- Email: [email protected]
Protective efficacy of piperine against Mycobacterium tuberculosis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
YTUBE1184_proof ■ 9 May 2014 ■ 1/8
Tuberculosis xxx (2014) 1e8
Contents lists available at ScienceDirect
Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube
IMMUNOLOGICAL ASPECTS
Protective efficacy of piperine against Mycobacterium tuberculosis Q8
Q1
Sandeep Sharma a,1, Nitin Pal Kalia a, Pankaj Suden b, Prashant Singh Chauhan b, Manoj Kumar a, 2, Anshu Beulah Ram a, Anamika Khajuria b, Sarang Bani b, Inshad Ali Khan a, * a b
Clinical Microbiology Division, Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi 180 001, India Pharmacology Division, Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi 180 001, India
a r t i c l e i n f o
s u m m a r y
Article history: Received 21 September 2013 Received in revised form 9 April 2014 Accepted 26 April 2014
Piperine a transetrans isomer of 1-piperoyl-piperidine was evaluated for its immunomodulatory activity to enhance the efficacy of rifampicin in a murine model of Mycobacterium tuberculosis infection. In-vitro immunomodulation of piperine was tested on mouse splenocytes for lymphocyte proliferation, cytokine production and macrophage activation. Protective efficacy of piperine was tested in a mice infection model of M. tuberculosis for the activation of Th-1 response and synergistic combination efficacy with rifampicin. Mice splenocytes exposed to piperine exhibited proliferation of T and B cell, increased Th-1 cytokines and enhanced macrophage activation. Piperine (1 mg/kg) in mice infected with M. tuberculosis activated the differentiation of T cells into Th-1 sub-population (CD4þ/CD8þ subsets). There was an increase in secretion of Th-1 cytokines (IFN-g and IL-2) by these cells. The qRT-PCR studies revealed corresponding increases in the mRNA transcripts of IFN-g and IL-2 in the infected lung tissues. Combination of piperine and rifampicin (1 mg/kg) exhibited better efficacy of and resulted in additional 1.4 to 0.8 log reduction in lung cfu as compared to rifampicin alone. The up-regulation of Th1 immunity by piperine can be synergistically combined with rifampicin to improve its therapeutic efficacy in immunecompromised TB patients. Ó 2014 Published by Elsevier Ltd.
Keywords: Rifampicin Bioavailability Cell proliferation Immune-phenotyping Immune-modulation
Q2
1. Introduction Protective immunity against Mycobacterium tuberculosis requires the generation of cell-mediated immunity. The secretion of Th-1 cytokines by antigen-specific T cells plays an important role in protective granuloma formation and stimulates the antimicrobial activity of infected macrophages [1]. Approximately 90e95% of initial infections are controlled by the cell-mediated immune response. However, tuberculosis immunity is static and a residual population of viable bacteria may be maintained in a poorly understood state of clinical latency for extended periods [2,3]. Majority of tuberculosis cases are caused by reaction of latent tuberculosis and approximately 5e10% of these cases results in spontaneous reactivation of tuberculosis infection [4].
* Corresponding author. Tel.: þ91 191 2569001; fax: þ91 191 2569333. E-mail addresses: [email protected], [email protected], [email protected] (I.A. Khan). 1 Present address: Department of Biotechnology, School of Basic Sciences, Arni University, HP, India. 2 Present address: Department of Biology, Daiichi Sankyo Research Center in India, Sec-18, Gurgaon, India.
The ability of the host to control infection with M. tuberculosis resides in the ability to mount an effective cellular immune response [5e7]. An effective immune-stimulant can complement the host cellular immune response by specifically inducing the type 1 (Th-1) response. In this regard, the key cytokine in mice and also in humans seems to be gamma interferon (IFN-g), which activates bactericidal effector mechanisms in the mycobacterial host cell, the macrophage [6]. Macrophages are also considered to be an important component of the cellular immune response in tuberculosis infection. Large numbers of plant products have shown immunomodulatory properties and have the ability to invoke a Th1 response of a variety of T-cell subsets as well as to stimulate the production of cytokines that are involved in the immune response against the infectious agent [8]. Some plants, such as Viscum album, Tinospora cordifolia, and Withania somnifera have been reported for their immunomodulatory activity [9]. Piperine, a transetrans isomer of 1-piperoyl-piperidine isolated from black pepper (Piper longum), is an inhibitor of human pglycoprotein and CYP3A4 [10]. It is also reported to be a bioavailability enhancer and has potential immunomodulatory activity [11e13]. Recently piperine has been reported as an inhibitor of NorA efflux pump of Staphylococcus aureus [14,15].
http://dx.doi.org/10.1016/j.tube.2014.04.007 1472-9792/Ó 2014 Published by Elsevier Ltd.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Q3 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 2/8
2
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
In the present study we investigated the immunomodulatory potential of piperine through up-regulation of Th-1 immune response and its protective efficacy in a murine model of M. tuberculosis infection.
culture supernatants were harvested for the estimation of cytokines (IFN-g, IL-2 and IL-4) by ELISA as per the instruction of manufacturer (R&D Systems, USA).
M. tuberculosis H37Rv (ATCC 27294; American Type Culture Collection, Manassas, VA) was used throughout the studies. Culture was grown for 10e15 days in Middlebrook 7H9 broth (Becton Dickinson, Sparks, USA) supplemented with 0.5% (v/v) glycerol, 0.25% (v/v) Tween 80 (Himedia, Mumbai, India), and 10% ADC (albumin dextrose catalase, Becton Dickinson, Sparks, USA) under shaking conditions at 37 C to facilitate exponential-phase growth of the organism. The turbidity of the bacterial suspension was adjusted to 1 McFarland (1.5 107 cfu/mL).
2.3.4. Nitrite production from peritoneal macrophages Macrophages were isolated from the peritoneal cavity of naive BALB/C mice. The cells were washed twice with RPMI-1640 and centrifuged at 400 g for 10 min at 4 C and finally adjusted to 3 106 cells/mL in complete medium. One millilitre of cell suspension was dispensed in 24-well culture plates. Macrophages were allowed to adhere to the bottom of the wells at 37 C for 3 h in CO2 incubator. The plates were washed with phosphate buffer saline, pH 7.4 (PBS) to remove non-adherent cells. Cells were further incubated with LPS (1 mg/mL) and piperine (1 and 10 mg/mL) at 37 C in CO2 for 48 h. The supernatants were harvested for estimation of nitrite content by Griess reagent as described by Malik et al. 2007 [8]. The absorbance at 550 nm (A(550)) was measured and nitrite content determined using a standard calibration curve.
2.2. Drugs
2.4. In vivo study
Rifampicin and piperine (potency, >99%) were purchased from SigmaeAldrich (St. Louis, USA). The drugs were dissolved in dimethyl sulfoxide (DMSO, Sigma) and the final concentration of DMSO did not exceed 0.1% v/v during experimentation.
2.4.1. Animals The institutional animal Ethics committee of the Indian Institute of Integrative Medicine (CSIR, Jammu) approved all experimental protocols for the use of animals. Eight week-old female (BALB/c) mice 20e22 g by body weight were used for the efficacy studies. Mice were allowed 1 week of acclimation before commencing experimental studies. Feed and water were given ad libitum.
