Proteome analysis of rat hepatic stellate cells

Proteome Analysis of Rat Hepatic Stellate Cells DAN BACH KRISTENSEN,1,2 NORIFUMI KAWADA,3 KUNIHIKO IMAMURA,1 YUKA MIYAMOTO,1 CHISE TATENO,1 SHUICHI SEKI,3 TETSUO KUROKI,3 AND KATSUTOSHI YOSHIZATO1,2

Proteome analysis was performed on cellular and secreted proteins of normal (quiescent) and activated rat hepatic stellate cells. The stellate cells were activated either in vitro by cultivating quiescent stellate cells for 9 days or in vivo by injecting rats with carbon tetrachloride for 8 weeks. A total of 43 proteins/polypeptides were identified, which altered their expression levels when the cells were activated in vivo and/or in vitro. Twenty-seven of them showed similar changes in vivo and in vitro, including up-regulated proteins such as calcyclin, calgizzarin, and galectin-1 as well as down-regulated proteins such as liver carboxylesterase 10 and serine protease inhibitor 3. Sixteen of them showed different expression levels between in vivo and in vitro activated stellate cells. These results were reproducibly obtained in 3 independent experiments. The up-regulation of calcyclin, calgizzarin, and galectin-1, as well as the downregulation of liver carboxylesterase 10 were directly confirmed in fibrotic liver tissues. Northern blots confirmed up-regulation of the messenger RNAs (mRNAs) of calcyclin, calgizzarin, and galectin-1 in activated stellate cells, indicating that these changes were controlled at the mRNA level. In addition a list compiling over 150 stellate cell proteins is presented. The data presented here thus provide a significant new protein-level insight into the activation of hepatic stellate cells, a key event in liver fibrogenesis. (HEPATOLOGY 2000;32:268-277.) The hepatic stellate cells play multiple crucial roles in the physiology and pathology of the liver, including metabolism of retinols, synthesis of extracellular matrices (ECMs), production of cytokines, and probably regulation of sinusoidal blood flow.1 After liver injury the hepatic stellate cells unAbbreviations: ECM, extracellular matrix; PDGF, platelet-derived growth factor; 2-D PAGE, 2-dimensional polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulfate; CCl4, carbon tetrachloride; mRNA, messenger RNA; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; PBS, phosphate-buffered saline; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-PCR, reverse transcription-polymerase chain reaction; SPARC, secreted protein acidic and rich in cysteine. From the 1Hiroshima Tissue Regeneration Project, Hiroshima Prefecture Joint-Research Project for Regional Intensive, JST, Hiroshima; 2Department of Biological Science, Graduate School of Science, Hiroshima University, Hiroshima; and 3Third Department of Internal Medicine, Osaka City University Medical School, Osaka, Japan. Received December 10, 1999; accepted May 23, 2000. N.K. was supported by grants-in-aid from the Ministry of Education, Science, and Culture of Japan (No. 11670525), Osaka City University Medical Research Foundation, Fund for Medical Research (1998), and Uehara Memorial Foundation (1998). Address reprint requests to: Katsutoshi Yoshizato, Ph.D., Developmental Biology Laboratory, Department of Biological Science, Graduate School of Science, Hiroshima University, 1-3-1, Kagamiyama, Higashihiroshima, Hiroshima 739-8526, Japan. E-mail: [email protected]; fax: (81) 824 24 1492. Copyright © 2000 by the American Association for the Study of Liver Diseases. 0270-9139/00/3202-0015$3.00/0 doi:10.1053/jhep.2000.9322

dergo “activation,” which is a characteristic transformation from a quiescent vitamin A–storing cell type to a myofibroblast-like cell type eliciting active proliferation, increased ECM production, enhanced contractility, and secretion of fibrotic mediators.2,3 The activation of hepatic stellate cells has attracted considerable attention, because it is a key event in the repair of damaged liver tissue, and in a chronic state it leads to an excessive accumulation of fibril-forming ECMs and development of liver fibrosis. The activation process has been studied using both in vivo and in vitro models, and these studies have provided an insight into the molecular mechanism behind the process of the transformation. For instance, transforming growth factor ␤ and platelet-derived growth factor (PDGF) are well established as important cytokines in the activation of hepatic stellate cells.2,3 Analysis of the molecular mechanisms underlying the hepatic stellate cell activation is essential for the development of effective therapies against liver fibrosis. To acquire a deeper knowledge on this subject we have initiated proteome analysis of hepatic stellate cells. The proteome (protein ⫹ genome) refers to the total protein profile of a given cell or tissue type,4,5 and proteome research basically involves the following experimental steps: (1) separation of proteins in the proteome, and (2) identification/characterization of individual proteins. Two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) originally described by O’Farrel6 is currently the method of choice for resolving the protein components of a proteome. This technique combines isoelectric focusing in the first dimension with sodium dodecyl sulfate (SDS)-PAGE in the second dimension, and it is capable of separating several thousands of proteins on a single 2-D gel. Identification of 2-D PAGE resolved proteins is now primarily done using mass spectrometric techniques, such as matrix-assisted laser desorption ionization or electrospray ionization mass spectrometry.7,8 The combination of 2-D PAGE and matrix-assisted laser desorption ionization or electrospray ionization mass spectrometry has the potential to resolve a complex proteome and characterize its individual proteins with respect to their identities, quantities, and post-translational modifications.9 In the present study a partial proteome analysis was performed on cellular and secreted proteins of normal (quiescent) and activated hepatic stellate cells, with a special emphasis on proteins displaying activation-associated changes in their expression levels. Stellate cell activation was induced either in vitro by cultivating the quiescent stellate cells for a longer period or in vivo by injecting rats with carbon tetrachloride (CCl4). A total of 43 proteins/polypeptides displaying altered expression levels in in vivo and/or in vitro activated stellate cells were identified, and focus was put on 27 proteins that showed similar changes in both models. Seventeen of these represented novel observations. Furthermore, the up-

268

HEPATOLOGY Vol. 32, No. 2, 2000

regulation of calcyclin, calgizzarin, and galectin-1 was directly confirmed in vivo in fibrotic liver tissues. Northern blots showed increased messenger RNA (mRNA) levels of these proteins in activated stellate cells, which indicated that their up-regulation was controlled at the mRNA level. Finally, a list compiling over 150 stellate cell proteins is presented. MATERIALS AND METHODS Chemicals. All chemicals were purchased from Wako Pure Chemicals (Osaka, Japan) unless otherwise indicated. Pronase E was purchased from Merck (Darmstadt, Germany). DNase was from Boehringer Mannheim (Mannheim, Germany). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were from Gibco BRL (Gaithersburg, MD). Animals. Pathogen-free male Wistar rats were obtained from SLC (Shizuoka, Japan). Animals were housed at a constant temperature and supplied with laboratory chow and water ad libitum. The protocol of experiments was approved by the Animal Research Committee of Osaka City University (Guide for Animal Experiments, Osaka City University). Induction of Liver Fibrosis. Liver fibrosis was induced by injecting rats with CCl4 mixed with olive oil to a final concentration of 50% (vol/vol). Pathogen-free male Wistar rats (200 g) were administered with 0.2 mL of 50% CCl4 subcutaneously twice a week for 8 weeks. One day after the final injection, rats were anesthetized by diethylether and the peritoneal cavity was opened. The liver was perfused with phosphate-buffered saline (PBS) via the portal vein at a flow rate of 10 mL/min until the blood was completely removed from the whole liver lobules. Subsequently, the liver was removed. A part of the liver was fixed in 10% formaldehyde and used for histologic examination. The remaining part was quickly frozen in liquid nitrogen and stored at ⫺80°C until use. Normal liver was prepared exactly in the same way except for the injection of CCl4. Preparation of Stellate Cells, Hepatocytes, Endothelial Cells, and Kupffer Cells. Stellate cells were obtained from normal or fibrotic rat livers as

