- Email: [email protected]
Protozoan grazing reduces the current output of microbial fuel cells
Bioresource Technology 193 (2015) 8–14
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Protozoan grazing reduces the current output of microbial fuel cells Dawn E. Holmes a,b,⇑, Kelly P. Nevin a, Oona L. Snoeyenbos-West a, Trevor L. Woodard a, Justin N. Strickland a, Derek R. Lovley a a b
Department of Microbiology, University of Massachusetts, Amherst, MA, United States Department of Physical and Biological Sciences, Western New England University, Springfield, MA, United States
h i g h l i g h t s Inhibition of eukaryotic grazing increased power output of sediment MFC 2–5-fold. Geobacteraceae and Euplotes were enriched on current-harvesting anodes. Anaerobic protozoa prey on G. sulfurreducens in pure culture studies. Protozoan grazing can reduce current up to 91% in G. sulfurreducens fuel cells. Anode biofilms are 4-fold thinner in fuel cells with protozoa.
a r t i c l e
i n f o
Article history: Received 28 April 2015 Received in revised form 9 June 2015 Accepted 12 June 2015 Available online 17 June 2015 Keywords: Sediment fuel cell Anaerobic protozoa Geobacteraceae
a b s t r a c t Several experiments were conducted to determine whether protozoan grazing can reduce current output from sediment microbial fuel cells. When marine sediments were amended with eukaryotic inhibitors, the power output from the fuel cells increased 2–5-fold. Quantitative PCR showed that Geobacteraceae sequences were 120 times more abundant on anodes from treated fuel cells compared to untreated fuel cells, and that Spirotrichea sequences in untreated fuel cells were 200 times more abundant on anode surfaces than in the surrounding sediments. Defined studies with current-producing biofilms of Geobacter sulfurreducens and pure cultures of protozoa demonstrated that protozoa that were effective in consuming G. sulfurreducens reduced current production up to 91% when added to G. sulfurreducens fuel cells. These results suggest that anode biofilms are an attractive food source for protozoa and that protozoan grazing can be an important factor limiting the current output of sediment microbial fuel cells. Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Although many applications have been proposed for microbial fuel cells, powering electronic monitoring devices with energy harvested from marine sediments is one of the few applications that appear to be currently practical (Franks and Nevin, 2010; Logan, 2009). However, the output of sediment fuel cells is relatively low (4–55 mW/m2) (Girguis et al., 2010), which has led to many investigations designed to identify factors limiting current production in order to develop strategies to increase current output and expand the types of devices that can be powered with sediment fuel cells.
⇑ Corresponding author at: Department of Microbiology, 203N Morrill Science Center IVN, University of Massachusetts Amherst, Amherst, MA 01003, United States. Tel.: +1 413 577 2439; fax: +1 413 577 4660. E-mail address: [email protected] (D.E. Holmes).
One strategy to enhance power output is to increase the anode surface area available for microbial colonization. Unfortunately, studies have shown that as the surface area is increased the power output may not scale linearly (Ewing et al., 2014) and large surface anodes are unwieldy and difficult to deploy. Another approach is to increase the supply of electron donor to anode microbes. Current output can be directly related to the rate that fermentable organic matter is degraded within sediments (Wardman et al., 2014; Williams et al., 2010), which can be increased with the addition of particulate organic matter (i.e. cellulose, chitin, or algal biomass) that can be fermented to electron donors that will support current production (Cui et al., 2014; Rashid et al., 2013; Rezaei et al., 2009). However, the technical difficulty of amending sediments with organic material, especially in deep environments, as well as the need for repeated additions of the organics for long-term deployments, limits the applicability of this approach. Another approach is to provide electron donors for current production within the anode itself (Nevin et al., 2011), but this strategy is not applicable
http://dx.doi.org/10.1016/j.biortech.2015.06.056 0960-8524/Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
for the multi-year operation desired for many applications of sediment fuel cells. A proven strategy for increasing current densities in laboratory studies is to colonize anodes with those microorganisms that have the most effective current production capabilities. Characteristics that confer high current densities include the ability to directly transfer electrons to electrodes and the formation of electrically conductive biofilms that permit cells that are part of the anode biofilm but not in direct contact with anodes to contribute to current production (Lovley, 2012). To date, the combination of these characteristics has only been documented in members of the Geobacteraceae (Malvankar and Lovley, 2014). The common predominance of Geobacteraceae on anodes harvesting current from sediments and other environments suggests that microorganisms with these favorable characteristics already have a competitive advantage in colonizing anodes in many instances (Lovley, 2012). In laboratory studies it is possible to genetically engineer microorganisms with improved current capabilities (Leang et al., 2013), but the feasibility of preemptively colonizing anodes of sediment fuel cells with engineered microbes has not been intensively investigated. In open environments, such as sediments, there may be factors other than substrate availability limiting the growth of Geobacteraceae in anode biofilms. For example, when the growth of Geobacter species in the subsurface was stimulated with the addition of high concentrations of electron donor in the form of acetate, a bloom of protozoa accompanied increases in Geobacter growth and substantially lowered the accumulation of Geobacter biomass below that expected in the absence of protozoan grazing (Holmes et al., 2013). An anode biofilm also represents a substantial enrichment of Geobacteraceae likely to enhance grazing opportunities for protozoa. Amoeboid protozoa have been shown to consume bacteria within a biofilm at rates of 1465 bacteria h1 (Rogerson et al., 1996) and mixed cultures of amoeba and flagellates can consume 55–75% of the cells comprising a biofilm (Zubkov and Sleigh, 1999). Here we report on sediment and defined culture studies that suggest that protozoan grazing on anode biofilms may be an important factor limiting the current output of sediment microbial fuel cells.
2. Methods 2.1. Sediment microbial fuel cells Marine sediments and overlying water were separately collected from The Great Sippewissett Marsh (West Falmouth, MA) as previously described Holmes et al. (2004) at a depth of 0.5 m in canning jars that were filled to the top and then sealed. Water from the sampling site was also collected in plastic containers as previously described Holmes et al. (2004). Six 1-L glass beakers were filled 1/4 full with anoxic sediment and then the beakers were completely filled with water from the site. Prior to fuel cell construction, three of the sediments were amended with 200 mg/L each of the eukaryotic inhibitors cycloheximide and colchicine. This concentration of inhibitors was selected because it has previously been shown to inhibit protozoan growth in sediment microcosms (Holmes et al., 2014; Schwarz and Frenzel, 2005). In order to ensure that the eukaryotic inhibitors could not act as electron shuttles, current generated by Geobacter sulfurreducens in two-chambered ‘H-type’ fuel cells with acetate (10 mM) provided as an electron donor in the presence of both inhibitors was monitored (Fig. 1). These pure culture studies showed that similar current outputs were obtained by G. sulfurreducens grown in the presence or absence of inhibitors, indicating that they could not act as shuttles. Power generated by sediment
9
Fig. 1. Current generated by H cell inoculated with G. sulfurreducens strain PCA grown with acetate (10 mM) provided as the electron donor in the presence and absence of Trepomonas and eukaryotic inhibitors cycloheximide and colchicine.
fuel cells constructed with autoclaved sediments in the presence and absence of inhibitors was also monitored to ensure that the inhibitors did not have an abiotic impact on current produced by sediment fuel cells (Supplementary Fig. 1). As previously described by Holmes et al. (2004), graphite (grade G10, Graphite Engineering and Sales, Greenville, MI) anodes (3.9 cm 3.9 cm 0.3 cm) were placed 2–5 cm below the sediment surface, and electrically connected to cathodes, constructed of the same size and material, that were suspended in overlying seawater, which was continuously bubbled with air. A resistor of 560 X was included in the circuit between the anode and cathode. Current and voltage measurements were collected with a Keithley model 2000 multimeter (Keithley Instruments, Cleveland, OH). Current produced by all 6 fuel cells was monitored for 43 days at an incubation temperature of 18 °C.
