Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation and its suppression promotes osteogenesis in vitro

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation and its suppression promotes osteogenesis in vitro☆ Hisashi Ideno a,c , Rieko Takanabe a , Akemi Shimada b , Kazuhiko Imaizumi c , Ryoko Araki a , Masumi Abe a , Akira Nifuji a,b,⁎ a

Transcriptome Research Group, National Institute of Radiological Sciences, Chiba, Japan Department of Pharmacology, Tsurumi University School of Dental Medicine, Kanagawa, Japan c Laboratory of Physiological Sciences, Graduate School of Human Sciences, Waseda University, Saitama, Japan b

A R T I C L E I N F O R M AT I O N

AB ST R AC T

Article Chronology:

Protein related to DAN and cerberus (PRDC) is a secreted protein characterized by a cysteine knot

Received 9 July 2008

structure, which binds bone morphogenetic proteins (BMPs) and thereby inhibits their binding to

Revised version received

BMP receptors. As an extracellular BMP antagonist, PRDC may play critical roles in osteogenesis;

18 November 2008

however, its expression and function in osteoblastic differentiation have not been determined.

Accepted 23 November 2008

Here, we investigated whether PRDC is expressed in osteoblasts and whether it regulates

Available online 6 December 2008

osteogenesis in vitro. PRDC mRNA was found to be expressed in the pre-osteoblasts of embryonic day 18.5 (E18.5) mouse calvariae. PRDC mRNA expression was elevated by treatment with BMP-2 in

Keywords:

osteoblastic cells isolated from E18.5 calvariae (pOB cells). Forced expression of PRDC using

BMP

adenovirus did not affect cell numbers, whereas it suppressed exogenous BMP activity and

Antagonist

endogenous levels of phosphorylated Smad1/5/8 protein. Furthermore, PRDC inhibited the

Osteoblast

expression of bone marker genes and bone-like mineralized matrix deposition in pOB cells. In

Differentiation

contrast, the reduction of PRDC expression by siRNA elevated alkaline phosphatase activity,

Bone formation

increased endogenous levels of phosphorylated Smad1/5/8 protein, and promoted bone-like mineralized matrix deposition in pOB cells. These results suggest that PRDC expression in osteoblasts suppresses differentiation and that reduction of PRDC expression promotes osteogenesis in vitro. PRDC is accordingly identified as a potential novel therapeutic target for the regulation of bone formation. © 2008 Elsevier Inc. All rights reserved.

☆

PRDC suppresses osteoblastic differentiation. ⁎ Corresponding author. Department of Pharmacology, Tsurumi University School of Dental Medicine, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama-city, Kanagawa 230-8501, Japan. Fax: +81 45 573 9599. E-mail address: [email protected] (A. Nifuji). Abbreviations: PRDC, Protein related to Dan and Cerberus; BMP, Bone morphogenetic protein; ALP, Alkaline phosphatase; OC, Osteocalcin; OPN, Osteopontin; SIRNA, Small interfering RNA; AA, Ascorbic acid; β-GP, β-Glycerophosphate 0014-4827/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2008.11.019

EX P ER I ME NTAL CE LL RE S E ARCH 315 (2 0 0 9 ) 474– 4 8 4

Introduction Bone morphogenetic proteins (BMPs) were originally identified by their capacity to induce endochondral bone formation [1]. Subsequently, BMPs have come to be recognized as signaling molecules, locally acting not only in skeletal tissue but also in extraskeletal tissues to regulate cell proliferation, differentiation, and apoptosis [2–5]. BMP ligands transduce their signals by binding to type I and type II serine/threonine kinase BMP receptors, which is followed by phosphorylation of intracellular Smad proteins [6,7]. Phosphorylated Smads dissociate from the receptor, heterodimerize with Smad4, and translocate to the nucleus where they activate transcription from target promoters [8,9]. BMP activity is tightly regulated by ligand availability, receptor activation, and intracellular signaling [10–12]. BMP ligand activities are modulated by extracellular BMP antagonists, which compete with the BMP receptors for binding to BMP ligands [13]. Extracellular BMP antagonists include noggin, the DAN family, the chordin family, and Twisted gastrulation (Tsg), all of which are characterized by a conserved structural motif referred to as a cysteine knot [14,15]. These antagonists differ in their capacity to bind BMP ligands and exhibit specific temporal and spatial expression patterns, which determine their differential functions. The expression of BMP antagonists is often induced by BMP ligands, and the combination of BMP ligands and their antagonists determine the net level of BMP activity [13]. Extracellular BMP antagonists are expressed and functional in skeletal tissues. The BMP antagonist noggin is expressed in skeletal cells, and the overexpression of this antagonist blocks skeletal cell differentiation, whereas noggin suppression enhances their differentiation [16–18]. Noggin null mice exhibit severe multiple skeletal defects, particularly in cartilage [19]. The critical roles of the noggin gene in skeletogenesis have been confirmed by human studies in which noggin mutations led to multiple synostosis [20]. The DAN family is a family of proteins structurally and functionally related to differential screening-selected gene aberrative in neuroblastoma (DAN) [21]. Members of the DAN family are structurally characterized by the same eight-cysteine carboxyterminal ring domain [13]. The DAN family consists of nine members: sclerostin, gremlin, DAN, USAG-1, cerberus, caronte, coco, Dante, and protein related to DAN and cerberus (PRDC) [22–27]. All members are capable of binding to BMPs. The DAN family members play pivotal roles in skeletogenesis. One member, gremlin, is expressed in calvarial osteoblasts and inhibits the stimulatory effects of BMP-2 on the proliferation and differentiation of osteoblasts [28]. Conditional deletion of gremlin using bonespecific osteocalcin promoter-cre causes enhanced osteoblastic activity and increased trabecular bone volume [29]. In addition to regulating BMPs, some members are also involved in the regulation of Wnts, which are important signaling molecules. Sclerostin suppresses osteoblastic differentiation through the inhibition of Wnts rather than BMP signals [30,31]. The Wnt signals regulate bone mass through LRP5/6 co-receptors, and sclerostin binds to these co-receptors, thereby antagonizing Wnt/β-catenin signaling. Therefore, although sclerostin binds to BMP-6 and -7 and inhibits their activity, its major function in skeletogenesis may be the blockade of wnt signaling [23,30,31]. A further member of the DAN family, PRDC, was originally identified in embryonic stem (ES) cells by gene trapping [32]. PRDC

