative stress to cardiac myocytes. Toxicol Lett 2001;121:151 – 7. [15] Koutinos G, Stathopoulos GP, Dontas I, et al. The effect of doxorubicin and its analogue mitoxantrone on cardiac muscle and on serum lipids: an experimental study. Anticancer Res 2002;22:815 – 20. [16] Mukherjee S, Banerjee SK, Maulik M, Dinda AK, Talwar KK, Maulik SK. Protection against acute adriamycin-induced cardiotoxicity by garlic: role of endogenous antioxidants and inhibition of TNF-alpha expression. BMC Pharmacol 2003;3:16. [17] Mohamed HE, Asker ME, Ali SI, Fattah TM. Protection against doxorubicin cardiomyopathy in rats: role of phosphodiesterase inhibitors type 4. Pharm Pharmacol 2004;56:757 – 68. [18] Dudnakova TV, Lakomkin VL, Tsyplenkova VG, Shekhonin BV, Shirinsky VP, Kapelko VI. Alterations in myocardial cytoskeletal and regulatory protein expression following a single doxorubicin injection. J Cardiovasc Pharmacol 2003;41:788 – 94. [19] RVitelli M, Filippelli A, Rinaldi B, et al. Effects of docosahexaenoic acid on [Ca(2+)](i) increase induced by doxorubicin in ventricular rat cardiomyocytes. Life Sci 2002;71:1905 – 16. [20] Zhou S, Heller LJ, Wallace KB. Interference with calcium-dependent mitochondrial bioenergetics in cardiac myocytes isolated from doxorubicin-treated rats. Toxicol Appl Pharmacol 2001;175:60 – 7. [21] Wu S, Ko YS, Teng MS, et al. Adriamycin-induced cardiomyocyte and endothelial cell apoptosis: in vitro and in vivo studies. J Mol Cell Cardiol 2002;34:1595 – 607. [22] Zhao W, Lu L, Chen SS, Sun Y. Temporal and spatial characteristics of apoptosis in the infarcted rat heart. Biochem Biophys Res Commun 2004;325:605 – 11. [23] Liu SF, Ye X, Malik AB. Inhibition of NF-kB activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes. Circulation 1999;100:1330 – 7. [24] Rangan GK, Wang Y, Tay YC, Harris DC. Early administration of PDTC in adriamycin nephropathy: effect on proteinuria, cortical tubulointerstitial injury, and NF-nB activation. Ren Fail 2001; 23:773 – 80. [25] Li Wenyan, Zheng Tao, Wang Jun, Altura Bella T., Altura Burton M.. Pyrrolidine dithiocarbamate prevents ethanol-induced elevation of [Ca2+]i in cultured canine cerebral vascular smooth muscle cells. Neurosci Lett 1999;266:205 – 8. [26] Han S, Sidell N. RU486-induced growth inhibition of human endometrial cells involves the nuclear factor-nB signaling pathway. J Clin Endocrinol Metab 2003;88:713 – 9. [27] Gupta Sudhiranjan, Purcell Nicole H., Lin Anning, Sen Subha. Activation of nuclear factor-kB is necessary for myotrophin-induced cardiac hypertrophy. JCB 2002;159:1019 – 28.