2.2. Defined culture studies Trepomonas agilis strain RCP-1 (ATCC 50286), Breviata anathema (ATCC 50338), and Hexamita inflata strain AZ-4 (ATCC 50268) were purchased from the American Type Culture Collection (ATCC). Heteromita strain DH-1 was isolated from sediments collected from a uranium-contaminated aquifer located in Rifle, Colorado and has 18S rRNA and b-tubulin gene sequences that are 97% and 92% identical to the flagellate, Heteromita globosa (D. Holmes et al., manuscript in preparation). G. sulfurreducens was obtained from our laboratory culture collection. Strict anaerobic culturing and sampling techniques were used throughout (Balch et al., 1979). All protozoan cultures were grown anaerobically with G. sulfurreducens provided as the food source. B. anathema was maintained on medium containing a 1:3 mixture of simplified ATCC medium 1171 (mucin, Tween-80, and rice starch were omitted) and standard ATCC medium 802 (Sonneborn’s Paramecium medium); T. agilis was maintained on ATCC 1171 TYGM-9 medium; H. inflata was maintained on ATCC 1773 Hexamita medium; and Heteromita strain DH-1 was maintained on ciliate mineral medium consisting of (per liter distilled water): 0.125 g K2HPO4, 0.025 g NH4Cl, 0.4 g NaCl, 0.2 g MgCl26H2O, 0.15 g KCl and 0.25 g CaCl22H2O, and 1% wheat starch (Sigma–Aldrich). For batch culture grazing studies, G. sulfurreducens strain PCAT (ATCC51573) was grown in a bicarbonate-buffered freshwater medium (Lovley and Phillips, 1988) with fumarate (40 mM) provided as the electron acceptor and H2 as the electron donor at 22 °C in the dark under N2–CO2 (80:20). Once cells reached stationary phase (OD600nm of 0.8), protozoa were added to the medium. G. sulfurreducens cells were counted with acridine orange staining and epifluorescence microscopy as previously described (Hobbie et al., 1977). Cells were diluted 100-fold, fixed with a 10%
10
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
glutaraldehyde solution, and stained with acridine orange (0.01% final concentration). One milliliter of this stained sample was then concentrated with a vacuum pump (pressure was ca. 150 mm Hg) onto a 0.2 lm pore-size polycarbonate membrane filter (Millipore) and visualized by fluorescence microscopy on a Nikon Eclipse E600 microscope. G. sulfurreducens was cultured and grown in two-chambered ‘H-type’ fuel cells with graphite anodes poised at +300 mV versus Ag/AgCl, as previously described Nevin et al. (2009) with continuous gassing with H2 as the electron donor (H2/CO2/N2 7:20:73). Anaerobically grown protozoan cultures (50 mL at a concentration of 1 104 cells/mL) were concentrated by centrifugation at 2000g for 15 min, resuspended in 5 mL of bicarbonate-buffered freshwater medium (Lovley and Phillips, 1988), and added to the anode chamber of fuel cells once current had stabilized (0.7– 1.0 mA). After a 5-day exposure to protozoan grazing by strain DH-1, biofilms were visualized with confocal scanning laser microscopy using LIVE/DEAD BacLight viability stain, as previously described Nevin et al. (2008). Percent reduction in current output from protozoan grazing was determined with the following calculation:
current prior to inoculation with protozoa ¼ 1 100% : current 5 days after protozoan inoculation
2.3. Analysis of bacterial and protozoan communities associated with sediment fuel cells The composition of the microbial community found on anode biofilms and surrounding sediments was determined as previously described (Holmes et al., 2004). Sediments (0.5 g) or the top millimeter of the anode scraped off with a sterile razor blade were resuspended in 1 mL TE/sucrose buffer (10 mM Tris–HCl, 1 mM EDTA, 6.7% sucrose; pH 8.0). Sodium dodecyl sulfate (SDS 0.5% final concentration), proteinase K (0.1 mg/mL), and lysozyme (1 mg/mL final concentration) were then added and samples were incubated at 37 °C for 30 min. Lysing matrix E (MP BioMedical) was added to the tubes and they were placed in a FastPrep-24 bead-beater (MP BioMedical) for 60 s at 5.5 m/s. Tubes were then centrifuged at 13,200 rpm for 15 min and supernatant was collected for DNA extraction with the FastDNA SPIN Kit for Soil (MP Biomedicals). Several previously described primer pairs were used for amplification of 16S rRNA, and b-tubulin gene fragments from genomic DNA. Gene fragments from the 16S rRNA gene were amplified with 8F (Eden et al., 1991) and 519R (Lane et al., 1985); and BT107F and BT261R (Baker et al., 2004) was used to amplify the b-tubulin gene. A 50 lL PCR reaction consisted of the following solutions: 10 lL Q buffer (Qiagen), 0.4 mM of each dNTP, 1.5 mM MgCl2, 0.2 lM of each primer, 5 lg bovine serum albumin (BSA), 2.5 U Taq DNA polymerase (Qiagen) and 10 ng of PCR template. Amplification was performed with a minicycler PTC 200 (MJ Research) starting with 5 min at 94 °C, followed by 35 cycles consisting of denaturation (30 s at 94 °C), annealing (45 s at 55–60 °C), extension (45 s at 72 °C), and a final extension at 72 °C for 10 min. After PCR amplification of these gene fragments, PCR products were purified with the Gel Extraction Kit (Qiagen), and cloned into the TOPO TA cloning vector, version M (Invitrogen, Carlsbad, CA). One hundred plasmid inserts from each of these clone libraries were sequenced with the M13F primer at the University of Massachusetts Sequencing Facility. 2.4. Quantitative PCR All quantitative PCR (qPCR) primers were designed according to the manufacturer’s specifications (Applied Biosystems) and had
amplicon sizes ranging from 100 to 200 bp. Copies of the b-tubulin gene from strain DH-1 were quantified on the anode surface and the surrounding medium from the G. sulfurreducens H-cell with the following primer set: DH1-374f (50 GATGTGCACCTTCTCCGTTT 30 ) and DH1-494r (50 ATCGATCACCATCACCTCGT 30 ). Geobacteraceae 16S rRNA and Spirotrichea b-tubulin gene copies were amplified from the anode surface and surrounding sediments of a marine sediment fuel cell with Geobacteraceae 494f and Geobacteraceae 1050r (Holmes et al., 2004) and Spirotrichea-13f (50 GGCGGGGGAAAGGAACTAA 30 ) and Spirotrichea-127r (50 TTGACCCATTTGGTCTCTGCT 30 ). Quantitative PCR amplification and detection were performed with the 7500 Real Time PCR System (Applied Biosystems) using genomic DNA extracted from H-cells and marine sediment fuel cells. All qPCR assays were run in triplicate. Each reaction mixture consisted of a total volume of 25 lL and contained 1.5 lL of the appropriate primers (stock concentrations, 1.5 lM), 5 ng cDNA, and 12.5 lL Power SYBR Green PCR Master Mix (Applied Biosystems). Standard curves covering 8 orders of magnitude were constructed with serial dilutions of known amounts of DNA quantified with a NanoDrop ND-1000 spectrophotometer at an absorbance of 260 nm. Gene copy numbers and qPCR efficiencies (95– 99%) were calculated from appropriate standard curves. Optimal thermal cycling parameters consisted of an activation step at 50 °C for 2 min, an initial 10 min denaturation step at 95 °C followed by 50 cycles of 95 °C for 15 s and 60 °C for 1 min. After 50 cycles of PCR amplification, dissociation curves were made for all qPCR products by increasing the temperature from 60 °C to 95 °C at a ramp rate of 2%. The curves all yielded a single predominant peak, further supporting the specificity of the qPCR primer pairs. 2.5. Phylogenetic analysis 16S rRNA and b-tubulin sequences were assembled with Geneious 5.6 and compared to GenBank nucleotide and protein databases with the blastn and blastx algorithms. Alignments were made in ClustalX before phylogenetic trees were constructed with Mega v6. The maximum likelihood algorithm with the Nearest-Neighbor Interchange was used to construct all phylogenetic trees. All evolutionary distances were computed with the Tamura-Nei substitution model with 100 bootstrap replicates. The nucleotide sequences of 18S rRNA, b-tubulin from strain DH1 and 16S rRNA and b-tubulin sequences from marine sediment fuel cells have been deposited in the GenBank database under accession numbers KR047867–KR047883. 3. Results and discussion 3.1. Impact of protozoan grazing on marine sediment fuel cells In order to evaluate the impact that protozoan grazing might have on current output of microbial fuel cells, current production was monitored in marine sediment fuel cells constructed with sediments treated with or without the eukaryotic inhibitors cycloheximide and colchicine (Fig. 2). There was variability in the current output in both treatments, which is typical of sediment microbial fuel cells (Reimers et al., 2001; Tender et al., 2002). During the first 5 days of the experiment, current generated by treated fuel cells was lower than untreated fuel cells. In this initial phase of anode colonization sulfide produced at a distance from the anode is likely to be a more important electron donor for current until a current-producing biofilm is established. It is possible that H2S generated by sulfate reducing protozoan symbionts (Edgcomb et al., 2011) can transfer electrons to the electrode and generate
11
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
0.12 no eukaryotic inhibitors
Power density (W/m2)
0.1
with eukaryotic inhibitors
0.08 0.06 0.04 0.02 0 0
5
10
15
20
-0.02
25
30
35
40
45
50
Time (days)
Fig. 2. Power produced by marine sediment fuel cells assembled with sediment and water collected from The Great Sippewissett Salt Marsh in the presence or absence of the eukaryotic inhibitors cycloheximide and colchicine. Results are the mean and standard error of triplicate fuel cells for each treatment.