previously described.10 Briefly, normal or fibrotic livers were perfused for 10 minutes with SC-1 solution consisting of 8,000 mg/L NaCl, 400 mg/L KCl, 88.17 mg/L NaH2PO4 䡠 2H2O, 120.45 mg/L Na2HPO4, 2,380 mg/L HEPES, 350 mg/L NaHCO3, 190 mg/L EGTA, 900 mg/L glucose, pH 7.3, followed by digestion at 37°C for 40 minutes with 0.1% pronase and 0.04% collagenase dissolved in SC-2 solution consisting of 8,000 mg/L NaCl, 400 mg/L KCl, 88.17 mg/L NaH2PO4 䡠 2H2O, 120.45 mg/L Na2HPO4, 2,380 mg/L HEPES, 350 mg/L NaHCO3, 560 mg/L CaCl2 䡠 2H2O, pH 7.3. The digested liver was excised, cut into small pieces, and incubated in SC-2 solution containing 0.08% pronase E, 0.08% collagenase, and 20 ␮g/mL of DNase. The resulting suspension was filtered through a 150-␮m steel mesh and centrifuged on an 8.2% Nycodenz cushion, which produced a stellate cell– enriched fraction in the upper whitish layer. The cells were washed, suspended in DMEM supplemented with 10% FBS, 70 mg/L penicillin, and 100 mg/L streptomycin, and plated on plastic culture dishes (Falcon 3003, Beckton Dickinson, Flanklin Lakes, NJ). Cell purity was around 95% as assessed by a typical star-like configuration and by detecting vitamin A autofluorescence. Stellate cells were plated for 3 hours, and the cultures were subsequently washed 5 times with PBS to remove dead cells and cell debris. The attached cells were lysed for the proteome analysis of cellular proteins. Stellate cells isolated from normal liver were referred to as quiescent stellate cells in the present study. Stellate cells isolated from fibrotic livers were prepared exactly in the same way as quiescent stellate cells and referred to as in vivo activated stellate cells. Stellate cells from normal liver were plated as described above and the attached cells were cultured for 9 days. These cells were referred to as in vitro activated stellate cells. Samples containing proteins secreted by quiescent, in vivo activated, and in vitro activated stellate cells were prepared as follows. Stellate cells were isolated from normal liver, plated on culture dishes and allowed to attach for 24 hours in DMEM supplemented with 10%

KRISTENSEN ET AL.

269

FBS. The cells were then washed 5 times with serum-free DMEM and subsequently cultured for 2 days in serum-free DMEM supplemented with 20 ng/mL human PDGF. The medium was collected at day 3, and the proteins in the medium were referred to as secreted proteins of quiescent stellate cells. Stellate cells from fibrotic liver were prepared exactly as those of the normal liver, and the medium was collected at day 3. Proteins in the medium were referred to as secreted proteins of in vivo activated stellate cells. Stellate cells from normal liver were cultured for 7 days in 10% FBS-containing DMEM, then washed with serum-free DMEM, and cultured additionally for 2 days in serum-free media. The media were collected, and the proteins in the media were referred to as secreted proteins of in vitro activated stellate cells. To remove detached cells all media were centrifuged at 500g for 10 minutes and passed through a sterilized filter with a pore size of 0.45 ␮m (Millex-HA, Millipore, Bedford, MA). All media were kept at ⫺80°C until use. Hepatocytes were prepared from normal and fibrotic livers as follows. Liver tissues were perfused first with SC-1 solution for 10 minutes, then with SC-2 solution supplemented with 0.05% collagenase and 0.005% soybean trypsin inhibitor for 20 minutes at 37°C. After perfusion, the liver was dispersed in ice-cold SC-2 solution and filtered through a nylon gauze. The cell suspension was centrifuged at 50g for 10 minutes at 4°C, and the cell pellet was washed and centrifuged 3 times in PBS. Finally, the hepatocytes were packed by centrifugation at 250g for 3 minutes, frozen in liquid nitrogen, and stored at ⫺80°C until use. Endothelial cells and Kupffer cells were prepared as follows. Normal and fibrotic livers were prepared and digested as described for the stellate cells, and the resulting cell suspension was centrifuged on a 17% Nycodenz cushion. This produced a nonparenchymal cell fraction, which was introduced into a centrifugal elutriation chamber (Hitachi CR-4A, Hitachi, Tokyo, Japan) at a flow rate of 18.5 mL/min at 3,250 rpm and 4°C. Elution buffer was Gey’s balanced salt solution supplemented with 1% FBS throughout the procedure. Endothelial cells were eluted from the chamber at a flow rate between 22 and 28 mL/min and Kupffer cells between 40 and 70 mL/min. The cell fractions were packed by centrifugation at 450g for 10 minutes at 4°C, and subsequently resuspended in DMEM with 10% FBS at a concentration of 3 ⫻ 106 cells/mL. The cells were plated at a density of 3 ⫻ 107 cells/dish for 3 hours. The adherent Kupffer cells were then washed and lysed as described below. Endothelial cells, of which more than 99% did not adhere to the plastic dishes after 3 hours of plating, were packed by centrifugation at 450g for 10 minutes at 4°C, and the cell pellet was subsequently washed and centrifuged twice in PBS, and finally lysed as described below. Sample Lysis Prior to 2-D PAGE. Stellate cells and Kupffer cells were washed 5 times with PBS and then dissolved at a concentration of approximately 107 cells/mL in lysis buffer consisting of 7 mol/L urea, 2 mol/L thiourea, 4% (wt/vol) 3-3-cholamidopropyldimethylammonio-1-propanesulfonate, 2% (vol/vol) Ampholine pH 3.5-10 (Pharmacia Hoefer, Uppsala, Sweden), and 1% dithiothreitol. The packed endothelial cells were lysed at a concentration of approximately 3 ⫻ 107 cells/mL. Liver tissues and hepatocytes were lysed at a concentration of 0.2 g/mL. All samples were centrifuged for 1 hour at 40,000g to remove DNA, and subsequently stored at ⫺80°C until use. The protein concentration of each sample was measured on a Jasco V-530 spectrophotometer (Jasco International, Tokyo, Japan) using a BioRad Protein Assay kit (Bio-Rad, Hercules, CA). Culture media containing proteins secreted from stellate cells were concentrated from 15 mL to a final volume of approximately 100 ␮L using 15-mL Ultrafree centrifugal filters with a 5-kd molecular weight cutoff (Millipore, Bedford, MA). The concentrated media were then mixed with lysis buffer at a 1:15 ratio and stored at ⫺80°C until use. 2-D PAGE. 2-D PAGE was performed as previously described.11 Briefly, protein samples were applied overnight to Immobiline DryStrips (pH 4-7, 18 cm, Pharmacia Hoefer, Uppsala, Sweden) by in-gel rehydration.12,13 For all cellular samples a total of 100 ␮g protein was loaded per gel and for liver tissues a total of 400 ␮g protein per gel. The proteins secreted by 107 stellate cells in 2 days were applied per