475

is a secreted protein and its transcripts are expressed in ovary, spleen, and brain [33]. PRDC binds to BMP-2 and BMP-4 and blocks BMP-responsive promoter activity [33]. As an extracellular BMP antagonist, PRDC may play critical roles in skeletogenesis; however, its expression and function in osteoblastic differentiation have not been determined. Here, we report that PRDC mRNA is expressed in vitro and in vivo in osteoblasts, and that PRDC expression is induced by BMP-2 in primary osteoblasts. Forced expression of PRDC in osteoblasts blocked osteoblastic differentiation, whereas a reduction in PRDC expression mediated by small interfering RNA (siRNA) promoted osteogenesis in vitro. Our data suggest that PRDC is a negative feedback regulator of BMP signals and plays important roles in osteogenesis.

Experimental procedures Experimental animals Embryos were collected from mating ICR outbred mice. The Animal Ethics Committee of the National Institute of Radiological Sciences approved all animal experimental designs and procedures.

In situ hybridization In situ hybridization (ISH) on sagittal sections of embryonic day 18.5 (E18.5) feral calvaria was conducted as described previously [18].

Culture of osteoblastic cells Sequential enzymatic digestions from calvariae of E18.5 embryos using 2 mg/ml collagenase type II and 0.25% trypsin were used to isolate fetal calvarial osteoblasts. Three sequential digestions were conducted for 5, 15, and 25 min at 37 °C. Fractions of the cells obtained from the second and third digestions were collected. The cells were then plated at 1 × 104 cells/cm2 in alpha minimal essential medium (alpha-MEM) supplemented with 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO2 and 95% air. To induce osteoblastic differentiation in fetal calvarial osteoblasts, the medium was changed to fresh medium containing 50 μg/ml ascorbic acid (AA) and 10 mM β-glycerophosphate (β GP) after cells had reached sub-confluency (day 0). Subsequently, the cells were incubated for the indicated period of time with a change of medium every 3 d.

Reverse transcription (RT) and RT-PCR A mixture of total RNA (1 μg), oligo(dT), and dNTPs (Invitrogen, Carlsbad, CA) was incubated at 65 °C for 5 min. Annealing was conducted by leaving the mixture on ice for 1 min. The annealed product was then subjected to reverse transcription using 200 U of SuperScript III (Invitrogen) according to the manufacturer's instructions. Reverse transcription was conducted in a solution containing 5× first-strand synthesis buffer [0.1 M DDT, 10 mM NTP mixture, and 40 U RNase inhibitor (Promega, Madison,WI)]. The reaction mixture was incubated at 50 °C for 60 min to allow the reverse transcription reaction to proceed, followed by incubation at 85 °C for 15 min to stop the reaction. After cDNA synthesis, PCR reactions were performed using 10 ng of cDNA template, 625 nM each of forward and reverse primers, and

476

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

Table 1 – Primers for real-time PCR experiments Accession number GAPDH PRDC ALP Runx2 Osteocalcin

M32599 NM_01182 J02980 NM_009820 L24431

Forward primer for real time-PCR GCCAAACGGGTCATCATCTC CAAGGATGGTAGCAGCAACA GATAACGAGATGCCACCAGA TTCCAGACCAGCAGCACTCC CAAGCAGGAGGGCAATAAGG

Reverse primer for real time-PCR GTCATGAGCCCTTCCACAAT TAGCAGAAGCGGTTGAGGAT AATGCTTGTGTCTGGGTTTA CTTCCGTCAGCGTCAACACC CCGTAGATGCGTTTGTAGGC

Accession number and primer sequences used for real-time PCR experiment.

1× SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in 25 μl. Samples were amplified for 50 cycles using an ABI Prism 7700 Sequence Detection System (Applied Biosystems), with an initial denaturation at 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s, 60 °C for 30 s, and 78 °C for 40 s. PCR product accumulation was monitored at multiple points during each cycle by measuring the increase in fluorescence caused by the binding of SYBR Green I to double-stranded DNA. Post-amplification dissociation curves were constructed to confirm that a single PCR product was produced in each reaction. The relative amounts of transcripts were calculated and normalized by dividing the value for the gene by that for GAPDH. At least three independent experiments from cell culture to PCR were performed and each PCR was performed three times. The accession numbers and primer sequences used in each PCR experiment are summarized in Table 1.

Construction of recombinant adenovirus expressing PRDC, GFP or LacZ Mouse PRDC cDNA was amplified by PCR with KOD plus DNA polymerase using the forward primer 5′-ATGTTCTGGAAGCTCTCGCT-3′ and the reverse primer 5′-TCACTGCTTGTCGGAGTCAC-3′. The PRDC cDNA was inserted into a XhoI site downstream of the CAG promoter in the pCAGGS vector. A Sall–PstI fragment of CAG-PRDC was subcloned in the pENTR4 vector (Invitrogen). For construction of Ad/GFP,

IRES-EGFP cassette was cloned into the EcoRI (Klenow-filled) site of pCAGGS. The resulting vector, pCAGGS-IRES-EGFP, was cloned into the pENTR4 vector (Invitrogen). Then the pENTR4-CAG-PRDC-IRESEGFP or pENTR4-CAG-IRES-EGFP was subcloned into pAd/PL-DEST by a site-specific recombination. The production of adenovirus was performed according to the manufacturer's protocol (ViraPower Adenoviral Expression System; Invitrogen). The production of Ad/LacZ was conducted as described [17].

Cell counts The cells were seeded at 1 × 104 cells/cm2 in 24-well plates. After 24 h, the cells were infected with adenovirus expression vector for GFP or PRDC at a multiplicity of infection of 50 for 3 h. At 1, 2, 3, and 4 d after adenovirus infection, the cells were harvested using trypsin-EDTA for 5 min at 37 °C, suspended in alpha-MEM containing 10% FBS plus 50% EtOH, and counted using a Z1 Coulter Particle Counter (Beckman Coulter, Miami, FL).