2. Materials and methods 2.1. Organisms
2.3. In vitro study 2.3.1. Isolation of mice splenocytes Spleens collected from BALB/c mice under aseptic conditions, in Hank’s balanced salt solution (HBSS, Sigma), was minced using a pair of glass slides and passed through a fine needle with help of syringe mesh to obtain a homogeneous cell suspension. Erythrocytes were separated by lyses with ammonium chloride (0.8%, w/v), followed by centrifugation (380 g at 4 C for 10 min). The pelleted cells were washed thrice in PBS, and resuspended in complete medium [RPMI 1640 (Sigma) supplemented with 12 mM HEPES (pH 7.1), 0.05 mM 2,b-mercaptoethanol, 100 u/mL penicillin, 100 mg/mL streptomycin, and 10% Foetal Calf Serum (FCS, Sigma)]. Cell numbers were counted with a haemocytometer by trypan blue dye exclusion technique. 2.3.2. Cell proliferation assay The splenocyte proliferation assay was performed by MTT assay. Briefly, splenocytes were seeded in 96-well flat-bottom microtiter plate (Nunc Roskilde, Denmark) at 2 106 cells/mL in 100 mL complete medium. For T-cell proliferation, concanavalin A (Con A, Sigma) was added at a final concentration of 0.5 mg/mL. For B cell proliferation, lipopolysaccharide (LPS, Sigma) was added at a final concentration of 1 mg/mL. Varying concentrations of piperine (1 and 10 mg/mL) were added to each well in triplicates and the plates were incubated at 37 C in a humid atmosphere with 5% CO2. After 72 h, 50 mL of MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyl tetrazolium bromide) solution (5 mg/mL) was added to each well and incubated further for 4 h. Plates were centrifuged (1400 g, for 5 min) and the untransformed MTT was decanted and formazan crystal of MTT were dissolved by adding 200 mL of acidified DMSO (192 mL DMSO with 8 mL 1 N HCl) to each well, and the absorbance was recorded 570 nm (A(570)) using a microplate reader (Multiskan Spectrum; Thermo Electron, Vantaa, Finland). 2.3.3. Cytokine estimation by ELISA Splenocytes were seeded into 96-well flat-bottom microtiter plate at 2 106 cells/mL in complete medium. Cells were incubated with piperine (0.5, 1 and 10 mg/mL) for 72 h at 37 C in 5% CO2. The
2.4.2. Infection with M. tuberculosis M. tuberculosis (H37Rv) was grown by the culturing of bacteria from LowensteineJensen slant in Middlebrook 7H9 supplemented with 10% ADC medium on a rotary shaker for 10e15 days at 37 C. Infection with M. tuberculosis was administered by the intranasal route with 1 103 cfu/mL (protective efficacy) and 5 105 cfu/mL (in combination study with rifampicin) in a 20 mL volume per mouse [10]. 2.4.3. Protective efficacy studies In this study, piperine was evaluated at 1.0 and 10 mg/kg of oral dose. Piperine was solubilized in minimal volume of ethanol and formulated in 50% polyethylene glycol-400 (PEG-400, Qualigens, India) in sterile distilled water. Final concentration of ethanol in formulation did not exceed 0.5% v/v. Piperine doses were administered orally (gavage daily) eight weeks prior to infection and were continued for next eight weeks post infection. The control infected group was treated with placebo. A group of mice, which was uninfected and untreated, was included throughout the experiment to obtain baseline information for Lymphocyte immunophenotyping, Intracellular cytokines estimation and cytokines expression studies. Schematic layout of these studies is explained in Figure 1. a Lymphocyte immunophenotyping: FITC-labelled anti-mouse CD4 and PE-labelled CD8 monoclonal antibodies were used to determine the percentage of CD4þ and CD8þ T cells in the control and treated groups of animals as described earlier (BD Biosciences, USA) [24]. Blood samples were collected from the retro orbital plexus of mice from all the groups after the completion of piperine treatment. FITC-labelled CD4 and PElabelled CD8 monoclonal antibodies were directly added to 100 mL of whole blood. Tubes were incubated in the dark for 30 min at room temperature. Subsequently, 1 X FACS lysing solution (BD Biosciences, USA) was added at room temperature with gentle mixing followed by incubation for 10 min. The samples were centrifuged at 300e400 g. Supernatant was
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 3/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
3
d qRT-PCR analysis: The right lung of the mouse was homogenized in equal volume of TRIZOL reagent (Invitrogen, CA, USA). Total RNA was extracted in accordance with the manufacturer’s instructions. The RNA was finally dissolved in DNase and RNase free water. In order to remove the genomic DNA contamination, RNA samples were treated with RNase-free DNase I according to manufacturer’s recommendations (Ambion, Austin, TX). The real time reactions were performed in the Light Cycler 1.5 (Roche, Mannheim, Germany) using one-step RT-PCR in a total reaction volume of 20 mL. All the primer sets used in this study are listed in Table 1. These primers were designed by using PRIMER 3 software [25] and purchased from Sigma (St. Louis, MO) [1]. The RT-PCR reaction mix comprised of 10 pmol of each primer, 4 mL of one-step RT-PCR reaction mix containing SYBR green I, 3 mM MgCl2, 0.4 mL of Light Cycler RT-PCR Enzyme Mix, (Roche) and the 4 mL extracted RNA (600e800 ng). The real-time PCR run protocol consisted of: reverse transcription at 55 C for 10 min, followed by PCR activation at 95 C for 30 s and 45 cycles of amplification (10 s at 95 C; 20 s at 60 C; 25 s at 72 C). Fluorescence was measured during the annealing step and plotted against the amplification cycles. We normalized gene copy numbers against copies of b-actin gene, constitutively expressed in human tissue. The gene induction ratio was calculated by dividing the normalized target gene transcripts to control mRNA transcripts from bacteria surviving in lung. Each reaction was performed in triplicate and singularity of RT-PCR product was assessed using melting curve analysis.
Figure 1. Effect of piperine (PIP) on proliferation of T and B Lymphocytes e in vitro. Splenocytes isolated from the sacrificed mice stimulated with sub-optimal amount of mitogens; Con A (0.5 mg/L), LPS (1 mg/L) for T and B cell proliferation respectively. Cells were incubated with piperine (1 & 10 mg/L) for 72 h and proliferation was measured by MTT reduction assay. The proliferating effect of piperine was compared with the stimulated controls. Data was mean S.D. (n ¼ 8). P value, significantly different from control. *<0.05, **<0.01.
aspirated out and the pellets collected were washed thrice with PBS. The resulting stained cell pellets were resuspended in 500 mL of PBS and run on a flow cytometer (LSR, BD Biosciences). Analysis was done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences). b Intracellular cytokines estimation: Blood samples were collected in heparinised tubes from retro orbital plexus as mentioned above. FITC-labelled anti-mouse CD4þ monoclonal antibody and PE-labelled anti-mouse IFN-g were used in first set, FITClabelled anti-mouse CD4þ monoclonal antibody and PElabelled anti-mouse IL-2 were used in the second set and FITC-labelled anti-mouse CD4þ monoclonal antibody and PElabelled anti-mouse IL-4 were used in third set. Acquisition and analysis were done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences) [24]. c Viable CFU count: The left lung of the sacrificed mouse was aseptically removed and homogenized in 1 mL of sterile normal saline containing 0.05% v/v of Tween 80. Viable bacteria were quantified by plating 10-fold serial dilutions in duplicates on Middlebrook 7H10 agar supplemented with 10% OADC and incubated at 37 C in 5% CO2 for 4e6 weeks. Viable colony counts were expressed as log10 cfu per organ and were compared with untreated control groups. Early and late control group consisted of infected untreated mice sacrificed one week post infection and after completion of piperine treatment.
2.4.4. Combination efficacy of rifampicin and piperine The combination efficacy study was carried as described by Cynamon et al. [26] The BALB/c mice were infected as described above and each group consisted of eight mice. Untreated infected mice (early control) were sacrificed at the start of the treatment. Treatment started one week post infection and groups were treated daily with oral administration (gavage) of rifampicin 10 mg/kg and 20 mg/kg alone and in combination with piperine (10 mg/kg) for 4 and 8 weeks. Both piperine and rifampicin were formulated in 50% PEG-400 in water as mentioned above. Piperine (10 mg/kg) alone was included as control and compared with untreated infected mice (late control) at the end of the study. All mice were euthanized by CO2 inhalation. The lungs from the early control group and from each treated group were aseptically removed and homogenized in 1 mL of sterile normal saline containing 0.05% v/v of Tween 80. Viable bacteria were quantified by plating 10-fold serial dilutions in duplicate on Middlebrook 7H10 agar supplemented with 10% OADC and incubated at 37 C in 5% CO2 for 4e6 weeks. Viable colony counts were expressed as log10 cfu per organ. 2.4.5. Statistical analysis Two tailed student’s t test was used to analyse the differences between each treatment group and was considered significant at Table 1 List of primer for expression study using RT-PCR. Cytokine and primer
Sequence (50 e30 )
Product size (base pairs)
IL-4
F: CTCCTATCACTGACGGT R: ATTCACATTGCAGCTCT F: CACCCACTTCAAGCTCT R: TCCACCACAGTTACTGTC F: GACAACCAGGCCATCC R: CAAAACAGCACCGACT F: CAAAAGCCACCCCCACTCCTAAGA R: GCCCTGGCTGCCTCAACACCT C
342
IL-2 IFN-g
b-actin
349 226 258
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 4/8
4
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
Figure 2. Influence of piperine (PIP) on expression of cytokines in mouse splenocytes in vitro Splenic lymphocytes isolated from BALB/c mice were grown in 24 well culture plates (2 106 cells/mL) in RPMI-FBS (10%). Cells were co-incubated with 0.5 mg/L Con A and different concentration of PIP (1e10 mg/L) for 72 h. The cytokines (A); IFN-g, (B) IL-2, (C) IL-4 were assayed by ELISA. (D) in vitro effect of piperine on NO production in peritoneal macrophages. Cells were co-incubated with 1 mg/L LPS and different concentration of PIP (1e 10 mg/L) for 48 h. The effect of piperine on cytokines and NO production was compared with the stimulated controls. The results were prepared as Mean S.D. of three independent experiments. P value *<0.05 **<0.01.