270 KRISTENSEN ET AL. gel. First dimension isoelectric focusing was performed using a Multiphor II electrophoresis chamber (Pharmacia Hoefer, Uppsala, Sweden). Second dimension SDS-PAGE was performed in 9% to 18% acrylamide gradient gels using the Iso-Dalt system from Pharmacia Hoefer. Proteins were visualized by silver staining and the 2-D gels were scanned on an Epson ES 8000 scanner (Seiko Epson Corporation, Suwa, Japan). After scanning the 2-D gels were dried between 2 cellophane sheets and stored at room temperature. Image analysis and 2-D gel proteome database management were done using the Melanie II 2-D PAGE software package (version 2.2) from Bio-Rad (Hercules, CA). The Melanie II software arbitrarily calculated the 2-D spot intensity by integrating the optical density over the spot area (i.e., the spot “volume”), and ␤-actin was used as an internal calibrant for cell and tissues samples. No suitable internal calibrant was available for samples of secreted proteins. Tryptic In-Gel Digestion of 2-D PAGE–Resolved Proteins. In-gel digestion of 2-D PAGE–resolved proteins was performed as previously described.11 Briefly, protein spots of interest were excised from the 2-D gels and rehydrated in 100 mmol/L ammonium carbonate. The gel pieces were washed twice in MilliQ water, destained in 15 mmol/L potassium ferricyanide and 50 mmol/L sodium thiosulfate, rinsed twice in MilliQ water and once in 100 mmol/L ammonium bicarbonate, dehydrated in acetonitrile until they turned opaque white, and finally dried in a centrifugal vaporizer. The gel pieces were then rehydrated in a digestion buffer containing trypsin, and proteins were in-gel digested overnight at 37°C. Digestion was terminated with 5% trifluoroacetic acid, and the peptides were extracted 3 times with 5% trifluoroacetic acid in 50% acetonitrile. The extraction solutions were pooled, dried in a centrifugal vaporizer, resuspended in 1% formic acid in 4% methanol, and loaded to a laboratory-made OLIGO R3 column (PerSeptive Biosystems, Framingham, MA).11 After washing the column with 1% formic acid the peptides were eluted with 1% formic acid in 70% methanol and analyzed by electrospray ionization mass spectrometry as described below. ESI Mass Spectrometry and Protein Identification. This work has been described in detail elsewhere.11 Briefly, the eluted peptides were loaded into Au/Pd coated nanoES spray capillaries (Protana, Odense, Denmark) and were inserted into the nanoflow Z-spray source of a Q-TOF mass spectrometer (Micromass, Manchester, England). QTOF operation, data acquisition, and data analysis were performed using the MassLynx/BioLynx 3.2 software (Micromass, Manchester, UK) on a Windows NT server. The Q-TOF was operated in 2 modes: MS and MS/MS. The MS mode was used to scan samples for detectable peptides. Subsequently the MS/MS mode was used to fragment individual peptides, and from the resulting MS/MS spectra the amino acid sequence was deduced for each peptide. Finally, the proteins were identified by matching the obtained amino acid sequences against the SwissProt and GenBank databases using the GenomeNet WWW server of Kyoto University, Japan (http://www.fasta.genome. ad.jp/). Construction of Probes for Northern Blotting by Reverse TranscriptionPolymerase Chain Reaction. Total RNA was extracted from the acti-

vated stellate cells and mouse skeletal muscle using Isogen (Nippon Gene, Tokyo, Japan). Double-stranded complementary DNAs of rat galectin-1, calcyclin, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were amplified from total RNA of stellate cells by reverse transcription-polymerase chain reaction (RT-PCR) using a GeneAmp RNA PCR Core Kit (Perkin Elmer, Branchburg, NJ). Reverse transcription was performed at 42°C for 15 minutes. PCR (30 seconds at 95°C, 30 seconds at 55°C, 1 minute at 70°C, 35 cycles) was performed in a GeneAmp PCR System 9700 (Perkin Elmer). The following primers were used: galectin-1, ACGCCAAGAGCTTTGTGTTGA (forward) and CGCCATGTAGTTGATGGCCT (reverse); calcyclin, GCATGCCCCCTGGATCA (forward) and CCCCAGGAAGGCAACATACTC (reverse); and GAPDH, ACCACAGTCCATGCCATCAC (forward) and TCCACCACCCTGTTGCTGTA (reverse). For mouse calgizzarin, the double-stranded complementary DNA was amplified using total RNA isolated from mouse skeletal muscle and a primer pair; GAACACAGAGCTGGCTGCCT (for-

HEPATOLOGY August 2000

ward) and TGGTGGTTGGATGGGAACTAA (reverse). PCR products were separated on a 2% agarose gel containing 0.5 mg/mL ethidium bromide to check if a single specific band had been produced. Quantification of mRNA by Northern Blotting. Twenty micrograms of the RNA extracted from rat stellate cells was denatured in 5% formaldehyde/50% formamide at 65°C for 15 minutes and then separated on a 1% agarose gel containing 7.4% formaldehyde using 1⫻ 4-morpholinepropane-sulfonic acid buffer. Total RNA was then visualized by ethidium bromide staining, and subsequently transferred to a nylon membrane (Hybond-N, Amersham Pharmacia Biotech, Upsala, Sweden). After 5 minutes of UV fixation at 302 nm the membrane was incubated at 42°C for 2 hours in a prehybridization buffer containing 5⫻ saline sodium citrate buffer, 5⫻ Denhardt’s solution, 50% formamide, 0.5% SDS, and 20 g/mL salmon sperm DNA. The membrane was then incubated in the same buffer supplemented with PCR-amplified double-stranded complementary DNA for galectin-1, calcyclin, calgizzarin, and GAPDH, which were labeled with [␣-32P] dCTP using a Rediprime DNA Labeling System (Amersham Pharmacia Biotech). After incubating overnight at 42°C, the membrane was washed twice with 2⫻ saline sodium citrate containing 0.1% SDS and then with 0.1⫻ saline sodium citrate containing 0.1% SDS. Reactive bands were detected by autoradiography on a Kodak XAR5 X-ray film (Kodak, Rochester, NY). RESULTS Identification of Proteins Associated with Activation of Stellate Cells. Hepatic stellate cells are activated when the liver is in-

jured, and the activation is thought to be a prime event in liver fibrogenesis.1-3 We investigated the overall protein expression pattern of the stellate cells derived from both normal and fibrotic livers to obtain a general insight into changes at the protein level accompanying the stellate cell activation and to identify the activation-associated proteins. Rats were treated with CCl4 for 8 weeks and stellate cells were isolated from the livers. Similarly, stellate cells were isolated from normal rat livers. Histologic examinations clearly showed that the liver from the rat treated with CCl4 became fibrotic (data not shown). Western blotting using antibodies against smooth muscle ␣-actin and PDGF ␤ receptor also confirmed that these proteins were up-regulated in stellate cells from the CCl4-treated livers as compared with those from the control livers (data not shown). These 2 proteins are well-established markers of activated stellate cells.1 We examined the secreted and cellular proteins of freshly isolated stellate cells. The cells were cultured for 3 hours and the attached cells were lysed to analyze the cellular proteins (Fig. 1A and B). For the analysis of secreted proteins the fresh isolates were cultured for 24 hours in serum-containing DMEM and additionally cultured for 2 days in serum-free DMEM. The media were then collected and analyzed for secreted proteins (Fig. 2A and B). To investigate the secreted proteins of quiescent stellate cells, the culture period should be as short as possible, because these cells are apt to be autonomously activated if their culture period becomes longer. Thus, we tried to reduce the culture period. However, we could not reduce it to less than 24 hours, because under these circumstances the cells were detached during the subsequent serum-free culture. Figure 1A and B show 2-D gels obtained from 100-␮g cellular proteins from stellate cells of normal and fibrotic livers, respectively. Some of the proteins displaying activation-associated changes in their expression levels are indicated, such as calgizzarin, smooth muscle ␣-actin, and calcyclin, which were

HEPATOLOGY Vol. 32, No. 2, 2000

KRISTENSEN ET AL.

271

FIG. 1. Silver-stained 2-D gels of proteins from the cellular fractions of quiescent and activated stellate cells. Isoelectric focussing was performed using immobilized pH gradients (IPG) 4-7. A total of 100 ␮g protein was applied per IPG gel. (A) Stellate cells derived from normal liver (quiescent stellate cells). (B) Stellate cells derived from fibrotic liver (in vivo activated stellate cells). (C) Stellate cells derived from normal liver and cultured for 9 days (in vitro activated stellate cells). A total of 229 spots were identified, and some of the proteins displaying activation-associated changes in their expression levels are indicated (see Tables 1 and 2 for a complete list). A detailed list of all identified proteins is given in Table 3.

up-regulated, and HPAST protein and liver carboxylesterase 10, which were down-regulated. Figure 2A and B display 2-D gels of secreted proteins from 107 stellate cells of normal and fibrotic livers, respectively. Collagen ␣1 (I), cathepsin D, and serine protease were examples of up-regulated secreted proteins, whereas stromelysin-1 and serine protease inhibitor 3 were examples of down-regulated ones. In addition we also analyzed cellular and secreted proteins from stellate cells that were in vitro activated in culture.1 Fig. 1C shows a 2-D gel of 100-␮g cellular proteins from stellate cells cultured for 9 days, and Fig. 2C shows a 2-D gel of their secreted proteins. Western blot analysis confirmed that both smooth muscle ␣-actin and PDGF ␤ receptor were up-regulated in these stellate cells as compared with quiescent cells (data not shown), indicating their actual activation. The 2-D PAGE analysis was performed 3 times for each sample of quiescent, in vivo, and in vitro activated stellate cells prepared from 3 different individuals. Figs. 1 and 2 are shown as representatives of them. The statistical variances in the 3 analyses are shown in Tables 1 and 2.