some current. When inhibitors are added, both the protozoa and their symbionts are destroyed and this abiotic effect is no longer observed, however further investigation into this possibility is required. After this initial lag, fuel cells made with sediments treated with eukaryotic inhibitors typically produced substantially more current than those with anodes suspended in untreated sediments. Whereas power densities from untreated sediments were comparable to those previously reported in fuel cells assembled with these same sediments and averaged 0.022 Watts per m2 of electrode surface area (Bond et al., 2002), power densities generated by fuel cells constructed with treated sediments were 2–5-fold higher and averaged 0.046 W/m2 (Fig. 2). In fact, at the end of the incubation period the sediment fuel cells with anodes in the sediments treated with eukaryotic inhibitors produced current that was 4.5-fold higher than the microbial fuel cells with untreated sediments and the overall area of the power density plot from the treated fuel cells was 2.11 times greater than that from untreated controls. Bacterial communities found on fuel cell anodes from both sediment types were similar to previously reported studies (Bond et al., 2002; Holmes et al., 2004) with a predominance of Geobacteraceae species; accounting for 72% and 61% of the 16S rRNA gene sequences recovered from anodes of the inhibitor-treated sediments and controls, respectively (Fig. 3A). The majority of Geobacteraceae 16S rRNA gene sequences (56% and 55% on treated and untreated anodes) were most similar to Desulfuromusa succinoxidans (98% sequence identity). In addition to the specific enrichment of Geobacteraceae species on the current-harvesting electrodes, there was a specific enrichment of protozoa associated with the anodes in untreated sediments (Fig. 3B). b-Tubulin sequences from the ciliate class Spirotrichea accounted for 65% of the protozoan population and 87% of these Spirotrichea sequences were most similar to Euplotes raikovi (91% nucleotide identity). In contrast, only 20% and 4% of the sequences amplified from surrounding sediments clustered within the class Spirotrichea and the genus Euplotes. As expected, no protozoa were detected on electrodes in the sediments that were amended with eukaryotic inhibitors. Quantitative PCR with specific primers for Spirotrichea b-tubulin and Geobacteraceae 16S rRNA genes demonstrated that, in the untreated sediments, Spirotrichea and Geobacteraceae were 2 orders of magnitude higher on the anode surface than in the sediments surrounding the anodes. Although 16S rRNA library analyses indicated that the proportion of Geobacteraceae found on treated and untreated anodes was similar, qPCR showed that Geobacteraceae were significantly (124 times) more abundant on treated anodes.
Previous studies have shown that Euplotes species are bacteriovorus (Turley et al., 1986). Thus, the specific association of Euplotes in anode biofilms and the increased current output from sediments treated with eukaryotic inhibitors are consistent with the hypothesis that protozoan grazing of anode biofilms can reduce the current output of sediment fuel cells. 3.2. Studies with defined cultures In order to further evaluate whether protozoan grazing might limit the output of sediment fuel cells, studies were conducted with G. sulfurreducens, which typically serves as the model organism in studies on current production by Geobacteraceae (Lovley, 2012). H2 served as the electron donor to prevent potential inhibition of grazing with an organic carbon source. T. agilis, H. inflata, and B. anathema were chosen as potential G. sulfurreducens grazers because they are related to protozoa previously detected in Geobacter-enriched groundwater (Holmes et al., 2013) and Heteromita strain DH-1 is a protozoan isolate from those groundwaters (D.E. Holmes et al., manuscript in preparation). Heteromita strain DH-1 grazed G. sulfurreducens most heavily, but T. agilis and H. inflata were also effective grazers (Fig. 4). Grazing rates of B. anathema were much slower. When the protozoa that were effective in grazing G. sulfurreducens were added to anode chambers that contained pre-established current-producing biofilms, there was a substantial reduction in current (Fig. 5). The lowest current outputs were achieved in the presence of strain DH-1, which was the most effective predator of G. sulfurreducens in batch culture studies. Grazing by DH-1 resulted in a 91% reduction in current output (0.861 mA prior to inoculation compared to 0.0719 mA after 5 days of grazing). In contrast, there was no impact on current output in the presence of B. anathema, consistent with batch culture studies that showed this species was an ineffective grazer of G. sulfurreducens. The addition of a heat-killed mixed culture of T. agilis, H. inflata, and strain DH-1 cells also had no impact on current production. In order to determine whether Heteromita strain DH-1, the most effective G. sulfurreducens grazer, was specifically associated with the anode, as would be expected if it was actively grazing on the biofilm, cells were quantified with qPCR primers targeting the strain DH-1 b-tubulin gene. Heteromita strain DH-1 b-tubulin genes in DNA extracted from the anode biofilms (6.41 104 ± 5220; n = 3) were 10-fold more abundant than in the surrounding medium (8.2 103 ± 1909). Imaging the anode biofilms with confocal scanning laser microscopy revealed that the presence of Heteromita strain DH-1 substantially decreased the abundance of G. sulfurreducens on the anode. Biofilms found on anodes in control fuel cells were much
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
Proportion of bacterial 16S rRNA gene sequences
12
100%
unclassified
90%
Tenericutes
betaproteobacteria Spirochetes
80%
Planctomycetes other deltaproteobacteria
70%
Geobacteraceae
60%
gammaproteobacteria
50%
Firmicutes Fibrobacteres/Acidobacteria
40%
epsilonproteobacteria Cyanobacteria
30%
Chloroflexi Chlamydiae/Verrucomicrobia
20%
Bacteroidetes/Chlorobi
10%
alphaproteobacteria Acnobacteria
0% electrode + inhibitor sediment + inhibitor
electrode
sediment
Percentage of B-tubulin sequences from protozoan taxa
100% 90%
Uroleptus
80%
Spumella Sorogena
70%
Paraphysomonas
60%
Oxytrichidae
50%
Oligohymenophorea
40%
Jacobida
30%
Euplotes
20%
Euglenozoa
10%
Colponema Cercozoa
0% sediment
biofilm
Fig. 3. (A) Distribution of 16S rRNA gene sequences recovered from the surface of the anode or the surrounding sediments in marine sediment fuel cells in the presence or absence of the eukaryotic inhibitors. Results are the average of triplicate fuel cells for each treatment. (B) Distribution of the protozoan community found on the marine sediment fuel cell anode surface or in the surrounding sediments as determined by analysis of b-tubulin clone libraries. Results are the average of triplicate fuel cells for each treatment.
Number of G. sulfurreducens cells per ml
1.00E+10
control (no protozoa)
Trepomonas
Breviata
Hexamita
DH-1
1.00E+09
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
0
50
100
150
200
250
Time (hours) Fig. 4. Predation of Geobacter sulfurreducens by various anaerobic protozoan species (Breviata anathema, Trepomonas agilis, Hexamita inflata, or Heteromita strain DH-1). Results are the mean and standard deviation for triplicate cultures.
thicker than biofilms exposed to protozoan grazing; 24 ± 10 lm compared to 5 ± 4 lm. In addition, protozoan cells were apparent in large areas of grazing within the strain DH-1 inoculated biofilm. 3.3. Implications The results suggest that protozoan grazing may be an important factor limiting the current output of sediment fuel cells. The pure
culture studies demonstrated that protozoa effective in grazing on G. sulfurreducens reduced anode biofilm thickness and current output. Thus, the elimination of protozoan grazing is the most likely explanation for the increased current output when the sediments were treated with eukaryotic inhibitors. These results suggest that even if factors such as low electron donor availability that limit current production of sediment fuel cells could be overcome, protozoan grazing is likely to diminish power outputs well below those that can
13
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 1.2
Current prior to inoculation with protozoa
5 days after inoculation with protozoa
1
Current (mA)
0.8
0.6
0.4
0.2
0 control (dead protozoa)
control (no protozoa)
Breviata
strain DH-1
Trepomonas
Hexamita
Fig. 5. Current generated by G. sulfurreducens grown in H-cells (H2 was provided as the electron donor) prior to addition of protozoa and 5 days after inoculation. Results are average of triplicate H-cells.
be obtained with pure cultures of effective current-producing microorganisms unless the grazing can be prevented. It is not sustainable to amend sediments with eukaryotic inhibitors for routine deployment of sediment fuel cells. However, the size difference between current-producing Geobacteraceae (1 0.5 lm) and protozoa (most are >5 lm) may make it feasible to provide a size-exclusion screen that would permit current-producing microbes to access current-harvesting electrodes while excluding protozoa. Another factor that may be limiting accumulation of Geobacter biomass during subsurface bioremediation is phage (Holmes et al., 2015). It would not be surprising if phage also play a role in limiting biofilm densities on electrodes harvesting current in sediments. A frequently proposed application for microbial fuel cells other than sediment fuel cells is anaerobic wastewater treatment with simultaneous current harvesting (Du et al., 2007; Li et al., 2014). It seems likely that protozoan grazing, and potentially phage, would be a factor limiting current outputs in these systems. However, further investigations into this possibility are required. 4. Conclusions Protozoan grazing appears to have an impact on power output by marine sediment fuel cells. Addition of eukaryotic inhibitors to marine sediments significantly increased current. Molecular studies showed that Geobacteraceae were enriched on current-harvesting anodes recovered from inhibitor treated and untreated sediments and that anaerobic protozoa from the genus Euplotes were associated with anode biofilms from untreated fuel cells. Defined studies with G. sulfurreducens showed that protozoa were able to reduce current production up to 91% and that G. sulfurreducens anode biofilms grown in the presence of protozoa were 4-fold thinner than biofilms from protozoan-free controls. Acknowledgement This research was supported by Office of Naval Research Grant N00014-13-1–0550. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2015.06. 056.
