- Email: [email protected]
Psoralen photofootprinting of protein-binding sites on DNA
Volume 229, number 1, 7 3 - 7 6
FEB 05595
February 1988
Psoralen photofootprinting of protein-binding sites on D N A Wei-ping Zhen, Claus Jeppesen and Peter E. Nielsen Department of Biochemistry B, The Panum Institute, University of Copenhagen, Blegdamsvej 3, DK 2200 N, Copenhagen, Denmark Received 28 December 1987 Using a BAL31 exonuclease assay to determine the sites of 4,5',8-trimethylpsoralen photocrosslinking in DNA we have shown that 5-'TA sites which are accessible to psoralen DNA interstrand photocrosslinking in naked DNA become inaccessible when protein, in casu, 2-repressor E. coli or RNA polymerase are bound at their recognition DNA sequences (ORt operator or deol promoter, respectively). These results show that psoralens can be used as photofootprinting reagents to study specific protein-DNA interactions. Psoralen; Footprint; RNA polymerase; Promoter; 2-repressor; Photocrosslinking
terstrand photocrosslinking by psoralens occurs in 'protein-free' parts of the chromatin exemplified by the internucleosomal linker DNA. We have recently developed an enzymatic method for determination of psoralen DNA interstrand crosslinks at the nucleotide level [8]. As an extension of this work we now report that proteins such as A-repressor or RNA polymerase bound to the DNA inhibit psoralen photocrosslinking. Thus, psoralens can be used as
1. I N T R O D U C T I O N
Psoralens have been used extensively to study chromatin structure by electron microscopy (e.g. [1-5]) or by using radiolabeled psoralens (e.g. [6,7]). From these studies it is inferred that the inCorrespondence address: P.E.
Nielsen, Department of Biochemistry B, The Panum Institute, University of Copenhagen, Blegdamsvej 3, DK2200 N, Copenhagen, Denmark
8
0 •
lO I
20
,
30
•
40
•
50
•
60F_
70
80
•
5~GGAT~C~CGACCGATATTGG~GTGCATAAAGG~GTCTGGCAGGGTTCTGTCGAGGTAA~GCCAGAAACGTTTTATTCGAACAT~GATCT 3~-CCTAGGG~gCTGGCTATAACCGCACGTATTTCCGCAGACCGTCCCAAGACAGCTCCATTGCGGTCTTTGCAAAATAAGCTTGTAGCTAGA BamHI
~
~
~
L_
90 100 110 120 130 -'1 140 150 167 177 CGTCTTGTGTTAGAATTCTAACATACGGTTGCAACAACGCATcCAGTTGCCCCAGGTAGACCGGCATCGATGTGACCGACGGTACGTGGT GCAGAACACAAT--CTTAAGATTGTATGCCAACGTTGTTGCGTAGGTCAACGGGGTCCA~TCTGG~CGTAGCTACACTGGCTGCCATGCAC¢A
+z 180
190
200
_J 210
220
230
240
250
GGTAAAGAATGGTCAGCAGAGAGAGTGCGTCATCAAGAT~CTCTAGAGTCGACCTGCAGGCATGCAAGCTT CCATTTCTTACCAGTCGTCTCTCTCACGCAGTAGTTCTAC~AGATCTCAGCTGGACGTCCGTACGTTCGAA SalI HindIII
b
EcoRI i0 20 , 30 40 ,HindIII 5 '- G - - - ~ - ~ C G A G C T C G G T A C C C G G G G A T C ~ T A C C T C T G G C G G T G A T A ~ A A G C T T 3 '- C T T A A G C T C G A G C C A ~ T G G G C C C C T A G ( ~ A T G G A G A C C G C C A C T A T I T T C G A A
L_
~-
---J
Fig.1. Sequence of the DNA fragments used. (a) deoI promoter DNA fragment. Transcription initiation (+ 1) and direction of transcription (' ,) are indicated. 5 '-TA sites are underlined and the DNase I footprint of RNA polymerase binding ( r - - --1 ) is also shown. (b) l-ORl operator DNA fragment with DNase I footprint ofA-repressor (L__ __] ) and operator sequence ( ,i ,i ) shown.