The expression patterns of both cellular (Fig. 1) and secreted proteins (Fig. 2) were basically similar between in vivo and in vitro activated stellate cells. Table 1 lists 27 proteins that displayed changes to a similar extent in both models, with the difference in expression level between in vivo and in vitro activated stellate cells being less than 3-fold. Among these proteins were 17 novel findings, including up-regulated proteins such as cathepsin D and galectin-1, and down-regulated proteins such as liver carboxylesterase 10 and serine protease inhibitor 3. However, there were some cellular proteins in which expression levels differed more than 3-fold between in vivo and in vitro models, and 16 such proteins are listed in Table 2. These proteins showed a similar expression level in quiescent and in vivo activated stellate cells as destrin and 5⬘ nucleotidase, a lower expression level as 2 actin variants, or a higher level as cofilin and proteasome delta chain, in in vivo activated stellate cells compared with the quiescent ones. The common feature of the proteins in Table 2 was that their expression levels in in vitro activated stellate cells were greatly up-regu-

272 KRISTENSEN ET AL.

HEPATOLOGY August 2000

FIG. 2. Silver-stained 2-D gels of proteins secreted into the media by stellate cells. Isoelectric focussing was performed using immobilized pH gradients (IPG) 4-7. Stellate cells (107 cells) from normal liver were cultured for 24 hours as quiescent stellate cells or 7 days as in vitro activated stellate cells in serum-containing media, and the cells were additionally cultured in 5 mL serum-free media for 2 days as described in the Materials and Methods. Stellate cells (107 cells) from fibrotic liver were treated as the quiescent stellate cells and used as the in vivo activated stellate cells. The media were removed, concentrated, mixed with lysis buffer, and loaded onto IPG gels as described in the text. (A) Proteins secreted by the quiescent stellate cells. (B) Proteins secreted by the in vivo activated stellate cells. (C) Proteins secreted by the in vitro activated stellate cells. All together a total of 83 protein spots were identified, and some of the proteins displaying activation-associated changes in their expression levels are indicated (see Table 1 for a complete list). A detailed list of all identified proteins is given in Table 3.

lated as for cofilin and FK506 binding proteins 6 or downregulated as for the actin variants and RHO GDP-dissociation inhibitor 2. These extreme expression levels found in in vitro activated stellate cells appeared to reflect their adaptation to the in vitro environments, because they were cultured for the extended period of 9 days. In contrast the quiescent and in vivo activated stellate cells were cultured for just 3 hours. The purity of the stellate cell fraction was measured by immunocytochemistry using anti-glial fibrillary acidic protein and desmin antibodies.14 The purity of stellate cells derived from normal and fibrotic livers was approximately 95% and 92%, respectively (data not shown). Immunocytochemistry revealed that the remaining cells were ED-1 positive Kupffer cells (data not shown).15 Endothelial cells were ED-1/antiglial fibrillary acidic protein negative, and they were not detected in the stellate cell fractions (data not shown). 2-D PAGE analysis of Kupffer cells isolated from normal and fibrotic rat livers revealed that the proteins listed in Tables 1 and 2, including galectin-1, calcyclin, and calgizzarin, were much less abundant or absent in these cells as compared with

stellate cells (data not shown). Consequently, the influence of Kupffer cells on the results shown in Tables 1 and 2 can be ignored. Two-Dimensional Gel Analysis of Liver Tissues, Hepatocytes, Endothelial Cells, and Kupffer Cells from Normal and Fibrotic Rats. To

further confirm that the observed changes take place in vivo we performed 2-D PAGE analysis directly on normal and fibrotic livers. It should be pointed out that stellate cells only constitute 5.5% of the total cell population in the liver.16 As a result proteins from other cell types, primarily hepatocytes, swamped many stellate cell-derived protein signals in the 2-D gels. However, despite this fact several of the above-described observations on proteins of stellate cells were reproduced in liver tissues. These proteins have been marked with ¶ in Table 1, and they include up-regulation of galectin-1, calcyclin, and calgizzarin (Fig. 3) and down-regulation of liver carboxylesterase 10. Galectin-1, calcyclin, and calgizzarin were not detected in the hepatocytes, but there was a clear down-regulation of liver carboxylesterase 10 in hepatocytes derived from fibrotic livers (data not shown). Two-dimensional gel analysis

HEPATOLOGY Vol. 32, No. 2, 2000

KRISTENSEN ET AL.

273

TABLE 1. Proteins Displaying Similar Activated Levels of Expression between In Vivo and In Vitro Activated Stellate Cells Protein (c*/s†)

Up-regulated proteins Calcyclin¶ (c) Calgizzarin¶ (c) Cartilage-associated CASP protein (c) Cathepsin D (s) 72 kDa type IV collagenase‡ (s) Catechol o-methyltransferase (c) Collagen alpha 1 (I)‡ (s) Collagen alpha 1 (I) c-terminal propeptide‡ (s) Collagen alpha 1 (III)‡ (s) Collagen alpha 1 (III) c-terminal propeptide‡ (s) Collagen alpha 2 (I) c-terminal propeptide‡ (s) F-actin capping protein (c) Farnesyl pyrophosphate synthetase (c) Galectin-1¶ (c) Gamma actin (c) Gamma enolase (c) Neural cell adhesion molecule‡ (c) Prolyl 4-hydroxylase alpha (c) Serine protease (s) Smooth muscle ␣-actin‡ (c) SPARC‡ (s) Down-regulated proteins Alpha-1-antiproteinase (s) Expressed sequence tag (EST; GenBank AA376979) (c) HPAST protein (c) Liver carboxylesterase 10¶ (c) Serine protease inhibitor 3 (s) Stromelysin-1‡ (s)

Quiescent Stellate Cells

In Vivo Activated Stellate Cells

In Vitro Activated Stellate Cells

125.7 ⫾ 6.3 68.0 ⫾ 6.9 172.4 ⫾ 8.0 287.6 ⫾ 145.1 213.2 ⫾ 110.4 63.15 ⫾ 39.6 0.0 ⫾ 0.0 35.5 ⫾ 4.3 83.2 ⫾ 2.3 1435.9 ⫾ 414.7 154.6 ⫾ 84.5 147.9 ⫾ 61.5 0.0 ⫾ 0.0 264.3 ⫾ 61.7 2256.9 ⫾ 217.9 202.6 ⫾ 16.7 0.0 ⫾ 0.0 0.0 ⫾ 0.0 332.7 ⫾ 20.5 356.3 ⫾ 37.1 381.9 ⫾ 264.2

850.2 ⫾ 148.9 1227.9 ⫾ 177.5 535.8 ⫾ 48.6 1689.2 ⫾ 671.2 1016.4 ⫾ 72.5 173.3 ⫾ 12.3 858.8 ⫾ 116.1 3470.2 ⫾ 854.0 980.4 ⫾ 72.9 4285.1 ⫾ 895.5 1579.7 ⫾ 631.9 443.5 ⫾ 17.4 172.0 ⫾ 1.9 1685.7 ⫾ 28.9 5109.2 ⫾ 297.9 457.1 ⫾ 43.6 44.0 ⫾ 14.2 198.9 ⫾ 29.6 1937.4 ⫾ 108.8 2846.8 ⫾ 271.0 2719.0 ⫾ 257.1

1812.5 ⫾ 107.5 2224.5 ⫾ 115.5 637.7 ⫾ 99.2 1543.8 ⫾ 549.1 895.8 ⫾ 267.8 498.1 ⫾ 73.9 452.9 ⫾ 88.9 2254.6 ⫾ 1414.9 449.0 ⫾ 21.7 6135.1 ⫾ 1704.8 2325.9 ⫾ 453.1 462.1 ⫾ 120.6 237.9 ⫾ 32.9 2793.8 ⫾ 185.6 5093.0 ⫾ 804.4 681.9 ⫾ 69.9 63.2 ⫾ 9.2 581.9 ⫾ 50.1 2669.3 ⫾ 1296.3 2928.4 ⫾ 126.1 2376.8 ⫾ 419.4

2590.5 ⫾ 132.5 333.8 ⫾ 81.5 996.2 ⫾ 95.0 325.1 ⫾ 173.8 2349.9 ⫾ 407.4 3916.8 ⫾ 425.3