P < 0.05. Data are represented as means; error bars indicate standard deviations from the means. 3. Results 3.1. In vitro study 3.1.1. Potent lymphoproliferation induced by piperine The proliferative effect of piperine was studied on lymphocytes isolated from mouse spleen. Piperine elicited a significant increase in proliferative response (P < 0.01) in the Con A stimulated T lymphocytes. The increase in proliferation was observed in a concentration dependent manner with optimal effect up to 1 mg/mL. However at higher concentration i.e. 10 mg/mL, reduced proliferation was observed, which could be due to mild cytotoxic effect of piperine. Piperine at this concentration exhibited w20% cytotoxic effect on mouse splenocytes as estimated by MTT assay (data no shown). Similar effect was observed on LPS primed B cells proliferation (P < 0.01) while the relative effect was more apparent on T cells (Figure 1A and B). Cells grown in the absence of mitogens did not show any proliferation. 3.1.2. Enhance production of Th-1 Cytokines in piperine treated lymphocytes Piperine showed a significant dose dependent up-regulation of Th-1 cytokines (IFN-g and IL-2) as compared to sensitized control (P < 0.01). Piperine at 1.0 and 10 mg/mL showed an up-regulation of IFN-g and IL-2 production with respect to control as shown in Figure 2A and B. The maximum immunomodulatory effect was
observed at 10 mg/mL (P < 0.05). There was no increase in the production of IL-4, a Th-2 cytokine (Figure 2C). 3.1.3. Nitric oxide production by piperine treated peritoneal macrophages The macrophages were primed with LPS (1 mg/mL) and incubated with different concentrations of piperine. Piperine at 1 mg/mL caused a significant increase in the production of nitric oxide (NO) in the supernatant, while its influence was of lesser magnitude at higher concentration of 10 mg/mL perhaps due to the mild cytotoxic effect of piperine as mentioned above (Figure 2D). 3.2. Protective efficacy of piperine a Modulation of Th-1 cytokines in the lymphocytes of piperine treated mice: In this experiment mice were administrated prophylactic doses of piperine at 1.0 mg/kg and 10 mg/kg body weight for eight weeks prior to the infection of M. tuberculosis followed by further eight weeks administration of piperine. The T-cell lymphocytes were analysed by flow cytometry for the production of Th-1 cytokines. The Th-1 cytokines (IFN-g and IL2) expressing population of cells were estimated on the CD4 subtypes of these T-cell lymphocytes. Piperine elicited increased production of IFN-g and IL-2 cytokines at 1.0 and 10.0 mg/kg body weight doses when compared with untreated (infected) group of mice. The maximum effect was observed at 10 mg/kg (Figure 3A and B). There was no stimulation observed in the expression of IL-4 at given concentration (Figure 3C). b Analysis of lymphocyte sub-populations: Piperine treated mice exhibited significant increase in the population of CD4þ/CD8þ
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 5/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
(P < 0.01) subsets at the dose of 10 mg/kg body weight as compared to untreated infected control group (Figure 3D). c Effect of piperine on viable CFU count: During prophylactic study, after 8 weeks of infection there was 2 log10 increases in cfu/lung in untreated mice (late control) with respect to early control. Piperine at 1.0 mg/kg dose did not exhibit any protective efficacy as evident from the cfu load; however at 10 mg/kg some protective efficacy was observed which did not allow the infection to proliferate as evident from the cfu load in this group when compared with early control (Figure 3E). d Effect of piperine on cytokines expression: Normalized relative expression ratio of cytokines (IFN-g, IL-2, and IL-4) in mice administered with piperine 1.0 mg/kg and 10 mg/kg of body weight was compared with control (untreated) mice. Relative expression of mRNA transcripts of cytokines was calculated on the basis of PCR efficiency and cycle threshold (Ct), where expression was normalized using b-actin as housekeeping gene. Expression of IFN-g and IL-2 was up-regulated significantly (upto two fold increase) in mice treated with piperine 10 mg/kg of body weight, as compared with untreated mice (Figure 4A and B). No significant effect on IL-4 mRNA expression was observed in mice of all the groups, with the values similar to the comparator (Figure 4C).
5
3.2.1. Combination study of piperine and rifampicin in murine model of M. tuberculosis The prophylactic treatment of piperine (10 mg/kg) in the above mentioned murine model of M. tuberculosis resulted in the polarization of lymphocytes to Th-1 immunity. These findings prompted us to test piperine in combination with rifampicin. The study was carried out for 4e8 weeks. Piperine alone at 10 mg/kg did not exhibit protective efficacy as evident from the cfu load in this group when compared with early control (Figure 5), probably because of higher inoculums (5 105 cfu/mL) used in this study as compared with 1 103 cfu/mL in the protective efficacy studies. However, the same dose of piperine in combination with rifampicin (10 mg/kg) significantly improved the therapeutic effect of rifampicin and resulted in additional 1.4e0.8 log reduction in bacterial load in the lungs at 4e8 weeks compared to rifampicin alone. The effect of piperine was more pronounced with higher dose of rifampicin (20 mg/kg) where the cfu/lung reached below detection limits in 4 weeks itself (same effect exhibited by rifampicin in 8 weeks) (Figure 5). 4. Discussion Piperine is endowed with numerous pharmacological activities but the most important being the enhancement of bioavailability
Figure 3. Influence of piperine (PIP) on expression of cytokines in mouse (n ¼ 8) in vivo by flow cytometry Blood from retro orbital plexus in EDTA coated tube from BALB/c mice were taken and acquisition and analysis were done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences). The results were compared with untreated (infected) controls. The cytokines (A); IFN-g, (B) IL-2, (C) IL-4, (D) %-T-cells (E) cfu/lung. The results were prepared as Mean S.D. of three independent experiments. P value *<0.05 **<0.01.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 6/8
6
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
Figure 4. Relative mRNA expression levels of IFN-g (A), IL-2 (B), IL-4 (C), in mice lung (n ¼ 8) treated with piperine (PIP) at 0.5 mg/kg and 1 mg/kg. Treatment was started two months before infection and continued for next two month after infection. Results were expressed as differences between Ct values of test and comparator samples. b-actin, a housekeeping gene was used for normalization. The samples were analysed in triplicates and the mean values were taken with respective Standard deviation. P value *<0.05 **<0.01.