Published by Elsevier SciencePublishers B. F. (BiomedicalDivision) 00145793/88/$3.50 © 1988 Federation of European Biochemical Societies
73
Volume 229, number 1
FEBS LETTERS
p h o t o f o o t p r i n t i n g reagents f o r studies o f specific protein-DNA interactions. 2. M A T E R I A L S A N D M E T H O D S
February 1988
TA27 in the presence o f r e p r e s s o r is a c o n s e q u e n c e o f t h e degree o f c r o s s l i n k i n g ( > 1 crosslink p e r f r a g m e n t ) , which results in a n o v e r - r e p r e s e n t a t i o n o f the l o n g e r D N A f r a g m e n t s since BAL31 stops at the first c r o s s l i n k e n c o u n t e r e d [8].
A BamHI-BgllI fragment from pGDI 1 [9] which contains the deol promoter [10] was cloned into the BamHI site of pUCI8
to yield pC J200. Two complementary, synthetic 23-mer oligonucleotides constituting the Oa~ operator DNA [11] having HindllI/BamHl cohesive ends were cloned into pUCI9 via the HindlII/BamHI sites in the polylinker of this plasmid. RNA polymerase (purified according to [12]) was a gift from Dr Kaj Frank Jensen, while A-repressor was purified from an overproducing strain (pEA305 in E. coli XA90 [13], a gift from Dr M. Ptashne) according to [14]. Psoralen photoreactions were performed in 50/zl buffer using the desired supercoiled plasmid (0.2/~g) and the samples were irradiated for 25 min at 365 nm (Philips TL 20W/09 fluorescent light tube, 220 J.m -2.s-t). The DNA was subsequently purified by phenol extraction and linearized with the first restriction enzyme, treated with BAL31, cleaved with the second restriction enzyme, 32P-end-labeled and analyzed by polyacrylamidegel electrophoresis as in [8]. The buffer for the A-repressor experiments was 10 mM Tris-HCl, pH 7.0, 2.5 mM MgCI2, 1 mM CaC12, 0.1 mM EDTA, 200 mM KCI, 100/~g/ml BSA and 2.5/~g/ml calf thymus DNA. For experiments with RNA polymerase 40 mM Tris-HCl, pH 8.0, 100 mM KCI, 5 mM MgC12 was used. All samples were incubated at 37°C for 10 min prior to being irradiated.
1
2
3
M
80
50 40
TA27 _
30
3. R E S U L T S A N D D I S C U S S I O N It is well e s t a b l i s h e d t h a t 5 ' - T A sites are m u c h m o r e efficiently c r o s s l i n k e d b y p s o r a l e n s as c o m p a r e d to 5 ' - A T sites [8,15,16] T h e A-repressor O t l o p e r a t o r D N A sequence contains two 5'-TA psoralen photocrosslinking sites (fig. 1, TA27, TA42) a n d o u r p l a s m i d c o n s t r u c t f u r t h e r m o r e has a 5 ' - T A site 13 b a s e - p a i r s o u t s i d e t h e OR1 sequence (fig. 1, TA14). T h e TA14 a n d TA27 sites were used to s t u d y the effect o f A-repressor b i n d i n g to the OR1 o p e r a t o r o n the p s o r a l e n D N A i n t e r s t r a n d p h o t o c r o s s l i n k i n g o f T A sites (fig.2). T h e s e results clearly s h o w t h a t the TA27 site which is e f f i c i e n t l y c r o s s l i n k e d in n a k e d D N A b e c o m e s c o m p l e t e l y p r o t e c t e d in the presence o f Arepressor. T h e a b s e n c e o f d e t e c t a b l e c r o s s l i n k i n g at TA42 is a s c r i b e d to t h e i n h i b i t i o n o f e n z y m a t i c a c t i o n b y p s o r a l e n crosslinks. I n this case i n h i b i t i o n o f H i n d I I I cleavage a n d / o r e n d - l a b e l i n g b y D N A polymerase. T h e a p p a r e n t relative increase in c r o s s l i n k i n g o f 74
TA14
-
Fig.2. Psoralen photofootprinting of binding of A-repressor to the OR~ operator. The psoralen-treated plasmid was linearized with HindIII, treated with BAL31, cleaved with EcoRI and endlabeled. Lanes: 1, no repressor; 2,3, psoralen-treated in the presence of A-repressor (0.7 and 2/~g, respectively); M, DNA size marker. DNA analysis was performed on a 2007o polyacrylamide gel followed by autoradiography.