499.8 ⫾ 215.6 0.0 ⫾ 0.0 222.6 ⫾ 74.5 0.0 ⫾ 0.0 573.8 ⫾ 357.7 289.1 ⫾ 75.0

602.5 ⫾ 338.5 0.0 ⫾ 0.0 112.7 ⫾ 4.4 0.0 ⫾ 0.0 686.1 ⫾ 213.7 330.8 ⫾ 55.3

NOTE. This table contains proteins displaying less than a 3-fold difference in expression level between in vivo and in vitro activated stellate cells. The results are means of 3 independent experiments ⫾ SD. The intensities are arbitrary densitometric values that were calculated by the 2-D gel analysis software (Melanie II). * Protein found in cellular fraction. † Protein found in medium fraction. ‡ Observation was documented previously elsewhere (see Results). ¶ Observation was directly confirmed in fibrotic liver tissues.

revealed a 1.6- to 3.3-fold up-regulation of galectin-1, calcyclin, and calgizzarin in the fibrotic endothelial cells and Kupffer cells (data not shown). In comparison, these proteins displayed a 6.8- to 18-fold up-regulation in fibrotic stellate cells (Table 1), and furthermore the concentrations of these proteins were at least twice as high in the fibrotic stellate cells as compared with those in Kupffer cells and endothelial cells (data not shown). Although Kupffer cells and endothelial cells show higher occupancy rates (8.5% and 21%, respectively) than the stellate cells (5.5%),16 we concluded that stellate cells were the main contributors to the up-regulation of galectin-1, calcyclin, and calgizzarin in fibrotic liver tissues. Northern Blotting. As described above we identified proteins whose quantities were similarly altered in both in vivo and in vitro activated stellate cells. To determine whether the expressions of these proteins were regulated at the mRNA level, we performed Northern blot analysis on the representative proteins, calcyclin, calgizzarin, and galectin-1. As shown in Fig. 4 the mRNA levels of these genes were increased in both in vivo and in vitro activated stellate cells, thus indicating that the up-regulation of these proteins was controlled at the mRNA level. Reconfirmation of Previous Findings. This study recapitulated 9 previous observations related to stellate cell activation and

liver fibrogenesis (proteins marked ‡ in Table 1). These include up-regulation of smooth muscle ␣-actin,17,18 72-kd type IV collagenase,19 collagen type I/III,20-22 neural cell adhesion molecule,23 and secreted protein acidic and rich in cysteine (SPARC),24,25 as well as down-regulation of stromelysin-1 in activated stellate cells (Table 1).26 It should be noted, however, that this study confirmed these findings by direct visualization and identification of proteins, and the data thus represent the most direct quantitative and qualitative evidence that these changes take place at the protein level. The upregulation of smooth muscle ␣-actin provided evidence that the stellate cells derived from fibrotic livers were actually activated. In addition to these well-established observations 17 novel findings are presented in Table 1 (not marked with ‡), including the up-regulation of F-actin capping protein ␤, and ␥-enolase, as well as the down-regulation of ␣-1-antiproteinase (␣-1-antitrypsin), and HPAST protein. Random Identification of Proteins From Stellate Cells. Protein identification was not only restricted to proteins displaying activation-associated expressions. To gain a more general overview of the stellate cell, proteome spots in Figs. 1 and 2 were randomly chosen for identification, and currently a total of 312 proteins have been successfully identified (Table 3). These include 229 cellular proteins and 83 secreted proteins.

274 KRISTENSEN ET AL.

HEPATOLOGY August 2000

TABLE 2. Cellular Proteins Showing Different Expression Levels between In Vivo and In Vitro Activated Stellate Cells Protein

Quiescent Stellate Cells

In Vivo Activated Stellate Cells

In Vitro Activated Stellate Cells

Actin variant, 20 kd Actin variant, 40 kd CBP-50 Cofilin Destrin FK506 binding protein 6 Heat shock protein HSP 90-␤ Myosin regulatory light chain 2 variant Dimethylargininase 1 5⬘ nucleotidase SPARC* Phosphoglycerate kinase Placental calcium-binding protein Proteasome delta chain Reticulocalbin RHO GDP-dissociation inhibitor 2

1565.1 ⫾ 618.8 977.6 ⫾ 61.9 175.3 ⫾ 36.7 61.4 ⫾ 36.6 31.6 ⫾ 20.8 0.0 ⫾ 0.0 0.0 ⫾ 0.0 81.5 ⫾ 34.2 24.0 ⫾ 4.2 157.9 ⫾ 55.0 0.0 ⫾ 0.0 43.8 ⫾ 15.8 0.0 ⫾ 0.0 0.0 ⫾ 0.0 41.4 ⫾ 1.9 371.0 ⫾ 136.1

760.7 ⫾ 194.7 591.6 ⫾ 65.7 243.9 ⫾ 93.4 126.9 ⫾ 25.7 39.5 ⫾ 24.0 0.0 ⫾ 0.0 0.0 ⫾ 0.0 92.8 ⫾ 30.2 74.4 ⫾ 28.0 204.5 ⫾ 5.05 0.0 ⫾ 0.0 72.3 ⫾ 7.3 0.0 ⫾ 0.0 55.6 ⫾ 12.9 61.9 ⫾ 6.4 229.45 ⫾ 0.7

99.8 ⫾ 22.0 108.8 ⫾ 22.6 968.0 ⫾ 118.2 849.4 ⫾ 408.1 326.7 ⫾ 122.2 910.2 ⫾ 97.8 227.4 ⫾ 6.4 571.9 ⫾ 60.6 521.9 ⫾ 70.6 860.5 ⫾ 152.3 543.8 ⫾ 0.0 652.9 ⫾ 74.7 222.5 ⫾ 31.5 282.5 ⫾ 21.85 316.9 ⫾ 45.6 19.1 ⫾ 3.6

NOTE. This table contains proteins displaying a 3-fold or bigger difference in expression level between in vivo and in vitro activated stellate cells. The results are means of 3 independent experiments ⫾ SD. The intensities are arbitrary densitometric values that were calculated by the 2-D gel analysis software (Melanie II). * Although SPARC is a secreted protein it was also found in the cellular lysate of in vitro activated stellate cells. This SPARC most likely represents an insoluble form bound to ECM molecules, such as collagens, that accumulated during the 9 days of in vitro culture. Very little ECM was present in dishes of in vivo activated stellate cells since they were cultured only for 3 hours, and this may explain the absence of SPARC in these samples, although in vivo activated stellate cells clearly secreted SPARC (Table 1).

The 312 spots were found to be products of 156 different genes, because a single gene often yielded multiple protein spots on a 2-D gel. These spots represented protein variants derived from alternative splicing, post-translational modifications such as glycosylation and phosphorylation, protein degradation, or artificial chemical modifications during sample preparation. For instance, collagen ␣1 (I) displayed multiple spots with similar molecular weights but different isoelectric points on the 2-D gels (Fig. 2). It is most likely that the collagen ␣1 (I) chains were heterogeneously charged because of O-glycosylation of hydroxylysine residues. Similar variants were also seen for stromelysin-1 and serine protease inhibitor 3 (Fig. 2).

FIG. 3. Silver-stained 2-D gels showing the expression levels of galectin-1, calcyclin, and calgizzarin in liver tissues. Normal and fibrotic livers were obtained from untreated rats and rats treated with CCl4 for 8 weeks, respectively. A total of 400 ␮g protein was applied per IPG gel. (A) Normal liver. (B) Fibrotic liver. A clear up-regulation of galectin-1, calcyclin, and calgizzarin was seen in the fibrotic liver tissues.

FIG. 4. Northern blots of mRNAs of calcyclin, calgizzarin, and galectin-1. Each lane was loaded with 20 ␮g of total RNA extracted from either quiescent, in vitro, or in vivo activated stellate cells. The up-regulation of these 3 mRNAs confirmed the protein-level observations shown in Fig. 1 and Table 1. GAPDH and ribosomal RNA were used as internal controls.

HEPATOLOGY Vol. 32, No. 2, 2000

KRISTENSEN ET AL.