[11,12] inhibition of cytochrome P450 as well as mammalian pglycoprotein [16]. On the basis of above mentioned pharmacological actions of piperine Indian Institute of Integrative Medicine, Jammu has developed an anti-TB formulation called ‘Risorine’, being marketed in India by Cadila Pharmaceutical Ltd. It contains rifampicin (200 mg), isoniazid (300 mg) and piperine (10 mg)
which is found to be bioequivalent with commercially available rifampicin (450 mg) preparations [17]. The objective of this study was to investigate in-detail the immunomodulatory effect of piperine and its protective effect on mice infected with M. tuberculosis. The in-vitro studies revealed that piperine augmented the immune responses to T-dependent antigen. This is
Figure 5. Each group consisted of 8 mice. Treatment was started 1 week after mice received w5 105 viable M. tuberculosis H37Rv through intranasal route. The drugs were evaluated at the following doses: RIF, 10 mg/kg; RIF, 20 mg/kg; PIP, 10 mg/kg; PIP, 1 mg/kg. RIF, RIF/PIP and PIP treated groups were compared with early control for 2 log10 reduction in cfu. Late control represented the untreated group at the end of the treatment period. The samples were analysed in triplicates and the mean values were taken with respective Standard deviation. P value *<0.05 **<0.01.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 7/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
evidenced from increased T and B cell proliferation, supported by selective Th-1 type immunity and enhanced macrophage activation thereby stimulating cell-mediated immunity. The immunomodulatory and anti-cancer properties of piperine have been reported earlier in tumour bearing mice. In this study the immunomodulatory potential of piperine was measured through increase in bone marrow cellularity, increased antibody titre and increased plaque forming cells in spleen [13]. In an another study, Pathak and Khandelwal (2007) reported the proliferating effect of piperine on the splenocytes comprising of both B and T cells, resulting in the complete abrogation of the influence of cadmium and leading to restoration of B and cell population [18]. Piperine at a dose of 10 mg/kg in mice infected with M. tuberculosis, appeared to activate and differentiate T cells into a Th-1 sub-population as evident from the increased population of CD4þ/CD8þ lymphocyte sub-population. There was also an increase in the secretion of Th-1 cytokines such as IFN-g and IL-2 by these cells. However, there was no effect on Th-2 cytokines such as IL-4. The Th-1 cytokines are associated with the generation of cellmediated immunity and resistance to intracellular parasites, whereas Th-2 cytokines favour the induction of humoral immunity and resistance to extracellular parasites [19,16]. IL-2 stimulates NKcell proliferation and activation for the production of IFN-g [20]. IFN-g is responsible for recruiting macrophages into the inflammatory site and promotes phagocytic activity. The protective role of IFN-g in M. tuberculosis or Mycobacterium leprae infection is well established and it has been effectively demonstrated that IFN-g knockout mice are more susceptible to M. tuberculosis [21e23]. Probably due to this Th-1 cytokines mediated protection by piperine, the proliferation of infection was controlled and there was no increase in bacterial cfu load (Figure 3E). The increase in the level of Th-1 cytokines was related to the corresponding increase in the mRNA transcripts of IFN-g and IL-2 (with no increase in IL-4 mRNA transcript) in the lung tissues of the infected mice. In order to investigate whether the Th-1 up-regulatory effect of piperine can synergistically affect the therapeutic outcome of rifampicin treatment, we treated the M. tuberculosis infected mice with a combination of piperine and rifampicin. We found that there was marked improvement in the therapeutic outcome of rifampicin (10 mg/kg) when combined with piperine at (10 mg/kg). The most important finding of this study was that the combination of higher dose of rifampicin (20 mg/kg) and piperine reduced the bacterial load in lungs below the detection limit within 4 weeks, whereas rifampicin alone at the same dose could achieve it in 8 weeks (Figure 5). The multicentric clinical trials conducted across India in patients with radiologically confirmed diagnosis of pulmonary tuberculosis revealed that more than 90% of the patients treated with risorine were cured of tuberculosis with lesser side effects owing to the reduced dose of rifampicin [17]. We hypothesize that one of the possible reasons for this better therapeutic outcome of this formulation could be the selective augmentation of Th-1 response by piperine is taking place in these patients as observed in mice in our study. It is therefore warranted that the post marketing studies on risorine formulation should address the immunomodulatory potential of piperine as contributor to clinical outcome of this formulation. Acknowledgements We are thankful to Dr. M. H. Cynamon, VAMC, Syracuse, NY for critical evaluation of manuscript. S.S., M.K., A.B.R. are grateful to the Q4,511Council of Scientific and Industrial Research, New Delhi, India for Q6 providing Senior Research Fellowship.
7
Funding: This work was supported by Council of Scientific and Industrial Research (CSIR), New Delhi. Competing interests: Ethical approval:
None declared. Not required.
Transparency declarations:
None to declare.
References [1] Quiroga MF, Jurado JO, Martinez GJ, Pasquienelli V, Musella RM, Abbate E, Issekutz AC, Bracco MM, Malbran A, Sieling PA, Chuluyan E, García VE. Crosstalk between CD31 and the signaling lymphocytic activation moleculeassociated protein during interferon-gamma production against Mycobacterium tuberculosis. J Infect Dis 2007;196:1369e78. [2] Nathan C, Shiloh MU. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc Natl Acad Sci U S A 2000;97:8841e8. [3] World Health Organization Report. Anti-tuberculosis drug resistance in the world e the fourth global report. The WHO/IUATLD Global Project on Anti-tuberculosis Drug Resistance Surveillance 2002e2007. WHO/HTM/TB/2008; 394. [4] Styblo K. Epidemiology of tuberculosisIn Selected papers of the Royal Netherlands Tuberculosis Association, 24. The Hague, The Netherlands: KNCV Tuberculosis Foundation Press; 1991. [5] Hahn H, Kaufmann SH. The role of cell-mediated immunity in bacterial infections. Rev Infect Dis 1981;3:1221e50. [6] Holten-Andersen L, Doherty TM, Korsholm KS, Andersen P. Combination of the cationic surfactant dimethyl dioctadecyl ammonium bromide and synthetic mycobacterial cord factor as an efficient adjuvant for tuberculosis subunit vaccines. Infect Immun 2004;72:1608e17. [7] Mackaness GB. The immunology of antituberculous immunity. Am Rev Respir Dis 1968;97:337e44. [8] Malik F, Singh J, Khajuria A, Suri KA, Satti NK, Singh S, Kaul MK, Kumar A, Bhatia A, Qazi GN. A standardized root extract of Withania somnifera and its major constituent withanolide-A elicit humoral and cell-mediated immune responses by up regulation of Th1-dominant polarization in BALB/c mice. Life Sci 2007;80:1525e38. [9] Kapoor LD. Handbook of ayurvedic medicinal plants. Boca Raton (Florida, USA): CRC Press; 2000. [10] Saunder BM, Cheers C. Inflammatory response following intranasal infection with Mycobacterium avium complex: role of T-cell subsets and gamma interferon. Infect Immun 1995;63:2282e7. [11] Atal CK, Dubey RK, Singh J. Biochemical basis of enhanced drug bioavailability by piperine: evidence that piperine is a potent inhibitor of drug metabolism. J Pharmacol Exp Ther 1985;232:258e62. [12] Atal CK, Zutshi U, Rao PG. Scientific evidence on the role of ayurvedic herbals on bioavailability of drugs. J Ethnopharmacol 1981;4:229e32. [13] Sunila ES, Kuttan G. Immunomodulatory and antitumor activity of Piper longum Linn. and piperine. J Ethnopharmacol 2004;90:339e46. [14] Khan IA, Mirza ZM, Kumar A, Verma V, Qazi GN. Piperine, a phytochemical potentiator of ciprofloxacin against Staphylococcus aureus. Antimicrobial Agents Chemother 2006;50:810e2. [15] Kumar A, Khan IA, Koul S, Koul JL, Taneja SC, Ali I, Ali F, Sharma S, Mirza ZM, Kumar M, Sangwan PL, Gupta P, Thota N, Qazi GN. Novel structural analogues of piperine as inhibitors of the NorA efflux pump of Staphylococcus aureus. J Antimicrob Chemother 2008;16:1270e6. [16] Singh J, Dubey RK, Atal CK. Piperine-mediated inhibition of glucuronidation activity in isolated epithelial cells of the guinea-pig small intestine: evidence that piperine lowers the endogenous UDP-glucuronic acid content. J Pharmacol Exp Ther 1986;236:488e93. [17] Chawla PC. Risorine e a novel CSIR drug curtails TB treatment. CSIR News 2010;60:52e4. [18] Pathak N, Khandelwal S. Cytoprotective and immunomodulating properties of piperine on murine splenocytes: an in vitro study. Eur J Pharmacol 2007;576: 160e70. [19] Mosmann T, Sad S. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol Today 1996;17:138e46. [20] He XS, Draghi M, Mahmood K, Holmes TH, Kemble GW, Dekker CL, Arvin AM, Parham P, Greenberg HB. T cell-dependent production of IFNgamma by NK cells in response to influenza A virus. J Clin Invest 2004;114:1812e9. [21] Condos RW, Rom N, Schluger NW. Treatment of multidrug resistant pulmonary TB with interferon-g via aerosol. Lancet 1997;24:1513e5. [22] Kaplan G, Mathur NK, Job CK, Nath I, Cohn ZA. Effect of multiple interferon gamma injections on the disposal of M. leprae. Proc Natl Acad Sci U S A 1989;86:8073e7.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
Q7
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5
YTUBE1184_proof ■ 9 May 2014 ■ 8/8
8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
[23] Xing Z, Zganiacz A, Wang J, Sharma SK. Enhanced protection against fatal mycobacterial infection in SCID beige mice by reshaping innate immunity with IFN-g transgene. J Immunol 2001;167:375e83. [24] Pandey A, Bani S, Dutt P, Suri KA. Modulation of Th1/Th2 cytokines and inflammatory mediators by hydroxychavicol in adjuvant induced arthritic tissues. Cytokines 2010;49(1):114e21.