Volume 229, number 1
FEBS LETTERS
The open complex between E. coil RNA polymerase and a strong promoter, deol, was used to study the effect of specific protein-DNA interactions on the interstrand photocrosslinking of DNA by 4,5',8-tdmethylpsoraien in more detail, since more psoralen crosslinking sites can be analyzed in this system. The BamHI-SalI DNA fragment used in this study (fig.l) contains 11 5'-TA sites which are all crosslinked by the psoralen (fig.3a, lane 6; fig.3b, lane 5). Furthermore, faint bands (< 10°70 intensities) are observed at positions corresponding to 5'-AT sites. Upon binding of RNA polymerase complete inhibition of psoralen photocrosslinking occurs at sites TA10o, TAx0s and TAI~3 and ATs2, while partial inhibition is seen at TA73 (figs 1,2).
February 1988
DNase I footprinting results have shown that RNA polymerase protects to the - 5 0 to + 15 sequence of the deol promoter [17]. Accordingly, 5'-TA sites 100, 108 and 113 are not photocrosslinked with 4,5' ,8-trimethylpsoralen when RNA polymerase is bound to the promoter, in either the open or closed (not shown) complex. T~-ese results show that tight binding of protein to M
1
2
3
4
5
6
M
1419 Q
M
1
2
3
4
5
6
7
8
M
1419
$17
396 517 396
TA 15
TA
214
56
- 223
214
27
73 -
182 172
-
146
!13
113
146
I00
108
-
7S 65
108 100
- 73 Q
i
!
Fig.3. Psoralen photofootprinting of binding of RNA polymerase to the deol promoter. (a) the plasmid (pC J200) was linearized with Sail, digested with BAL31 and cleaved with BamHI. The labeled DNA fragments were analyzed on a 10% polyacrylamide gel. Lanes: 5, no psoralen, control; 6, psoralen, no polymerase; 7,8, psoralen-treated in the presence of RNA polymerase (3 and 7/zg, respectively); 1-4, as lanes 5-8 but without BAL31 treatment. (b) The plasmid was linearized with BamHI, digested with BAL31 and cleaved with HindIII. Lanes: 4, no psoralen, control; 5, psoralen, no polymerase; 6, psoralen-treated in the presence of polymerase; 1-3, as lanes 4-6 but without BAL31. The crosslinking degree was 0.005 per basepair. M, DNA size marker (pUCI9 x HinfI).
75
Volume 229, n u m b e r 1
FEBS L E T T E R S
DNA inhibits psoralen photocrosslinking, presumably due to a rigid conformation of the DNA. This rigidity prevents the helix extension and unwinding which are prerequisites for psoralen intercalation and photobinding. Interestingly, photocrosslinking of 5'-TA73 is only partly inhibited, indicating a less tight association of the enzyme with this part of the promoter. A more loose protein DNA contact around this site is also indicated by DNase I cleavage at positions - 34 and - 35 [17]. These results clearly show that 4,5' ,8-trimethylpsoralen (and presumably other psoralens as well) can be used for photofootprinting studies of protein-DNA interactions, and also firmly establish that psoralens do not induce DNA interstrand crosslinks in DNA which is tightly associated with protein. Acknowledgements: The financial support of the NOVO Foundation (a Hallas Moiler fellowship to P.E,N.), the Weimann Foundation (W.Z.) and the Danish Medical Science Research Council (C.J.) is gratefully acknowledged.