275

TABLE 3. Identified Proteins from Rat Hepatic Stellate Cells Name (Accession Number, c*/s†)

Name (Accession Number, c*/s†)

Name (Accession Number, c*/s†)

14-3-3 Protein ␤/␣ (P35213, c) 14-3-3 Protein ␧ (P29360, c) 14-3-3 Protein ␩ (P11576, c) 14-3-3 Protein ␥ (P35214, c) 14-3-3 Protein ␶ (P35216, c) 14-3-3 Protein ␰/␦ (P35215, c) 40S Ribosomal protein S12 (P09388, c) 40S Ribosomal protein SA (P38983, c) 60S Acidic ribosomal protein P2 (P02401, c) 60S Acidic ribosomal protein PO (P19945, c) 72 kDa type IV collagenase (P33436, s) 78 kDa Glucose regulated protein (P06761, s) ACP-binding protein EB1 (AA925661, c) Adenine phophoribosyltransferase (P36972, c) Aldehyde dehydrogenase (P11884, c) Aldehyde dehydrogenase, E3 isozyme (P49189, c) Aldose reductase (P07943, c) ␣-enolase (P04764, c) ␣-glycosidase II ␣ (MMU92799, c) ␣-1-antiproteinase (P34955, s) ␣-S1 casein (P02662, s) Aminoacylase-1 (Q03154, c) Annexin III (P14669, c) Annexin IV (P55260, c) Annexin V (P14668, c) Annexin VI (P48037, c) Antioxidant protein 2 (O08709, c) APG-2 (Q61316, c) Aryl sulfotransferase (P17988, c) ␤-actin (P02570, c) Bithoraxoid-like protein (AF073839, c) Calcium-dependant protease (P04632, c) Calcyclin (P05964, c, s) Caldesmon non muscle (Q62736, c) Calgizzarin (P50543, c, s) Calreticulin (P18418, c) Carbamoyl-phosphate synthase (P07756, c) Cartilage-associated CASP protein (MMAJ6469, c) Catechol o-methyltransferase membrane (P22734, c) Cathepsin B (P00787, s) Cathepsin D (P18242, s) CBP-50 protein (O35783, c) Chloride intracellular channel protein (O00299, c) Chlorine channel protein P64 (P35526, c) Cofilin non-muscle (P45592, c) Collagen ␣1 (I) (P02454, s) Collagen ␣1 (I) (Q63079, s) Collagen ␣1 (III) (P13941, s) Collagen ␣2 (I) (P08123, s) Complement cis component (P09871, c) Creatine kinase B (P07335, c) Cystatin B (P01041, c)

Cytochrome C oxidase polypeptide VA (P11240, c) Destrin (P18282, c) Dihydropyrimidinase related protein 2 (P47942, c) Elongation factor 1-delta (P29692, c) Endoplasmin (P11427, c) ERP60 (P11598, c) Expressed sequence tag (AA376979, c) Expressed sequence tag (AA407205, c) Expressed sequence tag (AA892278, s) Eukaryotic initiation factor 4A-II (P10630, c) F-actin capping protein ␣-1 (P47753, c) Farnesyl pyrophosphate synthetase (P05369, c) FK506 binding protein 6 (Q61575, c) Galactokinase 1 (P51570, c) Galectin-1 (P11762, c, s) Gelsolin (P13020, c) Gelsolin plasma (P06396, c) ␥-actin (P02571, c) Ganglioside GM2 (Q60648, s) Guanine aminohydrolase protein (AF026472, c) Guanine nucleotide-binding protein G (I) ␣ 2 (P04897, c) Heat shock 27 kDa protein (P42930, c) Heat shock cognate 71 kDa protein (P08109, c) Heat shock protein HSP 90 (P34955, c) Heat shock protein HSP 90-␤ (P34058, c) Heat shock-related protein (P14659, c) Hint protein (P70349, c) Hpast protein (AF001434, c) Importin ␤ I (P52296, c) Initiation factor 5A (P10159, c) Keratin, type II cytoskeletal 1 (P04264, c) Keratin, type II cytoskeletal 2 (P35908, c) Lactoylglutathione lyase (P78375, c) Liver carboxylesterase 10 (P16303, c) Lumican (P51886, s) Malate dehydrogenase cytoplasmic (P04925, c) Mitochondiral matrix protein P1 (P19227, c) Mitochondrial stress-70 protein (P48721, c) Myo-inositol-1-monophosphatase (P29218, c) Myosin light alkali (Q64119, c) Myosin regulatory light chain (Q63781, c) Myotrophin (P80144, c) Neural cell adhesion molecule L1 (Q05695, c) Dimethylargininase 1 (O08557, c) Non-muscle caldesmon (Q62736, c) Non-muscle myosin heavy A (Q62812, c) Nucleolar phoshoprotein B23 (P13084, c) 5⬘ Nucleotidase (P21588, c) Oesteonectin (O08953, c) Ornithine aminotransferase (P04182, c) Phosphatidylethanolamine-binding protein (P31044, c) Phosphatidylinositol transfer protein ␣ (P16446, c)

Phosphoglycerate kinase (P16617, c) Placental calcium-binding protein (P05942, c) Plasminogen activator inhibitor-1 (P20961, s) Platelet activator factor (Q61206, c) Probable protein disulfide isomerase ER60 (P1 1589, c) Prohibitin (P24142, c) Proliferating cell nuclear antigen (P04961, c) Prolyl 4-hydroxylase ␣ (P54001, c) Prolyl 4-hydroxylase ␣ II (Q60716, c) Proteasome activator RPA 28 ␣ (Q63797, c) Proteasome activator RPA 28 ␤ (Q63798, c) Proteasome component C8 (P18422, c) Proteasome ␦ (P28073, c) Proteasome ␰ (P34064, c) Protein disulfide isomerase (P04785, c) Putative ␤-actin (Q64316, c) Pyruvate dehydrogenase E1 component ␤ (P49432, c) Pyruvate kinase M1 (P11980, c) Reticulocalbin (Q05186, c) Retinol-binding protein 1 cellular (P02696, c) RHO GDP-dissociation inhibitor 2 (Q61599, c) Serine protease (D88250, s) Serine protease inhibitor 3 (P09006, s) SET ␤ (Q63945, c) Smooth muscle ␣-actin (P03996, c) Sorcin (P30626, c) SPARC (P16975, c) Stathmin (P13668, c) Stromelysin-1 (P03957, c) Sulfated glycoprotein 1 (P10960, s) Superoxide dismutase (Cu/Zn) (P07632, c) T-complex protein I ␣ (P28480, c) T-complex protein I ␧ (P48643, c) TER ATPase (P46462, c) Tetranectin (P43025, s) Thioredoxin (P11232, c) Thioredoxin peroxidase 1 (P35704, c) Thioredoxin-like protein (AF003938, c) Thioredoxin-like protein (HSA010841, c) Thymosin ␤-10 (P13472, c) Translationally controlled tumor protein (P14701, c) Tropomyosin (Q63601, c) Tropomyosin 4 embryonic fibroblast (P09495, c) Tropomyosin fibroblast 1 (P06395, c) Tropomyosin fibroblast 2 (P19354, c) Tubulin ␣-1 (P02551, c) Tubulin ␤ (P04691, c) Ubiquitin (P02248, c) Ubiquitin-conjugating enzyme E2 (Q16781, c) UMP-CMP kinase (Q29561, c) Vimentin (P31000, c) Vinculin (P18206, c)

NOTE. For further information on proteins access SwissProt (http://www.expasy.ch/cgi-bin/sprot-search-ac) or Genbank (http://www.ncbi.nlm.nih.gov/Entrez/-protein.html) using the listed accession numbers. Numbers starting with O, P, or Q are from SwissProt. The remaining are from GenBank. * Protein found in cellular fraction. † Protein found in medium fraction.