Alkaline phosphatase activity assay At the indicated time points, the cells were rinsed twice with 0.9% NaCl and scraped into a buffer containing 10 mM Tris-HCl, 2 mM MgCl2, and 0.05% Triton X-100, pH 8.2. The cell lysates were briefly sonicated on ice after two cycles of freezing and thawing. The

Fig. 1 – PRDC mRNA is expressed in pre-osteoblasts in vivo. In situ hybridization was performed on sagittal section of E18.5 mouse calvaria using cRNA probes for PRDC anti-sense (PRDC-AS) (A, C), PRDC sense (PRDC-S) (B) osteocalcin (OC) (D), and osteopontin (OPN) (E). Arrows indicate PRDC-expressing cells residing in the uppermost layer of the periosteum of fetal calvaria (C). Arrowheads in (A) indicate PRDC-expressing cells in the epidermal region, whereas those in (C) indicate a few PRDC-expressing cells observed in the osteoblastic cell layer. (C) is a higher magnification of the boxed area shown in (A). (D) and (E) are sections adjacent to (C). bar = 50 μm.

EX P ER I ME NTAL CE LL RE S E ARCH 315 (2 0 0 9 ) 474– 4 8 4

477

Fig. 2 – PRDC mRNA is expressed in the early stage of osteogenesis. Primary osteoblastic cells isolated from E18.5 calvariae (pOB cells) were cultured in differentiation medium containing ascorbic acid (AA) and β-glycerophosphate (β GP) after cells had reached sub-confluency (day 0). RNA was extracted at each indicated time point up to day 21 and was subjected to real-time PCR as described in the Experimental procedures. The primers used were those for Protein Related to DAN and cerberus (PRDC), osteocalcin (OC), osteopontin (OPN), and alkaline phosphatase (ALP). The results of a representative experiment are shown; similar results were obtained in independent experiments from five different mice.

lysates were then mixed with an aliquot of assay mixture containing 2.2 mM p-nitrophenyl phosphate in 0.1 M 2-amino-2-methyl-1propanol and 2.2 mM MgCl2, pH 10.5. The mixtures were incubated at 37 °C and the amount of p-nitrophenol produced by the reaction was measured spectrophotometerically at 415 nm using a SpectraMax Plus microplate reader (Molecular Devices Corporation, Sunnyvale, CA). Protein contents in the lysates were determined according to the Coomassie blue G method. The protein levels were determined from measurements of light absorption at 595 nm.

Western blot analysis The cells were washed in ice-cold phosphate-buffered saline (PBS) and solubilized in lysis buffer (1% NP-40, 20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.5 mM phenylmethylsulfonyl fluoride) containing

Alizarin red and von Kossa staining After 19 or 21 d of culture, the cells were fixed with 0.2% glutaraldehyde for 15 min and washed once with water. For alizarin red staining, the cells were stained with 1% alizarin red solution for 20 min followed by several rinses with water. For von Kossa staining, the cells were serially dehydrated in 70% and 100% EtOH and then air dried. The plates were then rehydrated with water. A 2% silver nitrate solution was added and the plates were exposed to sunlight for 60 min. The plates were then rinsed with water, and sodium thiosulfate (5%) was added for 3 min. After staining, photos for the stained mineralized nodules were taken from different fields using a stereoscopic microscope (WILD M10, Leica). Images were analyzed using image-analysis software (Lumina Vision, Mitani Co, Fukui, Japan). Nodules positive area was defined as the number of pixels in a field that meet a user-defined color threshold of staining. Average of the pixels from four different fields was shown.

Fig. 3 – BMP-2 increases PRDC mRNA expression in primary osteoblasts. pOB cells were grown to sub-confluency and the medium was changed to a fresh one containing 100 ng/ml of recombinant human BMP-2. RNA was extracted at 12 h after the change of medium and was subjected to real-time PCR using primers specific for PRDC. Data are representative of three repeat experiments. Asterisk indicates P < 0.05.

478

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

1×PhosSTOP (Roche Diagnostics, Indianapolis, IN) at 4 °C for 30 min. The solubilized proteins were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and electrotransferred to polyvinylidene difluoride membranes (PALL, Ann Arbor, MI). Blocking of blots was performed by incubating membranes in TBS/0.05% Tween 20/5% skim milk overnight at 4 °C. Primary antibodies [rabbit anti-phospho-Smad1 (Ser463/465)/Smad5 (Ser463/465)/Smad8 (Ser426/428) (Cell Signaling Technology, Beverly, MA), rabbit anti-GFP (Rockland, Gilbertsville, PA) and mouse anti-actin (Sigma, St Louis, MO)] were used at a dilution of 1:2000 and hybridized to membranes in TBS/0.05% Tween 20/5% skim milk at 4 °C overnight. Secondary antibodies [horseradish peroxidase-conjugated goat anti-rabbit IgG (Southern Biotech, Birmingham, AL) and horseradish peroxidase-conjugated goat anti-mouse IgG (Pierce Biotechnology Inc, Rockford, IL)] were used at a dilution of 1:5000 and hybridized to membranes at room temperature for 1 h. Immunoreactive bands were detected by chemiluminescence using West Dura Extended Duration substrate (Pierce Biotechnology Inc). Quantification of each band was performed using Densitograph software (ATTO, Tokyo, Japan).

Statistical evaluation Statistical significance was determined using an unpaired Student's t-test. A value of p < 0.05 was considered to be statistically significant.