References Baker, B.J., Lutz, M.A., Dawson, S.C., Bond, P.L., Banfield, J.F., 2004. Metabolically active eukaryotic communities in extremely acidic mine drainage. Appl. Environ. Microbiol. 70 (10), 6264–6271. Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., Wolfe, R.S., 1979. Methanogens: reevaluation of a unique biological group. Microbiol. Rev. 43 (2), 260–296. Bond, D.R., Holmes, D.E., Tender, L.M., Lovley, D.R., 2002. Electrode-reducing microorganisms that harvest energy from marine sediments. Science 295 (5554), 483–485. Cui, Y.F., Rashid, N., Hu, N.X., Rehman, M.S.U., Han, J.I., 2014. Electricity generation and microalgae cultivation in microbial fuel cell using microalgae-enriched anode and bio-cathode. Energy Convers. Manage. 79, 674–680. Du, Z.W., Li, H.R., Gu, T.Y., 2007. A state of the art review on microbial fuel cells: a promising technology for wastewater treatment and bioenergy. Biotechnol. Adv. 25 (5), 464–482. Eden, P.A., Schmidt, T.M., Blakemore, R.P., Pace, N.R., 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction amplified 16S ribosomal RNA specific DNA. Int. J. Syst. Bacteriol. 41 (2), 324–325. Edgcomb, V.P., Leadbetter, E.R., Bourland, W., Beaudoin, D., Bernhard, J.M., 2011. Structured multiple endosymbiosis of bacteria and archaea in a ciliate from marine sulfidic sediments: a survival mechanism in low oxygen, sulfidic sediments? Front. Microbiol. 2, 55. Ewing, T., Ha, P.T., Babauta, J.T., Tang, N.T., Heo, D., Beyenal, H., 2014. Scale-up of sediment microbial fuel cells. J. Power Sources 272, 311–319. Franks, A.E., Nevin, K.P., 2010. Microbial fuel cells, a current review. Energies 3 (5), 899–919. Girguis, P.R., Nielsen, M.E., Reimers, C.E., 2010. Fundamentals of sediment-hosted fuel cells. In: Raebey, K. (Ed.), Bioelectrical Systems, First ed. Springer Verlag Press. Hobbie, J.E., Daley, R.J., Jasper, S., 1977. Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl. Environ. Microbiol. 33 (5), 1225–1228. Holmes, D.E., Bond, D.R., O’Neill, R.A., Reimers, C.E., Tender, L.R., Lovley, D.R., 2004. Microbial communities associated with electrodes harvesting electricity from a variety of aquatic sediments. Microb. Ecol. 48 (2), 178–190. Holmes, D.E., Giloteaux, L., Chaurasia, A.K., Williams, K.H., Luef, B., Wilkins, M.J., Wrighton, K.C., Thompson, C.A., Comolli, L.R., Lovley, D.R., 2015. Evidence of Geobacter-associated phage in a uranium-contaminated aquifer. ISME J. 9 (2), 333–346. Holmes, D.E., Giloteaux, L., Orellana, R., Williams, K.H., Robbins, M.J., Lovley, D.R., 2014. Methane production from protozoan endosymbionts following stimulation of microbial metabolism within subsurface sediments. Front. Microbiol. 5. Holmes, D.E., Giloteaux, L., Williams, K.H., Wrighton, K.C., Wilkins, M.J., Thompson, C.A., Roper, T.J., Long, P.E., Lovley, D.R., 2013. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater. ISME J. 7 (7), 1286–1298. Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., Pace, N.R., 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. U.S.A. 82 (20), 6955–6959. Leang, C., Malvankar, N.S., Franks, A.E., Nevin, K.P., Lovley, D.R., 2013. Engineering Geobacter sulfurreducens to produce a highly cohesive conductive matrix with enhanced capacity for current production. Energy Environ. Sci. 6 (6), 1901– 1908. Li, W.W., Yu, H.Q., He, Z., 2014. Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies. Energy Environ. Sci. 7 (3), 911–924. Logan, B.E., 2009. Exoelectrogenic bacteria that power microbial fuel cells. Nat. Rev. Microbiol. 7 (5), 375–381.
14
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
Lovley, D.R., 2012. Electromicrobiology. Annu. Rev. Microbiol. 66 (66), 391–409. Lovley, D.R., Phillips, E.J., 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol. 54 (6), 1472–1480. Malvankar, N.S., Lovley, D.R., 2014. Microbial nanowires for bioenergy applications. Curr. Opin. Biotechnol. 27, 88–95. Nevin, K.P., Kim, B.C., Glaven, R.H., Johnson, J.P., Woodard, T.L., Methe, B.A., DiDonato, R.J., Covalla, S.F., Franks, A.E., Liu, A., Lovley, D.R., 2009. Anode biofilm transcriptomics reveals outer surface components essential for high density current production in Geobacter sulfurreducens fuel cells. PLoS One 4 (5). Nevin, K.P., Richter, H., Covalla, S.F., Johnson, J.P., Woodard, T.L., Orloff, A.L., Jia, H., Zhang, M., Lovley, D.R., 2008. Power output and columbic efficiencies from biofilms of Geobacter sulfurreducens comparable to mixed community microbial fuel cells. Environ. Microbiol. 10 (10), 2505–2514. Nevin, K.P., Zhang, P., Franks, A.E., Woodard, T.L., Lovley, D.R., 2011. Anaerobes unleashed: aerobic fuel cells of Geobacter sulfurreducens. J. Power Sources 196 (18), 7514–7518. Rashid, N., Rehman, M.S.U., Han, J.I., 2013. Recycling and reuse of spent microalgal biomass for sustainable biofuels. Biochem. Eng. J. 75, 101–107. Reimers, C.E., Tender, L.M., Fertig, S., Wang, W., 2001. Harvesting energy from the marine sediment-water interface. Environ. Sci. Technol. 35 (1), 192–195.
Rezaei, F., Richard, T.L., Logan, B.E., 2009. Analysis of chitin particle size on maximum power generation, power longevity, and Coulombic efficiency in solid-substrate microbial fuel cells. J. Power Sources 192 (2), 304–309. Rogerson, A., Hannah, F., Gothe, G., 1996. The grazing potential of some unusual marine benthic amoebae feeding on bacteria. Europ. J. Protistol. 32 (2), 271–279. Schwarz, M.V.J., Frenzel, P., 2005. Methanogenic symbionts of anaerobic ciliates and their contribution to methanogenesis in an anoxic rice field soil. FEMS Microbiol. Ecol. 52 (1), 93–99. Tender, L.M., Reimers, C.E., Stecher, H.A., Holmes, D.E., Bond, D.R., Lowy, D.A., Pilobello, K., Fertig, S.J., Lovley, D.R., 2002. Harnessing microbially generated power on the seafloor. Nat. Biotechnol. 20 (8), 821–825. Turley, C., Newell, R., Robins, D., 1986. Survival strategies of two small marine ciliates and their role in regulating bacterial community structure under experimental conditions. Mar. Ecol. Prog. Ser. 33, 59–70. Wardman, C., Nevin, K.P., Lovley, D.R., 2014. Real-time monitoring of subsurface microbial metabolism with graphite electrodes. Front. Microbiol. 5. Williams, K.H., Nevin, K.P., Franks, A., Englert, A., Long, P.E., Lovley, D.R., 2010. Electrode-based approach for monitoring in situ microbial activity during subsurface bioremediation. Environ. Sci. Technol. 44 (1), 47–54. Zubkov, M.V., Sleigh, M.A., 1999. Growth of amoebae and flagellates on bacteria deposited on filters. Microb. Ecol. 37 (2), 107–115.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Protozoan grazing reduces the current output of microbial fuel cells Dawn E. Holmes a,b,⇑, Kelly P. Nevin a, Oona L. Snoeyenbos-West a, Trevor L. Woodard a, Justin N. Strickland a, Derek R. Lovley a a b
Department of Microbiology, University of Massachusetts, Amherst, MA, United States Department of Physical and Biological Sciences, Western New England University, Springfield, MA, United States
h i g h l i g h t s Inhibition of eukaryotic grazing increased power output of sediment MFC 2–5-fold. Geobacteraceae and Euplotes were enriched on current-harvesting anodes. Anaerobic protozoa prey on G. sulfurreducens in pure culture studies. Protozoan grazing can reduce current up to 91% in G. sulfurreducens fuel cells. Anode biofilms are 4-fold thinner in fuel cells with protozoa.