DISCUSSION Partial Proteome of Stellate Cells. In the present study we performed proteome analysis of rat hepatic stellate cells by separating their proteins on 2-D gels, and currently we have identified 312 polypeptides/proteins from the stellate cells. The complete stellate cell proteome consists of several thousand proteins, and consequently this study only highlighted some of the changes associated with hepatic stellate cell activation. Stellate Cell Activation and Remodeling of the ECM. Liver fibrosis is characterized by an increased deposition of fibril-forming collagens, primarily type I and III,27,28 and previous studies showed that activated stellate cells were a key source of

these proteins.22,29 This study confirmed these findings by showing that the activation of stellate cells resulted in increased levels of both collagen type I and III chains, as well as the corresponding C-terminal propeptides. Concurrently, we observed an up-regulation of type IV collagenase (MMP-2), and a down-regulation of stromelysin-1 (MMP-3) in agreement with earlier findings.26,28,30 Type IV collagenase is mainly responsible for the degradation of collagen type IV and proteins of the basement membrane, whereas stromelysin-1 can degrade collagen type III and activate procollagenases. These results support the general belief that ECM remodeling during fibrogenesis reflects changes in both matrix produc-

276 KRISTENSEN ET AL.

tion and matrix degradation.28 Taken together, the results in Table 1 revealed that the extracellular proteolytic activity changes radically in association with the stellate cell activation. For instance, this study showed that productions of serine protease inhibitor 3 and ␣-1-antiproteinase were downregulated in the activated stellate cells, whereas cathepsin D and serine protease were up-regulated. The functions of these proteins in liver fibrogenesis are unclear at present, but they may be involved in ECM remodeling or in proteolytic activation of precursor proteins, such as the latent transforming growth factor ␤ precursor.31 It is well documented that ␣-1antiproteinase deficiency is implicated in several liver disorders.32-36 We showed in this study that the stellate cells produce this protein. Stellate Cell Activation and Production of Growth Factors. During fibrogenesis, stellate cells display altered growth and proliferation as a result of paracrine and autocrine stimuli.1-3 Furthermore, the activated stellate cells are known to influence the growth and proliferation of other cell types, particularly hepatocytes, through paracrine effects.2 Several growth factors including transforming growth factor ␤ and PDGF have been reported to stimulate the proliferation and transformation of stellate cells.1 The present study shows that the 3 growth- and proliferation-associated proteins, calcyclin, calgizzarin, and galectin-1, become heavily up-regulated in the activated stellate cells. These results were also directly confirmed in fibrotic liver tissues as shown in Fig. 3. Calcyclin and calgizzarin are both calcium-binding proteins that belong to the S100 protein family.37-40 Calcyclin levels are increased in proliferating fibroblasts and colon carcinomas,40-42 and calgizzarin is overexpressed in colon cancers, indicating their growth-promoting role.43,44 Galectin-1 belongs to the family of ␤-galactoside-binding lectins, which have been implicated in growth regulation, cell adhesion, migration, apoptosis, neoplastic transformation, and immune responses.45 This protein has been reported to regulate lymphocyte proliferation by binding to cytokines, such as interleukin 2.45 Consequently, the up-regulation of galectin-1 in activated stellate cells strongly suggests some role(s) in regulating the growth of stellate cells as well as other cells in the chronically damaged liver. The secretions of galectin-1, calcyclin, and calgizzarin were also clearly enhanced in media of activated stellate cells as compared with media of normal stellate cells (Fig. 2). Therefore, it is plausible that these proteins are actively secreted also in vivo and they may thus regulate the growth and proliferation of cells in the damaged liver via paracrine and autocrine mechanisms. Consequently, these 3 proteins are strong candidates for further investigations. The present study showed increased levels of mRNAs of calcyclin, calgizzarin, and galectin-1 in activated stellate cells, thus indicating that the up-regulation of these proteins was controlled at the mRNA level. At present we have not performed Northern blot analysis for other genes of the proteins listed in Table 1. However, it is plausible that most of the changes listed in Table 1 were regulated at the mRNA level, because we found no indication that post-translational processing was responsible for the changes observed on the 2-D gels. However, 2 potential exceptions were 40-kd and 20-kd ␤-actin variants that were clearly down-regulated in in vitro activated stellate cells (Table 2). Although it is unclear at present, they may represent degradation products of mature ␤-actin (42 kd).

HEPATOLOGY August 2000

Quiescent versus Activated Stellate Cells In Vitro. Stromelysin-1 was an example of down-regulated proteins secreted by in vivo and in vitro activated stellate cells (Table 1 and Fig. 2). This enzyme was intensively expressed and secreted by fresh isolates (days 1-3 in serum-free culture) and its secretion was markedly reduced during the in vitro activation. However, Vyas et al.26 showed that freshly isolated quiescent stellate cells did not express stromelysin-1 at the mRNA level, and the expression was up-regulated during their early in vitro activation (from days 3 to 5 in their study).26 This apparent contradiction can be explained as follows. In the present study the stellate cells were cultured in serum-free medium, in contrast to the study by Vyas et al. in which the cells were cultured in serum-containing medium.26 The hostile serum-free environment might act as a strong inducer of stellate cell activation, and consequently the stellate cells prepared from normal liver might be activated even in the early period of cultivation (from days 1 to 3 in the present study), although we referred to them as quiescent stellate cells. Thus, some proteins, such as stromelysin-1 and serine protease inhibitor 3, might be expressed at high levels in the quiescent stellate cells in our study. Even with this limitation, the down-regulation of stromelysin-1 observed in both in vivo and in vitro activated stellate cells, might have some physiologic significance because Vyas et al. reported that this protein was down-regulated in advanced stages of activation.26 Activation of Stellate Cells In Vitro Versus Activation In Vivo. A major unresolved question in the biology of hepatic stellate cells has been if activation of these cells in vitro by culturing the cells on plastic adequately represents activation of these cells following a fibrogenic stimulus in vivo. The present study could partly address this question. The data presented in Tables 1 and 2 demonstrated that about 60% of the identified proteins showed similar changes in vivo and in vitro. However, the remaining showed different changes, most of them being up-regulated in the in vitro activated stellate cells but not in the in vivo activated cells. Therefore, it should be mentioned that the in vitro model of stellate cells might be useful for relatively many proteins expressed by these cells, but some of the proteins change their expressions because of the adaptation to the in vitro environment. Conclusion. In summary the current investigation used a proteome approach in the study of stellate cells and their activation in response to liver injury. This study identified 43 proteins whose expression levels were altered in in vivo and/or in vitro activated stellate cells, and 17 of the proteins displaying similar changes in both models represented novel observations. In addition, over 150 proteins expressed in the stellate cell were identified. These identified proteins should be useful for the characterization of hepatic stellate cells at the level of protein expression. The data compiled in this study therefore clearly show the analytical power of the proteome approach. Furthermore, the findings presented here provide a solid foundation for new and more functionally oriented projects, which could contribute to the development of effective therapies against liver fibrosis.

Acknowledgment: The authors thank Ryoko Terada for typing the manuscript. REFERENCES 1. Kawada N. The hepatic perisinusoidal stellate cell. Histol Histopathol 1997;12:1069-1080.