[25] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365e86. [26] Cynamon MM, Sklaney R, Shoen C. Gatifloxacin in combination with rifampicin in a murine tuberculosis model. J Antimicrob Chemother 2007;60:429e 32.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
6 7 8 9 10
YTUBE1184_proof ■ 9 May 2014 ■ 1/8
Tuberculosis xxx (2014) 1e8
Contents lists available at ScienceDirect
Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube
IMMUNOLOGICAL ASPECTS
Protective efficacy of piperine against Mycobacterium tuberculosis Q8
Q1
Sandeep Sharma a,1, Nitin Pal Kalia a, Pankaj Suden b, Prashant Singh Chauhan b, Manoj Kumar a, 2, Anshu Beulah Ram a, Anamika Khajuria b, Sarang Bani b, Inshad Ali Khan a, * a b
Clinical Microbiology Division, Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi 180 001, India Pharmacology Division, Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi 180 001, India
a r t i c l e i n f o
s u m m a r y
Article history: Received 21 September 2013 Received in revised form 9 April 2014 Accepted 26 April 2014
Piperine a transetrans isomer of 1-piperoyl-piperidine was evaluated for its immunomodulatory activity to enhance the efficacy of rifampicin in a murine model of Mycobacterium tuberculosis infection. In-vitro immunomodulation of piperine was tested on mouse splenocytes for lymphocyte proliferation, cytokine production and macrophage activation. Protective efficacy of piperine was tested in a mice infection model of M. tuberculosis for the activation of Th-1 response and synergistic combination efficacy with rifampicin. Mice splenocytes exposed to piperine exhibited proliferation of T and B cell, increased Th-1 cytokines and enhanced macrophage activation. Piperine (1 mg/kg) in mice infected with M. tuberculosis activated the differentiation of T cells into Th-1 sub-population (CD4þ/CD8þ subsets). There was an increase in secretion of Th-1 cytokines (IFN-g and IL-2) by these cells. The qRT-PCR studies revealed corresponding increases in the mRNA transcripts of IFN-g and IL-2 in the infected lung tissues. Combination of piperine and rifampicin (1 mg/kg) exhibited better efficacy of and resulted in additional 1.4 to 0.8 log reduction in lung cfu as compared to rifampicin alone. The up-regulation of Th1 immunity by piperine can be synergistically combined with rifampicin to improve its therapeutic efficacy in immunecompromised TB patients. Ó 2014 Published by Elsevier Ltd.
Keywords: Rifampicin Bioavailability Cell proliferation Immune-phenotyping Immune-modulation
Q2
1. Introduction Protective immunity against Mycobacterium tuberculosis requires the generation of cell-mediated immunity. The secretion of Th-1 cytokines by antigen-specific T cells plays an important role in protective granuloma formation and stimulates the antimicrobial activity of infected macrophages [1]. Approximately 90e95% of initial infections are controlled by the cell-mediated immune response. However, tuberculosis immunity is static and a residual population of viable bacteria may be maintained in a poorly understood state of clinical latency for extended periods [2,3]. Majority of tuberculosis cases are caused by reaction of latent tuberculosis and approximately 5e10% of these cases results in spontaneous reactivation of tuberculosis infection [4].
* Corresponding author. Tel.: þ91 191 2569001; fax: þ91 191 2569333. E-mail addresses: [email protected], [email protected], [email protected] (I.A. Khan). 1 Present address: Department of Biotechnology, School of Basic Sciences, Arni University, HP, India. 2 Present address: Department of Biology, Daiichi Sankyo Research Center in India, Sec-18, Gurgaon, India.
The ability of the host to control infection with M. tuberculosis resides in the ability to mount an effective cellular immune response [5e7]. An effective immune-stimulant can complement the host cellular immune response by specifically inducing the type 1 (Th-1) response. In this regard, the key cytokine in mice and also in humans seems to be gamma interferon (IFN-g), which activates bactericidal effector mechanisms in the mycobacterial host cell, the macrophage [6]. Macrophages are also considered to be an important component of the cellular immune response in tuberculosis infection. Large numbers of plant products have shown immunomodulatory properties and have the ability to invoke a Th1 response of a variety of T-cell subsets as well as to stimulate the production of cytokines that are involved in the immune response against the infectious agent [8]. Some plants, such as Viscum album, Tinospora cordifolia, and Withania somnifera have been reported for their immunomodulatory activity [9]. Piperine, a transetrans isomer of 1-piperoyl-piperidine isolated from black pepper (Piper longum), is an inhibitor of human pglycoprotein and CYP3A4 [10]. It is also reported to be a bioavailability enhancer and has potential immunomodulatory activity [11e13]. Recently piperine has been reported as an inhibitor of NorA efflux pump of Staphylococcus aureus [14,15].
http://dx.doi.org/10.1016/j.tube.2014.04.007 1472-9792/Ó 2014 Published by Elsevier Ltd.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Q3 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 2/8
2
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
In the present study we investigated the immunomodulatory potential of piperine through up-regulation of Th-1 immune response and its protective efficacy in a murine model of M. tuberculosis infection.
culture supernatants were harvested for the estimation of cytokines (IFN-g, IL-2 and IL-4) by ELISA as per the instruction of manufacturer (R&D Systems, USA).
M. tuberculosis H37Rv (ATCC 27294; American Type Culture Collection, Manassas, VA) was used throughout the studies. Culture was grown for 10e15 days in Middlebrook 7H9 broth (Becton Dickinson, Sparks, USA) supplemented with 0.5% (v/v) glycerol, 0.25% (v/v) Tween 80 (Himedia, Mumbai, India), and 10% ADC (albumin dextrose catalase, Becton Dickinson, Sparks, USA) under shaking conditions at 37 C to facilitate exponential-phase growth of the organism. The turbidity of the bacterial suspension was adjusted to 1 McFarland (1.5 107 cfu/mL).
2.3.4. Nitrite production from peritoneal macrophages Macrophages were isolated from the peritoneal cavity of naive BALB/C mice. The cells were washed twice with RPMI-1640 and centrifuged at 400 g for 10 min at 4 C and finally adjusted to 3 106 cells/mL in complete medium. One millilitre of cell suspension was dispensed in 24-well culture plates. Macrophages were allowed to adhere to the bottom of the wells at 37 C for 3 h in CO2 incubator. The plates were washed with phosphate buffer saline, pH 7.4 (PBS) to remove non-adherent cells. Cells were further incubated with LPS (1 mg/mL) and piperine (1 and 10 mg/mL) at 37 C in CO2 for 48 h. The supernatants were harvested for estimation of nitrite content by Griess reagent as described by Malik et al. 2007 [8]. The absorbance at 550 nm (A(550)) was measured and nitrite content determined using a standard calibration curve.
2.2. Drugs
2.4. In vivo study
Rifampicin and piperine (potency, >99%) were purchased from SigmaeAldrich (St. Louis, USA). The drugs were dissolved in dimethyl sulfoxide (DMSO, Sigma) and the final concentration of DMSO did not exceed 0.1% v/v during experimentation.
2.4.1. Animals The institutional animal Ethics committee of the Indian Institute of Integrative Medicine (CSIR, Jammu) approved all experimental protocols for the use of animals. Eight week-old female (BALB/c) mice 20e22 g by body weight were used for the efficacy studies. Mice were allowed 1 week of acclimation before commencing experimental studies. Feed and water were given ad libitum.