Results PRDC mRNA is expressed in osteoblasts and is induced by BMP-2 In situ hybridization analyses were performed in order to examine whether PRDC mRNA is expressed in osteoblasts during in vivo skeletogenesis. PRDC mRNA expression was localized mostly to cells in the uppermost layers of the periosteum of embryonic day 18.5 (E18.5) calvariae (arrows in Fig. 1C). A few PRDC-expressing cells were observed in the osteoblastic cell layer (arrowheads in Fig. 1C), where abundant expression of mature osteoblast markers, osteopontin (OPN) (Fig. 1D) or osteocalcin (OC) (Fig. 1E), was observed.

siRNA design and transfection For siRNA, we designed si oligo RNAs according to manufacturer's protocol (BLOCK -iT RNAi Designer tool; Invitrogen). We selected the following 3 siRNAs: siRNA1: 5′-CAGAGAGGTGGCATCACCAGATCAA-3′ siRNA2: 5′-GGCCAACAGTGTCCCTGTCACAAAT-3′ siRNA3: 5′-ACAACTCAGAGAGGTGGCATCACCA-3′ We checked the suppression efficiency of each siRNA against endogenous PRDC by real-time PCR and decided to use siRNA1 and siRNA2 based on their efficiency. For siRNA transfection, primary calvarial cells were seeded at 2 × 104 cells/cm2 for 30 min before transfection. The cells were transfected with mouse PRDC siRNAs or negative control siRNA (Invitrogen) at a final concentration of 10 nM in the presence of a HiPerFect transfection reagent (QIAGEN). The transfection efficiency of siRNA was checked using a fluorescein-labeled dsRNA oligomer (Block-iT Fluorescent Oligo; Invitrogen) one day later.

Promoter assays pOB cells were seeded at a density of 4 × 104 cells/well in a 12-well plate. Ten hours later, the cells were infected with Ad/GFP or Ad/ PRDC. After 24 h, the cells were then transfected in triplicate with the following plasmids: Super TOP-flash (25 ng) reporter plasmid, pRL luc reporter plasmid (10 ng), and mouse wnt1 or wnt3 expression plasmids (100 ng). All the plasmids were obtained from Addgene (Cambridge, Mass). Transfection was performed using FuGENE 6 transfection reagent (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's protocol. At 36 h after transfection, the cells were lysed with 200 μl of passive lysis buffer (Promega). The cell lysates were vortexed and briefly centrifuged to sediment the cell debris. A 20-μl aliquot of cell lysate was then assayed for luciferase activity using a Lumat LB9507 luminometer (Berthold, Bad Wildbad, Germany) and the Dual Luciferase Reporter (DLR) assay system (Promega), according to the supplier's recommendations. Each of the experiments was repeated at least three times.

Fig. 4 – Forced expression of PRDC blocks BMP signaling in primary osteoblasts. pOB cells infected with control (Ad/GFP) or PRDC-expressing adenoviruses (Ad/PRDC) at moi 50 were grown to sub-confluency and the medium was changed to a fresh one with or without 100 ng/ml of recombinant human BMP-2. The medium did not contain any other inducers. Measurement of ALP activity and western blot analysis were performed on day 7. For the western blot, the density of each pSmad1/5/8 protein band was normalized against that of actin and fold changes were calculated as the normalized value for each condition against the value in control condition (Ad/GFP infected, BMP (-)). Efficient infection by Ad/PRDC and Ad/GFP was verified using an anti-GFP antibody. Data are representative of three repeat experiments. Asterisk indicates P < 0.05.

EX P ER I ME NTAL CE LL RE S E ARCH 315 (2 0 0 9 ) 474– 4 8 4

479

Fig. 5 – Forced expression of PRDC inhibits osteoblastic differentiation. pOB cells infected with adenoviruses were grown to sub-confluency and the medium was changed to differentiation medium containing AA and β GP. (A) Total RNA was extracted at the times indicated until day 21 and was subjected to real-time PCR using primers for alkaline phosphatase (ALP) and osteocalcin (OC). Data are representative of three repeat experiments. Asterisk indicates P < 0.05. (B) The cells were fixed on day 21, and alizarin red staining and von Kossa staining were performed to examine mineralized matrix deposition. Stained nodule areas were quantified as described in Experimental procedures. Representative data from two repeat experiments are shown. Asterisk indicates P < 0.05. Bar = 1 mm.

PRDC-expressing cells were also observed in the basal layer of the epidermis, dermis, and in the brain (arrowheads in Fig. 1A). We next examined the temporal changes in PRDC mRNA expression during differentiation in primary osteoblastic (pOB) cells isolated from E18.5 calvariae. Primary osteoblasts were cultured in the presence of ascorbic acid (AA) and β-glycerophosphate (β GP) after the cells had reached sub-confluence (day 0). By day 21, these cells had differentiated into fully mature osteoblasts characterized by mineralized matrix deposition. During pOB differentiation, PRDC mRNA expression was increased from day 3 to day 7, and remained unchanged from day 7 to day 21 (Fig. 2). Gene expression of an early bone differentiation marker, alkaline phosphatase (ALP), increased with time from day 3 to day 21. Expression of more differentiated

bone marker mRNAs, OPN and OC, was low on days 3 and 7 and increased from day 14 to day 21. In order to compare the temporal changes in gene expressions during the course of osteoblastic differentiation, we calculated the ratio of the expression level at each time point to the expression level at day 3 (Supplemental sFig.1). The ratios of PRDC remained low after day 7 during differentiation, whereas other markers increased with time. Thus, PRDC mRNA is expressed during osteoblastic differentiation, but its expression level does not change during osteoblastic differentiation after day 7. Previous studies have demonstrated that BMP treatment upregulates the mRNA expression of BMP antagonists in osteoblasts [18,34,35]. In order to investigate whether BMP treatment increases PRDC mRNA expression, pOB cells were treated with recombinant

480

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

EX P ER I ME NTAL CE LL RE S E ARCH 315 (2 0 0 9 ) 474– 4 8 4

human BMP-2 at 100 ng/ml and the mRNA expressions of PRDC and Noggin were examined. Both PRDC and Noggin mRNA expression significantly increased after 12 (Fig. 3 and Supplemental sFig. 2) and 24 h (not shown) of BMP-2 treatment. Thus, BMP treatment increased the expression of both PRDC mRNA and Noggin mRNA.