HEPATOLOGY Vol. 32, No. 2, 2000 2. Gressner AM. The cell biology of liver fibrogenesis—an imbalance of proliferation, growth arrest and apoptosis of myofibroblasts. Cell Tissue Res 1998;292:447-452. 3. Olaso E, Friedman SL. Molecular regulation of hepatic fibrogenesis. J Hepatol 1998;29:836-847. 4. Kahn P. From genome to proteome: looking at a cell’s proteins. Science 1995;270:369-370. 5. Anderson NL, Anderson NG. Proteome and proteomics: new technologies, new concepts, and new words. Electrophoresis 1998;19:1853-1861. 6. O’Farrell PH. High resolution two-dimensional electrophoresis of proteins. J Biol Chem 1975;250:4007-4021. 7. Roepstorff P. Mass spectrometry in protein studies from genome to function. Curr Opin Biotechnol 1997;8:6-13. 8. Yates JR, 3rd. Mass spectrometry and the age of the proteome. J Mass Spectrom 1998;33:1-19. 9. Humphery Smith I, Blackstock W. Proteome analysis: genomics via the output rather than the input code. J Protein Chem 1997;16:537-544. 10. Kawada N, Tran-Thi TA, Klein H, Decker K. The contraction of hepatic stellate (Ito) cells stimulated with vasoactive substances. Possible involvement of endothelin 1 and nitric oxide in the regulation of the sinusoidal tonus. Eur J Biochem 1993;213:815-823. 11. Kristensen DB, Imamura K, Miyamoto Y, Yoshizato K. Mass spectrometric approaches for the characterization of proteins on a hybrid quadrupole time-of-flight (Q-TOF) mass spectrometer. Electrophoresis 2000; 21:430-439. 12. Rabilloud T, Valette C, Lawrence JJ. Sample application by in-gel rehydration improves the resolution of two-dimensional electrophoresis with immobilized pH gradients in the first dimension. Electrophoresis 1994; 15:1552-1558. 13. Sanchez JC, Rouge V, Pisteur M, Ravier F, Tonella L, Moosmayer M, Wilkins MR, et al. Improved and simplified in-gel sample application using reswelling of dry immobilized pH gradients. Electrophoresis 1997; 18:324-327. 14. Neubauer K, Knittel T, Aurisch S, Fellmer P, Ramadori G. Glial fibrillary acidic protein—a cell type specific marker for Ito cells in vivo and in vitro. J Hepatol 1996;24:719-30. 15. Collier DS, Pain JA, Wight DG, Lovat P, Bailey ME. The Kupffer cell in experimental extrahepatic cholestasis in the rat—a light microscopy, immunohistochemical and electron microscopy study. J Pathol 1986; 150:187-194. 16. Pertoft H, Smedsrød B. Separation and characterization of liver cells. In: Pretlow TG, Pretlow TP, eds. Cell separation: methods and selected applications. Volume 4., New York: Academic Press, 1982;1-24. 17. Ramadori G, Veit T, Schwogler S, Dienes HP, Knittel T, Rieder H, Meyer zum Buschenfelde KH. Expression of the gene of the alpha-smooth muscle-actin isoform in rat liver and in rat fat-storing (ITO) cells. Virchows Arch B Cell Pathol Incl Mol Pathol 1990;59:349-357. 18. Rockey DC, Boyles JK, Gabbiani G, Friedman SL. Rat hepatic lipocytes express smooth muscle actin upon activation in vivo and in culture. J Submicrosc Cytol Pathol 1992;24:193-203. 19. Arthur MJ, Stanley A, Iredale JP, Rafferty JA, Hembry RM, Friedman SL. Secretion of 72 kDa type IV collagenase/gelatinase by cultured human lipocytes. Analysis of gene expression, protein synthesis and proteinase activity. Biochem J 1992;287:701-707. 20. Maher JJ, Friedman SL, Roll FJ, Bissell DM. Immunolocalization of laminin in normal rat liver and biosynthesis of laminin by hepatic lipocytes in primary culture. Gastroenterology 1988;94:1053-1062. 21. Milani S, Herbst H, Schuppan D, Kim KY, Riecken EO, Stein H. Procollagen expression by nonparenchymal rat liver cells in experimental biliary fibrosis. Gastroenterology 1990;98:175-184. 22. Milani S, Herbst H, Schuppan D, Surrenti C, Riecken EO, Stein H. Cellular localization of type I III and IV procollagen gene transcripts in normal and fibrotic human liver. Am J Pathol 1990;137:59-70. 23. Knittel T, Aurisch S, Neubauer K, Eichhorst S, Ramadori G. Cell-typespecific expression of neural cell adhesion molecule (N-CAM) in Ito cells of rat liver. Up-regulation during in vitro activation and in hepatic tissue repair. Am J Pathol 1996;149:449-462.

KRISTENSEN ET AL.

277

24. Frizell E, Liu SL, Abraham A, Ozaki I, Eghbali M, Sage EH, Zern MA. Expression of SPARC in normal and fibrotic livers. HEPATOLOGY 1995;21: 847-854. 25. Blazejewski S, Le Bail B, Boussarie L, Blanc JF, Malaval L, Okubo K, Saric J, et al. Osteonectin (SPARC) expression in human liver and in cultured human liver myofibroblasts. Am J Pathol 1997;151:651-657. 26. Vyas SK, Leyland H, Gentry J, Arthur MJ. Rat hepatic lipocytes synthesize and secrete transin (stromelysin) in early primary culture. Gastroenterology 1995;109:889-898. 27. Arthur MJ. Collagenases and liver fibrosis. J Hepatol 1995;22:43-48. 28. Arthur MJ. Degradation of matrix proteins in liver fibrosis. Pathol Res Pract 1994;190:825-833. 29. Maher JJ, Bissell DM, Friedman SL, Roll FJ. Collagen measured in primary cultures of normal rat hepatocytes derives from lipocytes within the monolayer. J Clin Invest 1988;82:450-459. 30. Herbst H, Heinrichs O, Schuppan D, Milani S, Stein H. Temporal and spatial patterns of transin/stromelysin RNA expression following toxic injury in rat liver. Virchows Arch B Cell Pathol Incl Mol Pathol 1991;60: 295-300. 31. Okuno M, Moriwaki H, Imai S, Muto Y, Kawada N, Suzuki Y, Kojima S. Retinoids exacerbate rat liver fibrosis by inducing the activation of latent TGF-beta in liver stellate cells. HEPATOLOGY 1997;26:913-921. 32. Cohen C, Derose PB. Liver cell dysplasia in alpha-1-antitrypsin deficiency. Mod Pathol 1994;7:31-36. 33. Ghishan FK, Greene HL. Liver disease in children with PiZZ alpha 1-antitrypsin deficiency. HEPATOLOGY 1988;8:307-310. 34. Nakhleh RE, Snover DC. Use of alpha-1-antitrypsin staining in the diagnosis of nodular regenerative hyperplasia of the liver. Hum Pathol 1988; 19:1048-1052. 35. Nebbia G, Hadchouel M, Odievre M, Alagille D. Early assessment of evolution of liver disease associated with alpha 1- antitrypsin deficiency in childhood. J Pediatr 1983;102:661-665. 36. Nemeth A, Strandvik B, Glaumann H. Alpha-1-antitrypsin deficiency and juvenile liver disease. Ultrastructural observations compared with light microscopy and routine liver tests. Virchows Arch B Cell Pathol Incl Mol Pathol 1983;44:15-33. 37. Todoroki H, Kobayashi R, Watanabe M, Minami H, Hidaka H. Purification, characterization, and partial sequence analysis of a newly identified EF-hand type 13-kDa Ca(2⫹)-binding protein from smooth muscle and non-muscle tissues. J Biol Chem 1991;266:18668-18673. 38. Watanabe M, Ando Y, Todoroki H, Minami H, Hidaka H. Molecular cloning and sequencing of a cDNA clone encoding a new calcium binding protein, named calgizzarin, from rabbit lung. Biochem Biophys Res Commun 1991;181:644-649. 39. Ferrari S, Calabretta B, deRiel JK, Battini R, Ghezzo F, Lauret E, Griffin C, et al. Structural and functional analysis of a growth-regulated gene, the human calcyclin. J Biol Chem 1987;262:8325-8332. 40. Niki I, Okazaki K, Iino S, Kobayashi S, Hidaka H. Calcyclin, a calciumbinding protein, which regulates insulin secretion from the permeabilized pancreatic beta-cell. Adv Exp Med Biol 1997;426:85-89. 41. Breen EC, Fu Z, Normand H. Calcyclin gene expression is increased by mechanical strain in fibroblasts and lung. Am J Respir Cell Mol Biol 1999;21:746-752. 42. Komatsu K, Andoh A, Ishiguro S, Suzuki N, Hunai H, Kobune-Fujiwara Y, Kameyama M, et al. Increased expression of S100A6 (Calcyclin), a calcium-binding protein of the S100 family, in human colorectal adenocarcinomas. Clin Cancer Res 2000;6:172-177. 43. Tomasetto C, Regnier C, Moog-Lutz C, Mattei MG, Chenard MP, Lidereau R, Basset P, et al. Identification of four novel human genes amplified and overexpressed in breast carcinoma and localized to the q11-q21.3 region of chromosome 17. Genomics 1995;28:367-376. 44. Tanaka M, Adzuma K, Iwami M, Yoshimoto K, Monden Y, Itakura M. Human calgizzarin: one colorectal cancer-related gene selected by a large scale random cDNA sequencing and northern blot analysis. Cancer Lett 1995;89:195-200. 45. Perillo NL, Marcus ME, Baum LG. Galectins: versatile modulators of cell adhesion, cell proliferation, and cell death. J Mol Med 1998;76:402-412.