2. Materials and methods 2.1. Organisms
2.3. In vitro study 2.3.1. Isolation of mice splenocytes Spleens collected from BALB/c mice under aseptic conditions, in Hank’s balanced salt solution (HBSS, Sigma), was minced using a pair of glass slides and passed through a fine needle with help of syringe mesh to obtain a homogeneous cell suspension. Erythrocytes were separated by lyses with ammonium chloride (0.8%, w/v), followed by centrifugation (380 g at 4 C for 10 min). The pelleted cells were washed thrice in PBS, and resuspended in complete medium [RPMI 1640 (Sigma) supplemented with 12 mM HEPES (pH 7.1), 0.05 mM 2,b-mercaptoethanol, 100 u/mL penicillin, 100 mg/mL streptomycin, and 10% Foetal Calf Serum (FCS, Sigma)]. Cell numbers were counted with a haemocytometer by trypan blue dye exclusion technique. 2.3.2. Cell proliferation assay The splenocyte proliferation assay was performed by MTT assay. Briefly, splenocytes were seeded in 96-well flat-bottom microtiter plate (Nunc Roskilde, Denmark) at 2 106 cells/mL in 100 mL complete medium. For T-cell proliferation, concanavalin A (Con A, Sigma) was added at a final concentration of 0.5 mg/mL. For B cell proliferation, lipopolysaccharide (LPS, Sigma) was added at a final concentration of 1 mg/mL. Varying concentrations of piperine (1 and 10 mg/mL) were added to each well in triplicates and the plates were incubated at 37 C in a humid atmosphere with 5% CO2. After 72 h, 50 mL of MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyl tetrazolium bromide) solution (5 mg/mL) was added to each well and incubated further for 4 h. Plates were centrifuged (1400 g, for 5 min) and the untransformed MTT was decanted and formazan crystal of MTT were dissolved by adding 200 mL of acidified DMSO (192 mL DMSO with 8 mL 1 N HCl) to each well, and the absorbance was recorded 570 nm (A(570)) using a microplate reader (Multiskan Spectrum; Thermo Electron, Vantaa, Finland). 2.3.3. Cytokine estimation by ELISA Splenocytes were seeded into 96-well flat-bottom microtiter plate at 2 106 cells/mL in complete medium. Cells were incubated with piperine (0.5, 1 and 10 mg/mL) for 72 h at 37 C in 5% CO2. The
2.4.2. Infection with M. tuberculosis M. tuberculosis (H37Rv) was grown by the culturing of bacteria from LowensteineJensen slant in Middlebrook 7H9 supplemented with 10% ADC medium on a rotary shaker for 10e15 days at 37 C. Infection with M. tuberculosis was administered by the intranasal route with 1 103 cfu/mL (protective efficacy) and 5 105 cfu/mL (in combination study with rifampicin) in a 20 mL volume per mouse [10]. 2.4.3. Protective efficacy studies In this study, piperine was evaluated at 1.0 and 10 mg/kg of oral dose. Piperine was solubilized in minimal volume of ethanol and formulated in 50% polyethylene glycol-400 (PEG-400, Qualigens, India) in sterile distilled water. Final concentration of ethanol in formulation did not exceed 0.5% v/v. Piperine doses were administered orally (gavage daily) eight weeks prior to infection and were continued for next eight weeks post infection. The control infected group was treated with placebo. A group of mice, which was uninfected and untreated, was included throughout the experiment to obtain baseline information for Lymphocyte immunophenotyping, Intracellular cytokines estimation and cytokines expression studies. Schematic layout of these studies is explained in Figure 1. a Lymphocyte immunophenotyping: FITC-labelled anti-mouse CD4 and PE-labelled CD8 monoclonal antibodies were used to determine the percentage of CD4þ and CD8þ T cells in the control and treated groups of animals as described earlier (BD Biosciences, USA) [24]. Blood samples were collected from the retro orbital plexus of mice from all the groups after the completion of piperine treatment. FITC-labelled CD4 and PElabelled CD8 monoclonal antibodies were directly added to 100 mL of whole blood. Tubes were incubated in the dark for 30 min at room temperature. Subsequently, 1 X FACS lysing solution (BD Biosciences, USA) was added at room temperature with gentle mixing followed by incubation for 10 min. The samples were centrifuged at 300e400 g. Supernatant was
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 3/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
3
d qRT-PCR analysis: The right lung of the mouse was homogenized in equal volume of TRIZOL reagent (Invitrogen, CA, USA). Total RNA was extracted in accordance with the manufacturer’s instructions. The RNA was finally dissolved in DNase and RNase free water. In order to remove the genomic DNA contamination, RNA samples were treated with RNase-free DNase I according to manufacturer’s recommendations (Ambion, Austin, TX). The real time reactions were performed in the Light Cycler 1.5 (Roche, Mannheim, Germany) using one-step RT-PCR in a total reaction volume of 20 mL. All the primer sets used in this study are listed in Table 1. These primers were designed by using PRIMER 3 software [25] and purchased from Sigma (St. Louis, MO) [1]. The RT-PCR reaction mix comprised of 10 pmol of each primer, 4 mL of one-step RT-PCR reaction mix containing SYBR green I, 3 mM MgCl2, 0.4 mL of Light Cycler RT-PCR Enzyme Mix, (Roche) and the 4 mL extracted RNA (600e800 ng). The real-time PCR run protocol consisted of: reverse transcription at 55 C for 10 min, followed by PCR activation at 95 C for 30 s and 45 cycles of amplification (10 s at 95 C; 20 s at 60 C; 25 s at 72 C). Fluorescence was measured during the annealing step and plotted against the amplification cycles. We normalized gene copy numbers against copies of b-actin gene, constitutively expressed in human tissue. The gene induction ratio was calculated by dividing the normalized target gene transcripts to control mRNA transcripts from bacteria surviving in lung. Each reaction was performed in triplicate and singularity of RT-PCR product was assessed using melting curve analysis.
Figure 1. Effect of piperine (PIP) on proliferation of T and B Lymphocytes e in vitro. Splenocytes isolated from the sacrificed mice stimulated with sub-optimal amount of mitogens; Con A (0.5 mg/L), LPS (1 mg/L) for T and B cell proliferation respectively. Cells were incubated with piperine (1 & 10 mg/L) for 72 h and proliferation was measured by MTT reduction assay. The proliferating effect of piperine was compared with the stimulated controls. Data was mean S.D. (n ¼ 8). P value, significantly different from control. *<0.05, **<0.01.
aspirated out and the pellets collected were washed thrice with PBS. The resulting stained cell pellets were resuspended in 500 mL of PBS and run on a flow cytometer (LSR, BD Biosciences). Analysis was done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences). b Intracellular cytokines estimation: Blood samples were collected in heparinised tubes from retro orbital plexus as mentioned above. FITC-labelled anti-mouse CD4þ monoclonal antibody and PE-labelled anti-mouse IFN-g were used in first set, FITClabelled anti-mouse CD4þ monoclonal antibody and PElabelled anti-mouse IL-2 were used in the second set and FITC-labelled anti-mouse CD4þ monoclonal antibody and PElabelled anti-mouse IL-4 were used in third set. Acquisition and analysis were done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences) [24]. c Viable CFU count: The left lung of the sacrificed mouse was aseptically removed and homogenized in 1 mL of sterile normal saline containing 0.05% v/v of Tween 80. Viable bacteria were quantified by plating 10-fold serial dilutions in duplicates on Middlebrook 7H10 agar supplemented with 10% OADC and incubated at 37 C in 5% CO2 for 4e6 weeks. Viable colony counts were expressed as log10 cfu per organ and were compared with untreated control groups. Early and late control group consisted of infected untreated mice sacrificed one week post infection and after completion of piperine treatment.
2.4.4. Combination efficacy of rifampicin and piperine The combination efficacy study was carried as described by Cynamon et al. [26] The BALB/c mice were infected as described above and each group consisted of eight mice. Untreated infected mice (early control) were sacrificed at the start of the treatment. Treatment started one week post infection and groups were treated daily with oral administration (gavage) of rifampicin 10 mg/kg and 20 mg/kg alone and in combination with piperine (10 mg/kg) for 4 and 8 weeks. Both piperine and rifampicin were formulated in 50% PEG-400 in water as mentioned above. Piperine (10 mg/kg) alone was included as control and compared with untreated infected mice (late control) at the end of the study. All mice were euthanized by CO2 inhalation. The lungs from the early control group and from each treated group were aseptically removed and homogenized in 1 mL of sterile normal saline containing 0.05% v/v of Tween 80. Viable bacteria were quantified by plating 10-fold serial dilutions in duplicate on Middlebrook 7H10 agar supplemented with 10% OADC and incubated at 37 C in 5% CO2 for 4e6 weeks. Viable colony counts were expressed as log10 cfu per organ. 2.4.5. Statistical analysis Two tailed student’s t test was used to analyse the differences between each treatment group and was considered significant at Table 1 List of primer for expression study using RT-PCR. Cytokine and primer
Sequence (50 e30 )
Product size (base pairs)
IL-4
F: CTCCTATCACTGACGGT R: ATTCACATTGCAGCTCT F: CACCCACTTCAAGCTCT R: TCCACCACAGTTACTGTC F: GACAACCAGGCCATCC R: CAAAACAGCACCGACT F: CAAAAGCCACCCCCACTCCTAAGA R: GCCCTGGCTGCCTCAACACCT C
342
IL-2 IFN-g
b-actin
349 226 258
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 4/8
4
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
Figure 2. Influence of piperine (PIP) on expression of cytokines in mouse splenocytes in vitro Splenic lymphocytes isolated from BALB/c mice were grown in 24 well culture plates (2 106 cells/mL) in RPMI-FBS (10%). Cells were co-incubated with 0.5 mg/L Con A and different concentration of PIP (1e10 mg/L) for 72 h. The cytokines (A); IFN-g, (B) IL-2, (C) IL-4 were assayed by ELISA. (D) in vitro effect of piperine on NO production in peritoneal macrophages. Cells were co-incubated with 1 mg/L LPS and different concentration of PIP (1e 10 mg/L) for 48 h. The effect of piperine on cytokines and NO production was compared with the stimulated controls. The results were prepared as Mean S.D. of three independent experiments. P value *<0.05 **<0.01.