Forced expression of PRDC does not affect osteoblast proliferation but inhibits osteoblastic differentiation We examined whether PRDC regulates cell proliferation and/or differentiation in osteoblasts. For this purpose, we constructed a recombinant adenovirus expressing PRDC (Ad/PRDC) and control adenoviruses expressing LacZ (Ad/LacZ) or GFP (Ad/GFP). Two BMP antagonists of the DAN family, DAN and gremlin, are known to inhibit the proliferation of certain types of cells [36,37]. As PRDC is structurally related to DAN and gremlin, we investigated the effects of PRDC on the proliferation of pOB cells. Ad/PRDC-infected cells were cultured in growth medium and cell numbers were counted at 1, 2, 3, and 4 d after adenovirus infection. Since Ad/PRDC contains an IRES-GFP cassette placed downstream of the PRDC cDNA, efficient infection by Ad/PRDC could be verified by GFP fluorescence (day 1) or western blotting (day 3) using an anti-GFP antibody (Supplemental sFig. 3). GFP-positive cells were observed in more than 90% of Ad/PRDC- or Ad/GFPinfected pOB. Overexpression of PRDC did not affect cell numbers compared with the control (Supplemental sFig. 4). These observations suggest that PRDC does not affect cell proliferation in osteoblasts. Next, we examined whether PRDC affects the activity of exogenous BMP on osteoblasts. Primary osteoblasts were infected with Ad/PRDC and were cultured in the presence of BMP-2 for 7 d in normal medium without any other differentiation inducers. BMP-2 increased ALP activity in control osteoblasts, whereas this increase was suppressed in Ad/PRDC-infected osteoblasts (Fig. 4). Under the same conditions, BMP-2 increased the level of phosphorylated Smad1/5/8 protein, whereas the level remained low in Ad/PRDC-infected osteoblasts, irrespective of the presence or absence of BMP-2. We also examined the effects of PRDC on BMP-2 in the osteoblasts cultured in differentiation medium containing AA and β GP (Supplemental sFig. 5). We found that Ad/PRDC suppressed the increase in ALP activity induced by BMP2, similar to when the cells were cultured in normal medium. Interestingly, in the absence of BMP-2, Ad/PRDC alone induced a small increase in ALP activity in osteoblasts cultured in the normal medium, whereas it suppressed ALP activity in the differentiation medium (Fig. 4 and Supplemental sFig. 5). Since PRDC is structurally related to sclerostin, which suppresses wnt signaling, we next examined whether PRDC regulates

481

wnt signaling. For this purpose, we performed a promoter assay using β-catenin-responsive Wnt reporter, Super TOP-Flash (Wntresponsive promoter). Both wnt1 and wnt3 activated the Super TOP-flash reporter and this activation was unaffected by the expression of PRDC in pOB cells (Supplemental sFig. 6). Thus, Wntinduced transcriptional reporter activity was not antagonized by PRDC in osteoblasts. In order to explore the effects of PRDC on osteoblastic differentiation, Ad/PRDC-infected cells were cultured for 21 d in differentiation medium containing AA and β GP. Temporal changes in mRNA expression of early (alkaline phosphatase) and late (osteocalcin) bone marker genes were examined. In Ad/PRDCinfected osteoblasts, the level of alkaline phosphatase (ALP) gene expression was lower on days 7–21 compared with Ad/LacZinfected osteoblasts. Likewise, OC mRNA expression was suppressed on days 14–21 during osteoblastic differentiation (Fig. 5A). ALP activity was lowered on day 7 by Ad/PRDC when cells were cultured in the differentiation medium (Supplemental sFig. 5; compare Ad/GFP with Ad/PRDC under BMP-2 minus conditions). Moreover, ALP activity was also decreased when adenovirus infection was performed 1 d after confluency, thus confirming that PRDC blocks the differentiation steps (Supplemental sFig. 7). Histological assessment by Alizarin Red and von Kossa staining revealed that control cells exhibited a significant amount of mineralized matrix deposition at day 21, whereas Ad/PRDCinfected cells exhibited minimal amounts of deposition (Fig. 5B). Thus, forced expression of PRDC blocked BMP action in osteoblasts and suppressed osteoblastic differentiation.

Suppression of PRDC by siRNA promotes osteoblastic differentiation in vitro In order to explore the effects of endogenous PRDC expression in osteoblasts, we performed RNAi experiments to down-regulate PRDC expression. Two siRNAs against PRDC were designed, si RNA1 and si RNA2. Transfection of primary osteoblasts with these siRNAs resulted in the down-regulation of PRDC transcripts by 30% (si RNA1) or 80% (si RNA2) (Fig. 6A). PRDC down-regulation by siRNA caused an elevation in the levels of phosphorylated Smad1/5/8 protein at 48 h after transfection, which reflected the upregulation of BMP signaling (Fig. 6B). We then checked if PRDC down-regulation affects cell proliferation. Transfection with siRNA1 did not affect proliferation, whereas transection with siRNA2 slightly inhibited proliferation after 4 d of culture (Supplemental sFig. 8). When PRDC siRNA-transfected cells were cultured in differentiation medium for 7 d, significant up-regulation of ALP and OPN gene expressions (Fig. 6C) was observed. ALP activity was also

Fig. 6 – Suppression of PRDC expression by siRNA promotes osteoblastic differentiation. PRDC siRNAs (siRNA1 or siRNA2) or negative control siRNA (si-nega) were transfected into pOB cells. After reaching sub-confluency, the cells were cultured in osteoblastic differentiation medium containing AA and β GP. (A) Total RNA was extracted on day 7 and was subjected to real-time PCR using primers for PRDC. (B) On day 7, cell lysates were prepared and were subjected to western blot analysis using anti-phosphorylated Smad1/5/8 antibody. The density of each pSmad1/5/8 protein band was normalized against that of actin and fold changes were calculated as the normalized value for each condition against the value in control condition (si-nega). (C) Expression of ALP and OPN mRNAs was examined on day 7. (D) ALP activity was measured on day 7. (E) The cells were fixed on day 21, and alizarin red staining and von Kossa staining were performed to examine mineralized matrix deposition. Stained nodules areas were quantified as described in Experimental procedures. Representative data from seven repeat experiments are shown. Asterisk indicates P < 0.05.