a r t i c l e
i n f o
Article history: Received 28 April 2015 Received in revised form 9 June 2015 Accepted 12 June 2015 Available online 17 June 2015 Keywords: Sediment fuel cell Anaerobic protozoa Geobacteraceae
a b s t r a c t Several experiments were conducted to determine whether protozoan grazing can reduce current output from sediment microbial fuel cells. When marine sediments were amended with eukaryotic inhibitors, the power output from the fuel cells increased 2–5-fold. Quantitative PCR showed that Geobacteraceae sequences were 120 times more abundant on anodes from treated fuel cells compared to untreated fuel cells, and that Spirotrichea sequences in untreated fuel cells were 200 times more abundant on anode surfaces than in the surrounding sediments. Defined studies with current-producing biofilms of Geobacter sulfurreducens and pure cultures of protozoa demonstrated that protozoa that were effective in consuming G. sulfurreducens reduced current production up to 91% when added to G. sulfurreducens fuel cells. These results suggest that anode biofilms are an attractive food source for protozoa and that protozoan grazing can be an important factor limiting the current output of sediment microbial fuel cells. Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Although many applications have been proposed for microbial fuel cells, powering electronic monitoring devices with energy harvested from marine sediments is one of the few applications that appear to be currently practical (Franks and Nevin, 2010; Logan, 2009). However, the output of sediment fuel cells is relatively low (4–55 mW/m2) (Girguis et al., 2010), which has led to many investigations designed to identify factors limiting current production in order to develop strategies to increase current output and expand the types of devices that can be powered with sediment fuel cells.
⇑ Corresponding author at: Department of Microbiology, 203N Morrill Science Center IVN, University of Massachusetts Amherst, Amherst, MA 01003, United States. Tel.: +1 413 577 2439; fax: +1 413 577 4660. E-mail address: [email protected] (D.E. Holmes).
One strategy to enhance power output is to increase the anode surface area available for microbial colonization. Unfortunately, studies have shown that as the surface area is increased the power output may not scale linearly (Ewing et al., 2014) and large surface anodes are unwieldy and difficult to deploy. Another approach is to increase the supply of electron donor to anode microbes. Current output can be directly related to the rate that fermentable organic matter is degraded within sediments (Wardman et al., 2014; Williams et al., 2010), which can be increased with the addition of particulate organic matter (i.e. cellulose, chitin, or algal biomass) that can be fermented to electron donors that will support current production (Cui et al., 2014; Rashid et al., 2013; Rezaei et al., 2009). However, the technical difficulty of amending sediments with organic material, especially in deep environments, as well as the need for repeated additions of the organics for long-term deployments, limits the applicability of this approach. Another approach is to provide electron donors for current production within the anode itself (Nevin et al., 2011), but this strategy is not applicable
http://dx.doi.org/10.1016/j.biortech.2015.06.056 0960-8524/Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
for the multi-year operation desired for many applications of sediment fuel cells. A proven strategy for increasing current densities in laboratory studies is to colonize anodes with those microorganisms that have the most effective current production capabilities. Characteristics that confer high current densities include the ability to directly transfer electrons to electrodes and the formation of electrically conductive biofilms that permit cells that are part of the anode biofilm but not in direct contact with anodes to contribute to current production (Lovley, 2012). To date, the combination of these characteristics has only been documented in members of the Geobacteraceae (Malvankar and Lovley, 2014). The common predominance of Geobacteraceae on anodes harvesting current from sediments and other environments suggests that microorganisms with these favorable characteristics already have a competitive advantage in colonizing anodes in many instances (Lovley, 2012). In laboratory studies it is possible to genetically engineer microorganisms with improved current capabilities (Leang et al., 2013), but the feasibility of preemptively colonizing anodes of sediment fuel cells with engineered microbes has not been intensively investigated. In open environments, such as sediments, there may be factors other than substrate availability limiting the growth of Geobacteraceae in anode biofilms. For example, when the growth of Geobacter species in the subsurface was stimulated with the addition of high concentrations of electron donor in the form of acetate, a bloom of protozoa accompanied increases in Geobacter growth and substantially lowered the accumulation of Geobacter biomass below that expected in the absence of protozoan grazing (Holmes et al., 2013). An anode biofilm also represents a substantial enrichment of Geobacteraceae likely to enhance grazing opportunities for protozoa. Amoeboid protozoa have been shown to consume bacteria within a biofilm at rates of 1465 bacteria h1 (Rogerson et al., 1996) and mixed cultures of amoeba and flagellates can consume 55–75% of the cells comprising a biofilm (Zubkov and Sleigh, 1999). Here we report on sediment and defined culture studies that suggest that protozoan grazing on anode biofilms may be an important factor limiting the current output of sediment microbial fuel cells.
2. Methods 2.1. Sediment microbial fuel cells Marine sediments and overlying water were separately collected from The Great Sippewissett Marsh (West Falmouth, MA) as previously described Holmes et al. (2004) at a depth of 0.5 m in canning jars that were filled to the top and then sealed. Water from the sampling site was also collected in plastic containers as previously described Holmes et al. (2004). Six 1-L glass beakers were filled 1/4 full with anoxic sediment and then the beakers were completely filled with water from the site. Prior to fuel cell construction, three of the sediments were amended with 200 mg/L each of the eukaryotic inhibitors cycloheximide and colchicine. This concentration of inhibitors was selected because it has previously been shown to inhibit protozoan growth in sediment microcosms (Holmes et al., 2014; Schwarz and Frenzel, 2005). In order to ensure that the eukaryotic inhibitors could not act as electron shuttles, current generated by Geobacter sulfurreducens in two-chambered ‘H-type’ fuel cells with acetate (10 mM) provided as an electron donor in the presence of both inhibitors was monitored (Fig. 1). These pure culture studies showed that similar current outputs were obtained by G. sulfurreducens grown in the presence or absence of inhibitors, indicating that they could not act as shuttles. Power generated by sediment
9
Fig. 1. Current generated by H cell inoculated with G. sulfurreducens strain PCA grown with acetate (10 mM) provided as the electron donor in the presence and absence of Trepomonas and eukaryotic inhibitors cycloheximide and colchicine.
fuel cells constructed with autoclaved sediments in the presence and absence of inhibitors was also monitored to ensure that the inhibitors did not have an abiotic impact on current produced by sediment fuel cells (Supplementary Fig. 1). As previously described by Holmes et al. (2004), graphite (grade G10, Graphite Engineering and Sales, Greenville, MI) anodes (3.9 cm 3.9 cm 0.3 cm) were placed 2–5 cm below the sediment surface, and electrically connected to cathodes, constructed of the same size and material, that were suspended in overlying seawater, which was continuously bubbled with air. A resistor of 560 X was included in the circuit between the anode and cathode. Current and voltage measurements were collected with a Keithley model 2000 multimeter (Keithley Instruments, Cleveland, OH). Current produced by all 6 fuel cells was monitored for 43 days at an incubation temperature of 18 °C.