76
February 1988
REFERENCES [1] Hanson, C.V., Shen, C.J. and Hearst, J.E. (1976) Science 193, 62-64. [2] Wiesehahn, G.P., Hyde, J.E. and Hearst, J.E. (1977) Biochemistry 16, 925-932. [3] Potter, D.A., Fostel, J.M., Berninger, M., Pardue, M.L. and Cech, T.R. (1980) Proc. Natl. Acad. Sci. USA 77, 4118-4122. [4] Sogo, J.M., Ness, P.J., Widmer, R.M., Parish, R.W. and Koller, T. (1984) J. Mol. Biol. 178, 897-928. [5] De Bernardi, W., Koller, T. and Sogo, J.M. (1986) J. Mol. Biol. 191, 469-482. [6] Cech, T. and Pardue, M.L. (1977) Cell II, 631-640. [7] Kondoleon, S.K., Robinson, G.W. and Hallick, L.M. (1983) Virology 129, 261-273. [8] Zhen, W., Buchardt, O., Nielsen, H. and Nielsen, P.E. (1986) Biochemistry 25, 6598-6603. [9] Dandanell, G. (1985) Thesis, University of Copenhagen. [10] Valentin-Hansen, P., Aiba, H. and Schumperli, D. (1982) EMBO J. 1, 317-322. [1 l] Humayun, Z., Kleid, D. and Ptashne, M. (1977) Nucleic Acids Res. 4, 1595-1607. [12] Burgess, R.R. and Jendrisak, J.J. (1975) Biochemistry 14, 4634-4638. [13] Amann, E., Brosins, J. and Ptashne, M. (1983) Gene 25, 167-178. [14] Johnson, A.D., Pabo, C.O. and Sauer, R.T. (1980) Methods Enzymol. 65, 839-856. [15] Gamper, H., Piette, J. and Hearst, J.E. (1984) Photochem. Photobiol. 40, 29-34. [16] Sage, E. and Moustacchi, E. (1987) Biochemistry 26, 3307-3314. [17] Jeppesen, C., Buchardt, O., Henriksen, U. and Nielsen, P.E. (1987) submitted.
FEB 05595
February 1988
Psoralen photofootprinting of protein-binding sites on D N A Wei-ping Zhen, Claus Jeppesen and Peter E. Nielsen Department of Biochemistry B, The Panum Institute, University of Copenhagen, Blegdamsvej 3, DK 2200 N, Copenhagen, Denmark Received 28 December 1987 Using a BAL31 exonuclease assay to determine the sites of 4,5',8-trimethylpsoralen photocrosslinking in DNA we have shown that 5-'TA sites which are accessible to psoralen DNA interstrand photocrosslinking in naked DNA become inaccessible when protein, in casu, 2-repressor E. coli or RNA polymerase are bound at their recognition DNA sequences (ORt operator or deol promoter, respectively). These results show that psoralens can be used as photofootprinting reagents to study specific protein-DNA interactions. Psoralen; Footprint; RNA polymerase; Promoter; 2-repressor; Photocrosslinking
terstrand photocrosslinking by psoralens occurs in 'protein-free' parts of the chromatin exemplified by the internucleosomal linker DNA. We have recently developed an enzymatic method for determination of psoralen DNA interstrand crosslinks at the nucleotide level [8]. As an extension of this work we now report that proteins such as A-repressor or RNA polymerase bound to the DNA inhibit psoralen photocrosslinking. Thus, psoralens can be used as
1. I N T R O D U C T I O N
Psoralens have been used extensively to study chromatin structure by electron microscopy (e.g. [1-5]) or by using radiolabeled psoralens (e.g. [6,7]). From these studies it is inferred that the inCorrespondence address: P.E.