482

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

increased by siRNA (Fig. 6D). Furthermore, when pOB transfected with siRNA were cultured for 21 d, increased bone-like mineralized matrix deposition was observed compared with control si RNAtransfected cells (Fig. 6E). Taken together, these observations indicate that the suppression of PRDC mediated by siRNA promotes BMP signaling, thereby enhancing osteogenesis in vitro.

Discussion Our study reveals that PRDC mRNA is expressed in osteoblastic cells in vivo and that its expression increases at an early time point during differentiation in vitro. PRDC mRNA expression increased from day 3 to day 7 and this increase preceded the mRNA expressions of OPN and OC that started to increase on day 14 during osteoblastic differentiation in vitro. This suggests that PRDC mRNA is expressed in less mature osteoblasts. Consistent with these observations, in situ hybridization analysis revealed that most of the PRDC-expressing cells are localized in osteoblasts residing in the uppermost layers of the periosteum and that they lie proximal to more mature OC- and OPN-expressing osteoblasts. A few PRDCpositive cells were also observed in the cell layer of OC- and OPNexpressing osteoblasts. PRDC-expressing cells were observed on the ectodermal surface but not on the endocranial surface although the reasons for this regional difference have yet to be clarified. Thus, these data suggest that PRDC is mainly expressed in immature osteoblasts, namely pre-osteoblasts. PRDC mRNA, as well as noggin mRNA, is markedly induced by treatment with BMP-2 in osteoblasts. Although PRDC and noggin are induced after 12 h of BMP treatment, up-regulation of phosphorylated Smad 1/5/8 protein levels was still observed after 24 h of BMP treatment. Therefore BMP-triggered BMP antagonist expression appeared to incompletely block BMP signaling. BMP-dependent induction of BMP antagonist expression has also been reported for other DAN family members such as sclerostin and gremlin [34,35]. It is possible that BMP-triggered antagonists limit the total amount of BMP activity, serving as a negative feedback system. This negative feedback may play an important role in protecting skeletal cells from excessive exposure to BMP during osteogenesis [13]. Infection of Ad/PRDC into BMP-2 treated osteoblasts suppressed up-regulation of ALP activity and phosphorylated Smad1/ 5/8 protein level, suggesting that PRDC blocks exogenous action of BMP-2. This notion is consistent with a previous study that PRDC suppresses the stimulation of BMP responsive promoter activity by BMP-2 [33]. In addition to BMP-2, PRDC has been shown to block the signaling induced by BMP-4, BMP-6 and BMP-7. Similarly to PRDC, noggin antagonizes BMP-2 and BMP-4 and more weakly antagonizes BMP-6 and BMP-7 [31]. Whether both antagonists, PRDC and noggin, have the ability to block action of BMP to the same extent has yet to be clarified. When pOB cells infected with Ad/PRDC were cultured in the differentiation medium in the absence of BMP-2, mRNA expressions of ALP and OC and mineralized matrix formation were suppressed. This suppression of osteoblastic differentiation is accompanied by decreased level of phosphorylated Smad 1/5/8 protein, which indicates that endogenous BMP signaling is downregulated. PRDC does not affect cell proliferation but does inhibit ALP activity, even when cells are infected in the post-confluence state (Supplemental sFig. 7), suggesting that PRDC affects cell differentiation rather than proliferation. It is worth noting,

however, that even though PRDC suppresses the level of phosphorylated Smad1/5/8 protein, it slightly promotes ALP activity in growth medium, not in differentiation medium (Fig. 4 and Supplemental sFig. 5). This suggests that PRDC activity is modulated by the presence of absence of differentiation inducers. Further investigations will, nevertheless, be required in order to elucidate the precise mechanisms. Thus, PRDC inhibits endogenous BMP signaling and prevents osteoblastic differentiation. In contrast to forced expression, PRDC suppression mediated by siRNA increased the activity and expression of ALP on day 7 and enhanced mineralized matrix formation on day 21. PRDC suppression also augments the level of phosphorylated Smad 1/5/8 protein, suggesting that the siRNAs enhance osteoblastic differentiation through an up-regulation of the endogenous level of BMP signaling. Among the siRNAs we tested, siRNA2 was the most effective in suppressing PRDC expression and was more potent in enhancing osteogenic differentiation than siRNA1. Therefore, the osteoblasts with lower levels of PRDC expression exhibit a more mature osteogenic phenotype. Recent studies have suggested that certain BMP antagonists inhibit Wnt canonical signaling as well as BMP signaling. For example, sclerostin inhibits the canonical Wnt pathway by binding the Wnt co-receptor LPR5/6 [38,39]. Down-regulation of gremlin increases Wnt/b-catenin signaling in ST2 stromal cells, although direct interaction between gremlin and Wnt ligands or receptors has not been demonstrated [29]. Our results reveal that PRDC does not block Wnt1- and Wnt3a-activated Super TOP-flash reporter activity, suggesting that PRDC does not directly interfere with the Wnt canonical pathway; this notion is consistent with a previous study using HEK 293 cells [40]. However, we cannot exclude the possibility that PRDC affects a non-canonical Wnt pathway, since both canonical and non-canonical pathways are important for the proper progression of osteogenesis [41–43]. Further studies are required in order to investigate whether PRDC affects noncanonical Wnt pathways or other BMP-independent biological pathways to regulate osteogenesis. It has been reported that inhibition of a BMP antagonist results in an increase in BMP signals, thereby promoting osteogenesis. Noggin suppression by siRNA in primary osteoblasts increases the levels of phosphorylated Smad1/5/8 protein and accelerates osteoblastic differentiation in vitro [16]. Furthermore, downregulation of Gremlin in an osteoblastic cell line has been demonstrated to lead to an enhancement of BMP-2-stimulated promoter activity and ALP activity [29]. These data are consistent with our current observations; that is, PRDC suppression leading to the promotion of osteogenesis. Thus, as an alternative to cytokine application therapy using BMP recombinant proteins, the suppression of BMP antagonists might constitute a potential therapeutic approach for the promotion of bone formation. In this regard, in addition to noggin and gremlin, PRDC could function as a novel therapeutic target for the regulation of bone formation.