2.2. Defined culture studies Trepomonas agilis strain RCP-1 (ATCC 50286), Breviata anathema (ATCC 50338), and Hexamita inflata strain AZ-4 (ATCC 50268) were purchased from the American Type Culture Collection (ATCC). Heteromita strain DH-1 was isolated from sediments collected from a uranium-contaminated aquifer located in Rifle, Colorado and has 18S rRNA and b-tubulin gene sequences that are 97% and 92% identical to the flagellate, Heteromita globosa (D. Holmes et al., manuscript in preparation). G. sulfurreducens was obtained from our laboratory culture collection. Strict anaerobic culturing and sampling techniques were used throughout (Balch et al., 1979). All protozoan cultures were grown anaerobically with G. sulfurreducens provided as the food source. B. anathema was maintained on medium containing a 1:3 mixture of simplified ATCC medium 1171 (mucin, Tween-80, and rice starch were omitted) and standard ATCC medium 802 (Sonneborn’s Paramecium medium); T. agilis was maintained on ATCC 1171 TYGM-9 medium; H. inflata was maintained on ATCC 1773 Hexamita medium; and Heteromita strain DH-1 was maintained on ciliate mineral medium consisting of (per liter distilled water): 0.125 g K2HPO4, 0.025 g NH4Cl, 0.4 g NaCl, 0.2 g MgCl26H2O, 0.15 g KCl and 0.25 g CaCl22H2O, and 1% wheat starch (Sigma–Aldrich). For batch culture grazing studies, G. sulfurreducens strain PCAT (ATCC51573) was grown in a bicarbonate-buffered freshwater medium (Lovley and Phillips, 1988) with fumarate (40 mM) provided as the electron acceptor and H2 as the electron donor at 22 °C in the dark under N2–CO2 (80:20). Once cells reached stationary phase (OD600nm of 0.8), protozoa were added to the medium. G. sulfurreducens cells were counted with acridine orange staining and epifluorescence microscopy as previously described (Hobbie et al., 1977). Cells were diluted 100-fold, fixed with a 10%
10
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
glutaraldehyde solution, and stained with acridine orange (0.01% final concentration). One milliliter of this stained sample was then concentrated with a vacuum pump (pressure was ca. 150 mm Hg) onto a 0.2 lm pore-size polycarbonate membrane filter (Millipore) and visualized by fluorescence microscopy on a Nikon Eclipse E600 microscope. G. sulfurreducens was cultured and grown in two-chambered ‘H-type’ fuel cells with graphite anodes poised at +300 mV versus Ag/AgCl, as previously described Nevin et al. (2009) with continuous gassing with H2 as the electron donor (H2/CO2/N2 7:20:73). Anaerobically grown protozoan cultures (50 mL at a concentration of 1 104 cells/mL) were concentrated by centrifugation at 2000g for 15 min, resuspended in 5 mL of bicarbonate-buffered freshwater medium (Lovley and Phillips, 1988), and added to the anode chamber of fuel cells once current had stabilized (0.7– 1.0 mA). After a 5-day exposure to protozoan grazing by strain DH-1, biofilms were visualized with confocal scanning laser microscopy using LIVE/DEAD BacLight viability stain, as previously described Nevin et al. (2008). Percent reduction in current output from protozoan grazing was determined with the following calculation:
current prior to inoculation with protozoa ¼ 1 100% : current 5 days after protozoan inoculation
2.3. Analysis of bacterial and protozoan communities associated with sediment fuel cells The composition of the microbial community found on anode biofilms and surrounding sediments was determined as previously described (Holmes et al., 2004). Sediments (0.5 g) or the top millimeter of the anode scraped off with a sterile razor blade were resuspended in 1 mL TE/sucrose buffer (10 mM Tris–HCl, 1 mM EDTA, 6.7% sucrose; pH 8.0). Sodium dodecyl sulfate (SDS 0.5% final concentration), proteinase K (0.1 mg/mL), and lysozyme (1 mg/mL final concentration) were then added and samples were incubated at 37 °C for 30 min. Lysing matrix E (MP BioMedical) was added to the tubes and they were placed in a FastPrep-24 bead-beater (MP BioMedical) for 60 s at 5.5 m/s. Tubes were then centrifuged at 13,200 rpm for 15 min and supernatant was collected for DNA extraction with the FastDNA SPIN Kit for Soil (MP Biomedicals). Several previously described primer pairs were used for amplification of 16S rRNA, and b-tubulin gene fragments from genomic DNA. Gene fragments from the 16S rRNA gene were amplified with 8F (Eden et al., 1991) and 519R (Lane et al., 1985); and BT107F and BT261R (Baker et al., 2004) was used to amplify the b-tubulin gene. A 50 lL PCR reaction consisted of the following solutions: 10 lL Q buffer (Qiagen), 0.4 mM of each dNTP, 1.5 mM MgCl2, 0.2 lM of each primer, 5 lg bovine serum albumin (BSA), 2.5 U Taq DNA polymerase (Qiagen) and 10 ng of PCR template. Amplification was performed with a minicycler PTC 200 (MJ Research) starting with 5 min at 94 °C, followed by 35 cycles consisting of denaturation (30 s at 94 °C), annealing (45 s at 55–60 °C), extension (45 s at 72 °C), and a final extension at 72 °C for 10 min. After PCR amplification of these gene fragments, PCR products were purified with the Gel Extraction Kit (Qiagen), and cloned into the TOPO TA cloning vector, version M (Invitrogen, Carlsbad, CA). One hundred plasmid inserts from each of these clone libraries were sequenced with the M13F primer at the University of Massachusetts Sequencing Facility. 2.4. Quantitative PCR All quantitative PCR (qPCR) primers were designed according to the manufacturer’s specifications (Applied Biosystems) and had
amplicon sizes ranging from 100 to 200 bp. Copies of the b-tubulin gene from strain DH-1 were quantified on the anode surface and the surrounding medium from the G. sulfurreducens H-cell with the following primer set: DH1-374f (50 GATGTGCACCTTCTCCGTTT 30 ) and DH1-494r (50 ATCGATCACCATCACCTCGT 30 ). Geobacteraceae 16S rRNA and Spirotrichea b-tubulin gene copies were amplified from the anode surface and surrounding sediments of a marine sediment fuel cell with Geobacteraceae 494f and Geobacteraceae 1050r (Holmes et al., 2004) and Spirotrichea-13f (50 GGCGGGGGAAAGGAACTAA 30 ) and Spirotrichea-127r (50 TTGACCCATTTGGTCTCTGCT 30 ). Quantitative PCR amplification and detection were performed with the 7500 Real Time PCR System (Applied Biosystems) using genomic DNA extracted from H-cells and marine sediment fuel cells. All qPCR assays were run in triplicate. Each reaction mixture consisted of a total volume of 25 lL and contained 1.5 lL of the appropriate primers (stock concentrations, 1.5 lM), 5 ng cDNA, and 12.5 lL Power SYBR Green PCR Master Mix (Applied Biosystems). Standard curves covering 8 orders of magnitude were constructed with serial dilutions of known amounts of DNA quantified with a NanoDrop ND-1000 spectrophotometer at an absorbance of 260 nm. Gene copy numbers and qPCR efficiencies (95– 99%) were calculated from appropriate standard curves. Optimal thermal cycling parameters consisted of an activation step at 50 °C for 2 min, an initial 10 min denaturation step at 95 °C followed by 50 cycles of 95 °C for 15 s and 60 °C for 1 min. After 50 cycles of PCR amplification, dissociation curves were made for all qPCR products by increasing the temperature from 60 °C to 95 °C at a ramp rate of 2%. The curves all yielded a single predominant peak, further supporting the specificity of the qPCR primer pairs. 2.5. Phylogenetic analysis 16S rRNA and b-tubulin sequences were assembled with Geneious 5.6 and compared to GenBank nucleotide and protein databases with the blastn and blastx algorithms. Alignments were made in ClustalX before phylogenetic trees were constructed with Mega v6. The maximum likelihood algorithm with the Nearest-Neighbor Interchange was used to construct all phylogenetic trees. All evolutionary distances were computed with the Tamura-Nei substitution model with 100 bootstrap replicates. The nucleotide sequences of 18S rRNA, b-tubulin from strain DH1 and 16S rRNA and b-tubulin sequences from marine sediment fuel cells have been deposited in the GenBank database under accession numbers KR047867–KR047883. 3. Results and discussion 3.1. Impact of protozoan grazing on marine sediment fuel cells In order to evaluate the impact that protozoan grazing might have on current output of microbial fuel cells, current production was monitored in marine sediment fuel cells constructed with sediments treated with or without the eukaryotic inhibitors cycloheximide and colchicine (Fig. 2). There was variability in the current output in both treatments, which is typical of sediment microbial fuel cells (Reimers et al., 2001; Tender et al., 2002). During the first 5 days of the experiment, current generated by treated fuel cells was lower than untreated fuel cells. In this initial phase of anode colonization sulfide produced at a distance from the anode is likely to be a more important electron donor for current until a current-producing biofilm is established. It is possible that H2S generated by sulfate reducing protozoan symbionts (Edgcomb et al., 2011) can transfer electrons to the electrode and generate
11
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
0.12 no eukaryotic inhibitors
Power density (W/m2)
0.1
with eukaryotic inhibitors
0.08 0.06 0.04 0.02 0 0
5
10
15
20
-0.02
25
30
35
40
45
50
Time (days)
Fig. 2. Power produced by marine sediment fuel cells assembled with sediment and water collected from The Great Sippewissett Salt Marsh in the presence or absence of the eukaryotic inhibitors cycloheximide and colchicine. Results are the mean and standard error of triplicate fuel cells for each treatment.