P < 0.05. Data are represented as means; error bars indicate standard deviations from the means. 3. Results 3.1. In vitro study 3.1.1. Potent lymphoproliferation induced by piperine The proliferative effect of piperine was studied on lymphocytes isolated from mouse spleen. Piperine elicited a significant increase in proliferative response (P < 0.01) in the Con A stimulated T lymphocytes. The increase in proliferation was observed in a concentration dependent manner with optimal effect up to 1 mg/mL. However at higher concentration i.e. 10 mg/mL, reduced proliferation was observed, which could be due to mild cytotoxic effect of piperine. Piperine at this concentration exhibited w20% cytotoxic effect on mouse splenocytes as estimated by MTT assay (data no shown). Similar effect was observed on LPS primed B cells proliferation (P < 0.01) while the relative effect was more apparent on T cells (Figure 1A and B). Cells grown in the absence of mitogens did not show any proliferation. 3.1.2. Enhance production of Th-1 Cytokines in piperine treated lymphocytes Piperine showed a significant dose dependent up-regulation of Th-1 cytokines (IFN-g and IL-2) as compared to sensitized control (P < 0.01). Piperine at 1.0 and 10 mg/mL showed an up-regulation of IFN-g and IL-2 production with respect to control as shown in Figure 2A and B. The maximum immunomodulatory effect was
observed at 10 mg/mL (P < 0.05). There was no increase in the production of IL-4, a Th-2 cytokine (Figure 2C). 3.1.3. Nitric oxide production by piperine treated peritoneal macrophages The macrophages were primed with LPS (1 mg/mL) and incubated with different concentrations of piperine. Piperine at 1 mg/mL caused a significant increase in the production of nitric oxide (NO) in the supernatant, while its influence was of lesser magnitude at higher concentration of 10 mg/mL perhaps due to the mild cytotoxic effect of piperine as mentioned above (Figure 2D). 3.2. Protective efficacy of piperine a Modulation of Th-1 cytokines in the lymphocytes of piperine treated mice: In this experiment mice were administrated prophylactic doses of piperine at 1.0 mg/kg and 10 mg/kg body weight for eight weeks prior to the infection of M. tuberculosis followed by further eight weeks administration of piperine. The T-cell lymphocytes were analysed by flow cytometry for the production of Th-1 cytokines. The Th-1 cytokines (IFN-g and IL2) expressing population of cells were estimated on the CD4 subtypes of these T-cell lymphocytes. Piperine elicited increased production of IFN-g and IL-2 cytokines at 1.0 and 10.0 mg/kg body weight doses when compared with untreated (infected) group of mice. The maximum effect was observed at 10 mg/kg (Figure 3A and B). There was no stimulation observed in the expression of IL-4 at given concentration (Figure 3C). b Analysis of lymphocyte sub-populations: Piperine treated mice exhibited significant increase in the population of CD4þ/CD8þ
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 5/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
(P < 0.01) subsets at the dose of 10 mg/kg body weight as compared to untreated infected control group (Figure 3D). c Effect of piperine on viable CFU count: During prophylactic study, after 8 weeks of infection there was 2 log10 increases in cfu/lung in untreated mice (late control) with respect to early control. Piperine at 1.0 mg/kg dose did not exhibit any protective efficacy as evident from the cfu load; however at 10 mg/kg some protective efficacy was observed which did not allow the infection to proliferate as evident from the cfu load in this group when compared with early control (Figure 3E). d Effect of piperine on cytokines expression: Normalized relative expression ratio of cytokines (IFN-g, IL-2, and IL-4) in mice administered with piperine 1.0 mg/kg and 10 mg/kg of body weight was compared with control (untreated) mice. Relative expression of mRNA transcripts of cytokines was calculated on the basis of PCR efficiency and cycle threshold (Ct), where expression was normalized using b-actin as housekeeping gene. Expression of IFN-g and IL-2 was up-regulated significantly (upto two fold increase) in mice treated with piperine 10 mg/kg of body weight, as compared with untreated mice (Figure 4A and B). No significant effect on IL-4 mRNA expression was observed in mice of all the groups, with the values similar to the comparator (Figure 4C).
5
3.2.1. Combination study of piperine and rifampicin in murine model of M. tuberculosis The prophylactic treatment of piperine (10 mg/kg) in the above mentioned murine model of M. tuberculosis resulted in the polarization of lymphocytes to Th-1 immunity. These findings prompted us to test piperine in combination with rifampicin. The study was carried out for 4e8 weeks. Piperine alone at 10 mg/kg did not exhibit protective efficacy as evident from the cfu load in this group when compared with early control (Figure 5), probably because of higher inoculums (5 105 cfu/mL) used in this study as compared with 1 103 cfu/mL in the protective efficacy studies. However, the same dose of piperine in combination with rifampicin (10 mg/kg) significantly improved the therapeutic effect of rifampicin and resulted in additional 1.4e0.8 log reduction in bacterial load in the lungs at 4e8 weeks compared to rifampicin alone. The effect of piperine was more pronounced with higher dose of rifampicin (20 mg/kg) where the cfu/lung reached below detection limits in 4 weeks itself (same effect exhibited by rifampicin in 8 weeks) (Figure 5). 4. Discussion Piperine is endowed with numerous pharmacological activities but the most important being the enhancement of bioavailability
Figure 3. Influence of piperine (PIP) on expression of cytokines in mouse (n ¼ 8) in vivo by flow cytometry Blood from retro orbital plexus in EDTA coated tube from BALB/c mice were taken and acquisition and analysis were done directly on a flow cytometer using Cell Quest Pro software (BD Biosciences). The results were compared with untreated (infected) controls. The cytokines (A); IFN-g, (B) IL-2, (C) IL-4, (D) %-T-cells (E) cfu/lung. The results were prepared as Mean S.D. of three independent experiments. P value *<0.05 **<0.01.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 6/8
6
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
Figure 4. Relative mRNA expression levels of IFN-g (A), IL-2 (B), IL-4 (C), in mice lung (n ¼ 8) treated with piperine (PIP) at 0.5 mg/kg and 1 mg/kg. Treatment was started two months before infection and continued for next two month after infection. Results were expressed as differences between Ct values of test and comparator samples. b-actin, a housekeeping gene was used for normalization. The samples were analysed in triplicates and the mean values were taken with respective Standard deviation. P value *<0.05 **<0.01.