Acknowledgments We would like to acknowledge Prof. Masaki Noda and Prof. Norio Amizuka for their advice and discussions. We are grateful to Ms Yasuko Harada for her technical assistance. This work was supported by grants from the Ministry of Education, Science and Culture of Japan (16390521, 18659546, and 19390475).

EX P ER I ME NTAL CE LL RE S E ARCH 315 (2 0 0 9 ) 474– 4 8 4

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.yexcr.2008.11.019.

REFERENCES

[1] J.M. Wozney, V. Rosen, A.J. Celeste, L.M. Mitsock, M.J. Whitters, R.W. Kriz, R.M. Hewick, E.A. Wang, Novel regulators of bone formation: molecular clones and activities, Science 242 (1988) 1528–1534. [2] G. Mitu, R. Hirschberg, Bone morphogenetic protein-7 (BMP7) in chronic kidney disease, Front Biosci. 13 (2008) 4726–4739. [3] H.L. Chen, D.M. Panchision, Concise review: bone morphogenetic protein pleiotropism in neural stem cells and their derivatives–alternative pathways, convergent signals, Stem Cells 25 (2007) 63–68. [4] V. Zuzarte-Luis, J.M. Hurle, Programmed cell death in the embryonic vertebrate limb, Semin. Cell. Dev. Biol. 16 (2005) 261–269. [5] J. Zhang, L. Li, BMP signaling and stem cell regulation, Dev. Biol. 284 (2005) 1–11. [6] A. von Bubnoff, K.W. Cho, Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev. Biol. 239 (2001) 1–14. [7] K. Miyazono, K. Kusanagi, H. Inoue, Divergence and convergence of TGF-beta/BMP signaling, J. Cell. Physiol. 187 (2001) 265–276. [8] A. Zwijsen, K. Verschueren, D. Huylebroeck, New intracellular components of bone morphogenetic protein/Smad signaling cascades, FEBS Lett. 546 (2003) 133–139. [9] K. Miyazono, Signal transduction by bone morphogenetic protein receptors: functional roles of Smad proteins, Bone 25 (1999) 91–93. [10] E. Canalis, A.N. Economides, E. Gazzerro, Bone morphogenetic proteins, their antagonists, and the skeleton, Endocr. Rev. 24 (2003) 218–235. [11] C. Chang, D.A. Holtzman, S. Chau, T. Chickering, E.A. Woolf, L.M. Holmgren, J. Bodorova, D.P. Gearing, W.E. Holmes, A.H. Brivanlou, Twisted gastrulation can function as a BMP antagonist, Nature 410 (2001) 483–487. [12] W. Ishida, T. Hamamoto, K. Kusanagi, K. Yagi, M. Kawabata, K. Takehara, T.K. Sampath, M. Kato, K. Miyazono, Smad6 is a Smad1/5-induced smad inhibitor. Characterization of bone morphogenetic protein-responsive element in the mouse Smad6 promoter, J. Biol. Chem. 275 (2000) 6075–6079. [13] E. Gazzerro, E. Canalis, Bone morphogenetic proteins and their antagonists, Rev. Endocr. Metab. Disord. 7 (2006) 51–65. [14] O. Avsian-Kretchmer, A.J. Hsueh, Comparative genomic analysis of the eight-membered ring cystine knot-containing bone morphogenetic protein antagonists, Mol. Endocrinol. 18 (2004) 1–12. [15] J. Groppe, J. Greenwald, E. Wiater, J. Rodriguez-Leon, A.N. Economides, W. Kwiatkowski, M. Affolter, W.W. Vale, J.C. Belmonte, S. Choe, Structural basis of BMP signalling inhibition by the cystine knot protein Noggin, Nature 420 (2002) 636–642. [16] D.C. Wan, J.H. Pomerantz, L.J. Brunet, J.B. Kim, Y.F. Chou, B.M. Wu, R. Harland, H.M. Blau, M.T. Longaker, Noggin suppression enhances in vitro osteogenesis and accelerates in vivo bone formation, J. Biol. Chem. 282 (2007) 26450–26459. [17] A. Nifuji, O. Kellermann, M. Noda, Noggin inhibits chondrogenic but not osteogenic differentiation in mesodermal stem cell line C1 and skeletal cells, Endocrinology 145 (2004) 3434–3442. [18] A. Nifuji, M. Noda, Coordinated expression of noggin and bone morphogenetic proteins (BMPs) during early skeletogenesis and induction of noggin expression by BMP-7, J. Bone Miner. Res. 14 (1999) 2057–2066.