some current. When inhibitors are added, both the protozoa and their symbionts are destroyed and this abiotic effect is no longer observed, however further investigation into this possibility is required. After this initial lag, fuel cells made with sediments treated with eukaryotic inhibitors typically produced substantially more current than those with anodes suspended in untreated sediments. Whereas power densities from untreated sediments were comparable to those previously reported in fuel cells assembled with these same sediments and averaged 0.022 Watts per m2 of electrode surface area (Bond et al., 2002), power densities generated by fuel cells constructed with treated sediments were 2–5-fold higher and averaged 0.046 W/m2 (Fig. 2). In fact, at the end of the incubation period the sediment fuel cells with anodes in the sediments treated with eukaryotic inhibitors produced current that was 4.5-fold higher than the microbial fuel cells with untreated sediments and the overall area of the power density plot from the treated fuel cells was 2.11 times greater than that from untreated controls. Bacterial communities found on fuel cell anodes from both sediment types were similar to previously reported studies (Bond et al., 2002; Holmes et al., 2004) with a predominance of Geobacteraceae species; accounting for 72% and 61% of the 16S rRNA gene sequences recovered from anodes of the inhibitor-treated sediments and controls, respectively (Fig. 3A). The majority of Geobacteraceae 16S rRNA gene sequences (56% and 55% on treated and untreated anodes) were most similar to Desulfuromusa succinoxidans (98% sequence identity). In addition to the specific enrichment of Geobacteraceae species on the current-harvesting electrodes, there was a specific enrichment of protozoa associated with the anodes in untreated sediments (Fig. 3B). b-Tubulin sequences from the ciliate class Spirotrichea accounted for 65% of the protozoan population and 87% of these Spirotrichea sequences were most similar to Euplotes raikovi (91% nucleotide identity). In contrast, only 20% and 4% of the sequences amplified from surrounding sediments clustered within the class Spirotrichea and the genus Euplotes. As expected, no protozoa were detected on electrodes in the sediments that were amended with eukaryotic inhibitors. Quantitative PCR with specific primers for Spirotrichea b-tubulin and Geobacteraceae 16S rRNA genes demonstrated that, in the untreated sediments, Spirotrichea and Geobacteraceae were 2 orders of magnitude higher on the anode surface than in the sediments surrounding the anodes. Although 16S rRNA library analyses indicated that the proportion of Geobacteraceae found on treated and untreated anodes was similar, qPCR showed that Geobacteraceae were significantly (124 times) more abundant on treated anodes.
Previous studies have shown that Euplotes species are bacteriovorus (Turley et al., 1986). Thus, the specific association of Euplotes in anode biofilms and the increased current output from sediments treated with eukaryotic inhibitors are consistent with the hypothesis that protozoan grazing of anode biofilms can reduce the current output of sediment fuel cells. 3.2. Studies with defined cultures In order to further evaluate whether protozoan grazing might limit the output of sediment fuel cells, studies were conducted with G. sulfurreducens, which typically serves as the model organism in studies on current production by Geobacteraceae (Lovley, 2012). H2 served as the electron donor to prevent potential inhibition of grazing with an organic carbon source. T. agilis, H. inflata, and B. anathema were chosen as potential G. sulfurreducens grazers because they are related to protozoa previously detected in Geobacter-enriched groundwater (Holmes et al., 2013) and Heteromita strain DH-1 is a protozoan isolate from those groundwaters (D.E. Holmes et al., manuscript in preparation). Heteromita strain DH-1 grazed G. sulfurreducens most heavily, but T. agilis and H. inflata were also effective grazers (Fig. 4). Grazing rates of B. anathema were much slower. When the protozoa that were effective in grazing G. sulfurreducens were added to anode chambers that contained pre-established current-producing biofilms, there was a substantial reduction in current (Fig. 5). The lowest current outputs were achieved in the presence of strain DH-1, which was the most effective predator of G. sulfurreducens in batch culture studies. Grazing by DH-1 resulted in a 91% reduction in current output (0.861 mA prior to inoculation compared to 0.0719 mA after 5 days of grazing). In contrast, there was no impact on current output in the presence of B. anathema, consistent with batch culture studies that showed this species was an ineffective grazer of G. sulfurreducens. The addition of a heat-killed mixed culture of T. agilis, H. inflata, and strain DH-1 cells also had no impact on current production. In order to determine whether Heteromita strain DH-1, the most effective G. sulfurreducens grazer, was specifically associated with the anode, as would be expected if it was actively grazing on the biofilm, cells were quantified with qPCR primers targeting the strain DH-1 b-tubulin gene. Heteromita strain DH-1 b-tubulin genes in DNA extracted from the anode biofilms (6.41 104 ± 5220; n = 3) were 10-fold more abundant than in the surrounding medium (8.2 103 ± 1909). Imaging the anode biofilms with confocal scanning laser microscopy revealed that the presence of Heteromita strain DH-1 substantially decreased the abundance of G. sulfurreducens on the anode. Biofilms found on anodes in control fuel cells were much
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
Proportion of bacterial 16S rRNA gene sequences
12
100%
unclassified
90%
Tenericutes
betaproteobacteria Spirochetes
80%
Planctomycetes other deltaproteobacteria
70%
Geobacteraceae
60%
gammaproteobacteria
50%
Firmicutes Fibrobacteres/Acidobacteria
40%
epsilonproteobacteria Cyanobacteria
30%
Chloroflexi Chlamydiae/Verrucomicrobia
20%
Bacteroidetes/Chlorobi
10%
alphaproteobacteria Acnobacteria
0% electrode + inhibitor sediment + inhibitor
electrode
sediment
Percentage of B-tubulin sequences from protozoan taxa
100% 90%
Uroleptus
80%
Spumella Sorogena
70%
Paraphysomonas
60%
Oxytrichidae
50%
Oligohymenophorea
40%
Jacobida
30%
Euplotes
20%
Euglenozoa
10%
Colponema Cercozoa
0% sediment
biofilm
Fig. 3. (A) Distribution of 16S rRNA gene sequences recovered from the surface of the anode or the surrounding sediments in marine sediment fuel cells in the presence or absence of the eukaryotic inhibitors. Results are the average of triplicate fuel cells for each treatment. (B) Distribution of the protozoan community found on the marine sediment fuel cell anode surface or in the surrounding sediments as determined by analysis of b-tubulin clone libraries. Results are the average of triplicate fuel cells for each treatment.
Number of G. sulfurreducens cells per ml
1.00E+10
control (no protozoa)
Trepomonas
Breviata
Hexamita
DH-1
1.00E+09
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
0
50
100
150
200
250
Time (hours) Fig. 4. Predation of Geobacter sulfurreducens by various anaerobic protozoan species (Breviata anathema, Trepomonas agilis, Hexamita inflata, or Heteromita strain DH-1). Results are the mean and standard deviation for triplicate cultures.
thicker than biofilms exposed to protozoan grazing; 24 ± 10 lm compared to 5 ± 4 lm. In addition, protozoan cells were apparent in large areas of grazing within the strain DH-1 inoculated biofilm. 3.3. Implications The results suggest that protozoan grazing may be an important factor limiting the current output of sediment fuel cells. The pure
culture studies demonstrated that protozoa effective in grazing on G. sulfurreducens reduced anode biofilm thickness and current output. Thus, the elimination of protozoan grazing is the most likely explanation for the increased current output when the sediments were treated with eukaryotic inhibitors. These results suggest that even if factors such as low electron donor availability that limit current production of sediment fuel cells could be overcome, protozoan grazing is likely to diminish power outputs well below those that can
13
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 1.2
Current prior to inoculation with protozoa
5 days after inoculation with protozoa
1
Current (mA)
0.8
0.6
0.4
0.2
0 control (dead protozoa)
control (no protozoa)
Breviata
strain DH-1
Trepomonas
Hexamita
Fig. 5. Current generated by G. sulfurreducens grown in H-cells (H2 was provided as the electron donor) prior to addition of protozoa and 5 days after inoculation. Results are average of triplicate H-cells.
be obtained with pure cultures of effective current-producing microorganisms unless the grazing can be prevented. It is not sustainable to amend sediments with eukaryotic inhibitors for routine deployment of sediment fuel cells. However, the size difference between current-producing Geobacteraceae (1 0.5 lm) and protozoa (most are >5 lm) may make it feasible to provide a size-exclusion screen that would permit current-producing microbes to access current-harvesting electrodes while excluding protozoa. Another factor that may be limiting accumulation of Geobacter biomass during subsurface bioremediation is phage (Holmes et al., 2015). It would not be surprising if phage also play a role in limiting biofilm densities on electrodes harvesting current in sediments. A frequently proposed application for microbial fuel cells other than sediment fuel cells is anaerobic wastewater treatment with simultaneous current harvesting (Du et al., 2007; Li et al., 2014). It seems likely that protozoan grazing, and potentially phage, would be a factor limiting current outputs in these systems. However, further investigations into this possibility are required. 4. Conclusions Protozoan grazing appears to have an impact on power output by marine sediment fuel cells. Addition of eukaryotic inhibitors to marine sediments significantly increased current. Molecular studies showed that Geobacteraceae were enriched on current-harvesting anodes recovered from inhibitor treated and untreated sediments and that anaerobic protozoa from the genus Euplotes were associated with anode biofilms from untreated fuel cells. Defined studies with G. sulfurreducens showed that protozoa were able to reduce current production up to 91% and that G. sulfurreducens anode biofilms grown in the presence of protozoa were 4-fold thinner than biofilms from protozoan-free controls. Acknowledgement This research was supported by Office of Naval Research Grant N00014-13-1–0550. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2015.06. 056.