[11,12] inhibition of cytochrome P450 as well as mammalian pglycoprotein [16]. On the basis of above mentioned pharmacological actions of piperine Indian Institute of Integrative Medicine, Jammu has developed an anti-TB formulation called ‘Risorine’, being marketed in India by Cadila Pharmaceutical Ltd. It contains rifampicin (200 mg), isoniazid (300 mg) and piperine (10 mg)
which is found to be bioequivalent with commercially available rifampicin (450 mg) preparations [17]. The objective of this study was to investigate in-detail the immunomodulatory effect of piperine and its protective effect on mice infected with M. tuberculosis. The in-vitro studies revealed that piperine augmented the immune responses to T-dependent antigen. This is
Figure 5. Each group consisted of 8 mice. Treatment was started 1 week after mice received w5 105 viable M. tuberculosis H37Rv through intranasal route. The drugs were evaluated at the following doses: RIF, 10 mg/kg; RIF, 20 mg/kg; PIP, 10 mg/kg; PIP, 1 mg/kg. RIF, RIF/PIP and PIP treated groups were compared with early control for 2 log10 reduction in cfu. Late control represented the untreated group at the end of the treatment period. The samples were analysed in triplicates and the mean values were taken with respective Standard deviation. P value *<0.05 **<0.01.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YTUBE1184_proof ■ 9 May 2014 ■ 7/8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
evidenced from increased T and B cell proliferation, supported by selective Th-1 type immunity and enhanced macrophage activation thereby stimulating cell-mediated immunity. The immunomodulatory and anti-cancer properties of piperine have been reported earlier in tumour bearing mice. In this study the immunomodulatory potential of piperine was measured through increase in bone marrow cellularity, increased antibody titre and increased plaque forming cells in spleen [13]. In an another study, Pathak and Khandelwal (2007) reported the proliferating effect of piperine on the splenocytes comprising of both B and T cells, resulting in the complete abrogation of the influence of cadmium and leading to restoration of B and cell population [18]. Piperine at a dose of 10 mg/kg in mice infected with M. tuberculosis, appeared to activate and differentiate T cells into a Th-1 sub-population as evident from the increased population of CD4þ/CD8þ lymphocyte sub-population. There was also an increase in the secretion of Th-1 cytokines such as IFN-g and IL-2 by these cells. However, there was no effect on Th-2 cytokines such as IL-4. The Th-1 cytokines are associated with the generation of cellmediated immunity and resistance to intracellular parasites, whereas Th-2 cytokines favour the induction of humoral immunity and resistance to extracellular parasites [19,16]. IL-2 stimulates NKcell proliferation and activation for the production of IFN-g [20]. IFN-g is responsible for recruiting macrophages into the inflammatory site and promotes phagocytic activity. The protective role of IFN-g in M. tuberculosis or Mycobacterium leprae infection is well established and it has been effectively demonstrated that IFN-g knockout mice are more susceptible to M. tuberculosis [21e23]. Probably due to this Th-1 cytokines mediated protection by piperine, the proliferation of infection was controlled and there was no increase in bacterial cfu load (Figure 3E). The increase in the level of Th-1 cytokines was related to the corresponding increase in the mRNA transcripts of IFN-g and IL-2 (with no increase in IL-4 mRNA transcript) in the lung tissues of the infected mice. In order to investigate whether the Th-1 up-regulatory effect of piperine can synergistically affect the therapeutic outcome of rifampicin treatment, we treated the M. tuberculosis infected mice with a combination of piperine and rifampicin. We found that there was marked improvement in the therapeutic outcome of rifampicin (10 mg/kg) when combined with piperine at (10 mg/kg). The most important finding of this study was that the combination of higher dose of rifampicin (20 mg/kg) and piperine reduced the bacterial load in lungs below the detection limit within 4 weeks, whereas rifampicin alone at the same dose could achieve it in 8 weeks (Figure 5). The multicentric clinical trials conducted across India in patients with radiologically confirmed diagnosis of pulmonary tuberculosis revealed that more than 90% of the patients treated with risorine were cured of tuberculosis with lesser side effects owing to the reduced dose of rifampicin [17]. We hypothesize that one of the possible reasons for this better therapeutic outcome of this formulation could be the selective augmentation of Th-1 response by piperine is taking place in these patients as observed in mice in our study. It is therefore warranted that the post marketing studies on risorine formulation should address the immunomodulatory potential of piperine as contributor to clinical outcome of this formulation. Acknowledgements We are thankful to Dr. M. H. Cynamon, VAMC, Syracuse, NY for critical evaluation of manuscript. S.S., M.K., A.B.R. are grateful to the Q4,511Council of Scientific and Industrial Research, New Delhi, India for Q6 providing Senior Research Fellowship.
7
Funding: This work was supported by Council of Scientific and Industrial Research (CSIR), New Delhi. Competing interests: Ethical approval:
None declared. Not required.
Transparency declarations:
None to declare.
References [1] Quiroga MF, Jurado JO, Martinez GJ, Pasquienelli V, Musella RM, Abbate E, Issekutz AC, Bracco MM, Malbran A, Sieling PA, Chuluyan E, García VE. Crosstalk between CD31 and the signaling lymphocytic activation moleculeassociated protein during interferon-gamma production against Mycobacterium tuberculosis. J Infect Dis 2007;196:1369e78. [2] Nathan C, Shiloh MU. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc Natl Acad Sci U S A 2000;97:8841e8. [3] World Health Organization Report. Anti-tuberculosis drug resistance in the world e the fourth global report. The WHO/IUATLD Global Project on Anti-tuberculosis Drug Resistance Surveillance 2002e2007. WHO/HTM/TB/2008; 394. [4] Styblo K. Epidemiology of tuberculosisIn Selected papers of the Royal Netherlands Tuberculosis Association, 24. The Hague, The Netherlands: KNCV Tuberculosis Foundation Press; 1991. [5] Hahn H, Kaufmann SH. The role of cell-mediated immunity in bacterial infections. Rev Infect Dis 1981;3:1221e50. [6] Holten-Andersen L, Doherty TM, Korsholm KS, Andersen P. Combination of the cationic surfactant dimethyl dioctadecyl ammonium bromide and synthetic mycobacterial cord factor as an efficient adjuvant for tuberculosis subunit vaccines. Infect Immun 2004;72:1608e17. [7] Mackaness GB. The immunology of antituberculous immunity. Am Rev Respir Dis 1968;97:337e44. [8] Malik F, Singh J, Khajuria A, Suri KA, Satti NK, Singh S, Kaul MK, Kumar A, Bhatia A, Qazi GN. A standardized root extract of Withania somnifera and its major constituent withanolide-A elicit humoral and cell-mediated immune responses by up regulation of Th1-dominant polarization in BALB/c mice. Life Sci 2007;80:1525e38. [9] Kapoor LD. Handbook of ayurvedic medicinal plants. Boca Raton (Florida, USA): CRC Press; 2000. [10] Saunder BM, Cheers C. Inflammatory response following intranasal infection with Mycobacterium avium complex: role of T-cell subsets and gamma interferon. Infect Immun 1995;63:2282e7. [11] Atal CK, Dubey RK, Singh J. Biochemical basis of enhanced drug bioavailability by piperine: evidence that piperine is a potent inhibitor of drug metabolism. J Pharmacol Exp Ther 1985;232:258e62. [12] Atal CK, Zutshi U, Rao PG. Scientific evidence on the role of ayurvedic herbals on bioavailability of drugs. J Ethnopharmacol 1981;4:229e32. [13] Sunila ES, Kuttan G. Immunomodulatory and antitumor activity of Piper longum Linn. and piperine. J Ethnopharmacol 2004;90:339e46. [14] Khan IA, Mirza ZM, Kumar A, Verma V, Qazi GN. Piperine, a phytochemical potentiator of ciprofloxacin against Staphylococcus aureus. Antimicrobial Agents Chemother 2006;50:810e2. [15] Kumar A, Khan IA, Koul S, Koul JL, Taneja SC, Ali I, Ali F, Sharma S, Mirza ZM, Kumar M, Sangwan PL, Gupta P, Thota N, Qazi GN. Novel structural analogues of piperine as inhibitors of the NorA efflux pump of Staphylococcus aureus. J Antimicrob Chemother 2008;16:1270e6. [16] Singh J, Dubey RK, Atal CK. Piperine-mediated inhibition of glucuronidation activity in isolated epithelial cells of the guinea-pig small intestine: evidence that piperine lowers the endogenous UDP-glucuronic acid content. J Pharmacol Exp Ther 1986;236:488e93. [17] Chawla PC. Risorine e a novel CSIR drug curtails TB treatment. CSIR News 2010;60:52e4. [18] Pathak N, Khandelwal S. Cytoprotective and immunomodulating properties of piperine on murine splenocytes: an in vitro study. Eur J Pharmacol 2007;576: 160e70. [19] Mosmann T, Sad S. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol Today 1996;17:138e46. [20] He XS, Draghi M, Mahmood K, Holmes TH, Kemble GW, Dekker CL, Arvin AM, Parham P, Greenberg HB. T cell-dependent production of IFNgamma by NK cells in response to influenza A virus. J Clin Invest 2004;114:1812e9. [21] Condos RW, Rom N, Schluger NW. Treatment of multidrug resistant pulmonary TB with interferon-g via aerosol. Lancet 1997;24:1513e5. [22] Kaplan G, Mathur NK, Job CK, Nath I, Cohn ZA. Effect of multiple interferon gamma injections on the disposal of M. leprae. Proc Natl Acad Sci U S A 1989;86:8073e7.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
Q7
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5
YTUBE1184_proof ■ 9 May 2014 ■ 8/8
8
S. Sharma et al. / Tuberculosis xxx (2014) 1e8
[23] Xing Z, Zganiacz A, Wang J, Sharma SK. Enhanced protection against fatal mycobacterial infection in SCID beige mice by reshaping innate immunity with IFN-g transgene. J Immunol 2001;167:375e83. [24] Pandey A, Bani S, Dutt P, Suri KA. Modulation of Th1/Th2 cytokines and inflammatory mediators by hydroxychavicol in adjuvant induced arthritic tissues. Cytokines 2010;49(1):114e21.
[25] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365e86. [26] Cynamon MM, Sklaney R, Shoen C. Gatifloxacin in combination with rifampicin in a murine tuberculosis model. J Antimicrob Chemother 2007;60:429e 32.
Please cite this article in press as: Sharma S, et al., Protective efficacy of piperine against Mycobacterium tuberculosis, Tuberculosis (2014), http:// dx.doi.org/10.1016/j.tube.2014.04.007
6 7 8 9 10