483

[19] L.J. Brunet, J.A. McMahon, A.P. McMahon, R.M. Harland, Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton, Science 280 (1998) 1455–1457. [20] Y. Gong, D. Krakow, J. Marcelino, D. Wilkin, D. Chitayat, R. Babul-Hirji, L. Hudgins, C.W. Cremers, F.P. Cremers, H.G. Brunner, K. Reinker, D.L. Rimoin, D.H. Cohn, F.R. Goodman, W. Reardon, M. Patton, C.A. Francomano, M.L. Warman, Heterozygous mutations in the gene encoding noggin affect human joint morphogenesis, Nat. Genet. 21 (1999) 302–304. [21] T. Ozaki, Y. Nakamura, H. Enomoto, M. Hirose, S. Sakiyama, Overexpression of DAN gene product in normal rat fibroblasts causes a retardation of the entry into the S phase, Cancer Res. 55 (1995) 895–900. [22] M. Yanagita, M. Oka, T. Watabe, H. Iguchi, A. Niida, S. Takahashi, T. Akiyama, K. Miyazono, M. Yanagisawa, T. Sakurai, USAG-1: a bone morphogenetic protein antagonist abundantly expressed in the kidney, Biochem. Biophys. Res. Commun. 316 (2004) 490–500. [23] D.G. Winkler, M.K. Sutherland, J.C. Geoghegan, C. Yu, T. Hayes, J.E. Skonier, D. Shpektor, M. Jonas, B.R. Kovacevich, K. Staehling-Hampton, M. Appleby, M.E. Brunkow, J.A. Latham, Osteocyte control of bone formation via sclerostin, a novel BMP antagonist, EMBO J. 22 (2003) 6267–6276. [24] E. Bell, I. Munoz-Sanjuan, C.R. Altmann, A. Vonica, A.H. Brivanlou, Cell fate specification and competence by Coco, a maternal BMP, TGFbeta and Wnt inhibitor, Development 130 (2003) 1381–1389. [25] Y. Yokouchi, K.J. Vogan, R.V. Pearse 2nd, C.J. Tabin, Antagonistic signaling by Caronte, a novel Cerberus-related gene, establishes left-right asymmetric gene expression, Cell 98 (1999) 573–583. [26] J.J. Pearce, G. Penny, J. Rossant, A mouse cerberus/Dan-related gene family, Dev. Biol. 209 (1999) 98–110. [27] E. Stanley, C. Biben, S. Kotecha, L. Fabri, S. Tajbakhsh, C.C. Wang, T. Hatzistavrou, B. Roberts, C. Drinkwater, M. Lah, M. Buckingham, D. Hilton, A. Nash, T. Mohun, R.P. Harvey, DAN is a secreted glycoprotein related to Xenopus cerberus, Mech. Dev. 77 (1998) 173–184. [28] E. Gazzerro, R.C. Pereira, V. Jorgetti, S. Olson, A.N. Economides, E. Canalis, Skeletal overexpression of gremlin impairs bone formation and causes osteopenia, Endocrinology 146 (2005) 655–665. [29] E. Gazzerro, A. Smerdel-Ramoya, S. Zanotti, L. Stadmeyer, D. Durant, A.N. Economides, E. Canalis, Conditional deletion of gremlin causes a transient increase in bone formation and bone mass, J. Biol. Chem. 282 (2007) 31549–31557. [30] R.L. van Bezooijen, B.A. Roelen, A. Visser, L. van der Wee-Pals, E. de Wilt, M. Karperien, H. Hamersma, S.E. Papapoulos, P. ten Dijke, C.W. Lowik, Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical BMP antagonist, J. Exp. Med. 199 (2004) 805–814. [31] N. Kusu, J. Laurikkala, M. Imanishi, H. Usui, M. Konishi, A. Miyake, I. Thesleff, N. Itoh, Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity, J. Biol. Chem. 278 (2003) 24113–24117. [32] C. Minabe-Saegusa, H. Saegusa, M. Tsukahara, S. Noguchi, Sequence and expression of a novel mouse gene PRDC (protein related to DAN and cerberus) identified by a gene trap approach, Dev. Growth Differ. 40 (1998) 343–353. [33] S. Sudo, O. Avsian-Kretchmer, L.S. Wang, A.J. Hsueh, Protein related to DAN and cerberus is a bone morphogenetic protein antagonist that participates in ovarian paracrine regulation, J. Biol. Chem. 279 (2004) 23134–23141. [34] Y. Ohyama, A. Nifuji, Y. Maeda, T. Amagasa, M. Noda, Spaciotemporal association and bone morphogenetic protein regulation of sclerostin and osterix expression during embryonic osteogenesis, Endocrinology 145 (2004) 4685–4692. [35] R.C. Pereira, A.N. Economides, E. Canalis, Bone morphogenetic proteins induce gremlin, a protein that limits their activity in osteoblasts, Endocrinology 141 (2000) 4558–4563.

484

EX PE R I ME NTAL CE LL RE S E ARCH 315 ( 2 0 0 9 ) 474– 4 84

[36] E. Hanaoka, T. Ozaki, Y. Nakamura, H. Moriya, A. Nakagawara, S. Sakiyama, Overexpression of DAN causes a growth suppression in p53-deficient SAOS-2 cells, Biochem. Biophys. Res. Commun. 278 (2000) 20–26. [37] L.Z. Topol, M. Marx, D. Laugier, N.N. Bogdanova, N.V. Boubnov, P.A. Clausen, G. Calothy, D.G. Blair, Identification of drm, a novel gene whose expression is suppressed in transformed cells and which can inhibit growth of normal but not transformed cells in culture, Mol. Cell Biol. 17 (1997) 4801–4810. [38] D.L. Ellies, B. Viviano, J. McCarthy, J.P. Rey, N. Itasaki, S. Saunders, R. Krumlauf, Bone density ligand, Sclerostin, directly interacts with LRP5 but not LRP5G171V to modulate Wnt activity, J. Bone Miner. Res. 21 (2006) 1738–1749. [39] X. Li, Y. Zhang, H. Kang, W. Liu, P. Liu, J. Zhang, S.E. Harris, D. Wu, Sclerostin binds to LRP5/6 and antagonizes canonical Wnt signaling, J. Biol. Chem. 280 (2005) 19883–19887. [40] J. Im, H. Kim, S. Kim, E.H. Jho, Wnt/beta-catenin signaling regulates expression of PRDC, an antagonist of the BMP-4

signaling pathway, Biochem. Biophys. Res. Commun. 354 (2007) 296–301. [41] I. Takada, M. Mihara, M. Suzawa, F. Ohtake, S. Kobayashi, M. Igarashi, M.Y. Youn, K. Takeyama, T. Nakamura, Y. Mezaki, S. Takezawa, Y. Yogiashi, H. Kitagawa, G. Yamada, S. Takada, Y. Minami, H. Shibuya, K. Matsumoto, S. Kato, A histone lysine methyltransferase activated by non-canonical Wnt signalling suppresses PPAR-gamma transactivation, Nat. Cell. Biol. 9 (2007) 1273–1285. [42] D. Baksh, R.S. Tuan, Canonical and non-canonical Wnts differentially affect the development potential of primary isolate of human bone marrow mesenchymal stem cells, J. Cell. Physiol. 212 (2007) 817–826. [43] T. Gaur, C.J. Lengner, H. Hovhannisyan, R.A. Bhat, P.V. Bodine, B.S. Komm, A. Javed, A.J. van Wijnen, J.L. Stein, G.S. Stein, J.B. Lian, Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression, J. Biol. Chem. 280 (2005) 33132–33140.