References Baker, B.J., Lutz, M.A., Dawson, S.C., Bond, P.L., Banfield, J.F., 2004. Metabolically active eukaryotic communities in extremely acidic mine drainage. Appl. Environ. Microbiol. 70 (10), 6264–6271. Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., Wolfe, R.S., 1979. Methanogens: reevaluation of a unique biological group. Microbiol. Rev. 43 (2), 260–296. Bond, D.R., Holmes, D.E., Tender, L.M., Lovley, D.R., 2002. Electrode-reducing microorganisms that harvest energy from marine sediments. Science 295 (5554), 483–485. Cui, Y.F., Rashid, N., Hu, N.X., Rehman, M.S.U., Han, J.I., 2014. Electricity generation and microalgae cultivation in microbial fuel cell using microalgae-enriched anode and bio-cathode. Energy Convers. Manage. 79, 674–680. Du, Z.W., Li, H.R., Gu, T.Y., 2007. A state of the art review on microbial fuel cells: a promising technology for wastewater treatment and bioenergy. Biotechnol. Adv. 25 (5), 464–482. Eden, P.A., Schmidt, T.M., Blakemore, R.P., Pace, N.R., 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction amplified 16S ribosomal RNA specific DNA. Int. J. Syst. Bacteriol. 41 (2), 324–325. Edgcomb, V.P., Leadbetter, E.R., Bourland, W., Beaudoin, D., Bernhard, J.M., 2011. Structured multiple endosymbiosis of bacteria and archaea in a ciliate from marine sulfidic sediments: a survival mechanism in low oxygen, sulfidic sediments? Front. Microbiol. 2, 55. Ewing, T., Ha, P.T., Babauta, J.T., Tang, N.T., Heo, D., Beyenal, H., 2014. Scale-up of sediment microbial fuel cells. J. Power Sources 272, 311–319. Franks, A.E., Nevin, K.P., 2010. Microbial fuel cells, a current review. Energies 3 (5), 899–919. Girguis, P.R., Nielsen, M.E., Reimers, C.E., 2010. Fundamentals of sediment-hosted fuel cells. In: Raebey, K. (Ed.), Bioelectrical Systems, First ed. Springer Verlag Press. Hobbie, J.E., Daley, R.J., Jasper, S., 1977. Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl. Environ. Microbiol. 33 (5), 1225–1228. Holmes, D.E., Bond, D.R., O’Neill, R.A., Reimers, C.E., Tender, L.R., Lovley, D.R., 2004. Microbial communities associated with electrodes harvesting electricity from a variety of aquatic sediments. Microb. Ecol. 48 (2), 178–190. Holmes, D.E., Giloteaux, L., Chaurasia, A.K., Williams, K.H., Luef, B., Wilkins, M.J., Wrighton, K.C., Thompson, C.A., Comolli, L.R., Lovley, D.R., 2015. Evidence of Geobacter-associated phage in a uranium-contaminated aquifer. ISME J. 9 (2), 333–346. Holmes, D.E., Giloteaux, L., Orellana, R., Williams, K.H., Robbins, M.J., Lovley, D.R., 2014. Methane production from protozoan endosymbionts following stimulation of microbial metabolism within subsurface sediments. Front. Microbiol. 5. Holmes, D.E., Giloteaux, L., Williams, K.H., Wrighton, K.C., Wilkins, M.J., Thompson, C.A., Roper, T.J., Long, P.E., Lovley, D.R., 2013. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater. ISME J. 7 (7), 1286–1298. Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., Pace, N.R., 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. U.S.A. 82 (20), 6955–6959. Leang, C., Malvankar, N.S., Franks, A.E., Nevin, K.P., Lovley, D.R., 2013. Engineering Geobacter sulfurreducens to produce a highly cohesive conductive matrix with enhanced capacity for current production. Energy Environ. Sci. 6 (6), 1901– 1908. Li, W.W., Yu, H.Q., He, Z., 2014. Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies. Energy Environ. Sci. 7 (3), 911–924. Logan, B.E., 2009. Exoelectrogenic bacteria that power microbial fuel cells. Nat. Rev. Microbiol. 7 (5), 375–381.
14
D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14
Lovley, D.R., 2012. Electromicrobiology. Annu. Rev. Microbiol. 66 (66), 391–409. Lovley, D.R., Phillips, E.J., 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol. 54 (6), 1472–1480. Malvankar, N.S., Lovley, D.R., 2014. Microbial nanowires for bioenergy applications. Curr. Opin. Biotechnol. 27, 88–95. Nevin, K.P., Kim, B.C., Glaven, R.H., Johnson, J.P., Woodard, T.L., Methe, B.A., DiDonato, R.J., Covalla, S.F., Franks, A.E., Liu, A., Lovley, D.R., 2009. Anode biofilm transcriptomics reveals outer surface components essential for high density current production in Geobacter sulfurreducens fuel cells. PLoS One 4 (5). Nevin, K.P., Richter, H., Covalla, S.F., Johnson, J.P., Woodard, T.L., Orloff, A.L., Jia, H., Zhang, M., Lovley, D.R., 2008. Power output and columbic efficiencies from biofilms of Geobacter sulfurreducens comparable to mixed community microbial fuel cells. Environ. Microbiol. 10 (10), 2505–2514. Nevin, K.P., Zhang, P., Franks, A.E., Woodard, T.L., Lovley, D.R., 2011. Anaerobes unleashed: aerobic fuel cells of Geobacter sulfurreducens. J. Power Sources 196 (18), 7514–7518. Rashid, N., Rehman, M.S.U., Han, J.I., 2013. Recycling and reuse of spent microalgal biomass for sustainable biofuels. Biochem. Eng. J. 75, 101–107. Reimers, C.E., Tender, L.M., Fertig, S., Wang, W., 2001. Harvesting energy from the marine sediment-water interface. Environ. Sci. Technol. 35 (1), 192–195.
Rezaei, F., Richard, T.L., Logan, B.E., 2009. Analysis of chitin particle size on maximum power generation, power longevity, and Coulombic efficiency in solid-substrate microbial fuel cells. J. Power Sources 192 (2), 304–309. Rogerson, A., Hannah, F., Gothe, G., 1996. The grazing potential of some unusual marine benthic amoebae feeding on bacteria. Europ. J. Protistol. 32 (2), 271–279. Schwarz, M.V.J., Frenzel, P., 2005. Methanogenic symbionts of anaerobic ciliates and their contribution to methanogenesis in an anoxic rice field soil. FEMS Microbiol. Ecol. 52 (1), 93–99. Tender, L.M., Reimers, C.E., Stecher, H.A., Holmes, D.E., Bond, D.R., Lowy, D.A., Pilobello, K., Fertig, S.J., Lovley, D.R., 2002. Harnessing microbially generated power on the seafloor. Nat. Biotechnol. 20 (8), 821–825. Turley, C., Newell, R., Robins, D., 1986. Survival strategies of two small marine ciliates and their role in regulating bacterial community structure under experimental conditions. Mar. Ecol. Prog. Ser. 33, 59–70. Wardman, C., Nevin, K.P., Lovley, D.R., 2014. Real-time monitoring of subsurface microbial metabolism with graphite electrodes. Front. Microbiol. 5. Williams, K.H., Nevin, K.P., Franks, A., Englert, A., Long, P.E., Lovley, D.R., 2010. Electrode-based approach for monitoring in situ microbial activity during subsurface bioremediation. Environ. Sci. Technol. 44 (1), 47–54. Zubkov, M.V., Sleigh, M.A., 1999. Growth of amoebae and flagellates on bacteria deposited on filters. Microb. Ecol. 37 (2), 107–115.