Nielsen, Department of Biochemistry B, The Panum Institute, University of Copenhagen, Blegdamsvej 3, DK2200 N, Copenhagen, Denmark
8
0 •
lO I
20
,
30
•
40
•
50
•
60F_
70
80
•
5~GGAT~C~CGACCGATATTGG~GTGCATAAAGG~GTCTGGCAGGGTTCTGTCGAGGTAA~GCCAGAAACGTTTTATTCGAACAT~GATCT 3~-CCTAGGG~gCTGGCTATAACCGCACGTATTTCCGCAGACCGTCCCAAGACAGCTCCATTGCGGTCTTTGCAAAATAAGCTTGTAGCTAGA BamHI
~
~
~
L_
90 100 110 120 130 -'1 140 150 167 177 CGTCTTGTGTTAGAATTCTAACATACGGTTGCAACAACGCATcCAGTTGCCCCAGGTAGACCGGCATCGATGTGACCGACGGTACGTGGT GCAGAACACAAT--CTTAAGATTGTATGCCAACGTTGTTGCGTAGGTCAACGGGGTCCA~TCTGG~CGTAGCTACACTGGCTGCCATGCAC¢A
+z 180
190
200
_J 210
220
230
240
250
GGTAAAGAATGGTCAGCAGAGAGAGTGCGTCATCAAGAT~CTCTAGAGTCGACCTGCAGGCATGCAAGCTT CCATTTCTTACCAGTCGTCTCTCTCACGCAGTAGTTCTAC~AGATCTCAGCTGGACGTCCGTACGTTCGAA SalI HindIII
b
EcoRI i0 20 , 30 40 ,HindIII 5 '- G - - - ~ - ~ C G A G C T C G G T A C C C G G G G A T C ~ T A C C T C T G G C G G T G A T A ~ A A G C T T 3 '- C T T A A G C T C G A G C C A ~ T G G G C C C C T A G ( ~ A T G G A G A C C G C C A C T A T I T T C G A A
L_
~-
---J
Fig.1. Sequence of the DNA fragments used. (a) deoI promoter DNA fragment. Transcription initiation (+ 1) and direction of transcription (' ,) are indicated. 5 '-TA sites are underlined and the DNase I footprint of RNA polymerase binding ( r - - --1 ) is also shown. (b) l-ORl operator DNA fragment with DNase I footprint ofA-repressor (L__ __] ) and operator sequence ( ,i ,i ) shown.
Published by Elsevier SciencePublishers B. F. (BiomedicalDivision) 00145793/88/$3.50 © 1988 Federation of European Biochemical Societies
73
Volume 229, number 1
FEBS LETTERS
p h o t o f o o t p r i n t i n g reagents f o r studies o f specific protein-DNA interactions. 2. M A T E R I A L S A N D M E T H O D S
February 1988
TA27 in the presence o f r e p r e s s o r is a c o n s e q u e n c e o f t h e degree o f c r o s s l i n k i n g ( > 1 crosslink p e r f r a g m e n t ) , which results in a n o v e r - r e p r e s e n t a t i o n o f the l o n g e r D N A f r a g m e n t s since BAL31 stops at the first c r o s s l i n k e n c o u n t e r e d [8].
A BamHI-BgllI fragment from pGDI 1 [9] which contains the deol promoter [10] was cloned into the BamHI site of pUCI8
to yield pC J200. Two complementary, synthetic 23-mer oligonucleotides constituting the Oa~ operator DNA [11] having HindllI/BamHl cohesive ends were cloned into pUCI9 via the HindlII/BamHI sites in the polylinker of this plasmid. RNA polymerase (purified according to [12]) was a gift from Dr Kaj Frank Jensen, while A-repressor was purified from an overproducing strain (pEA305 in E. coli XA90 [13], a gift from Dr M. Ptashne) according to [14]. Psoralen photoreactions were performed in 50/zl buffer using the desired supercoiled plasmid (0.2/~g) and the samples were irradiated for 25 min at 365 nm (Philips TL 20W/09 fluorescent light tube, 220 J.m -2.s-t). The DNA was subsequently purified by phenol extraction and linearized with the first restriction enzyme, treated with BAL31, cleaved with the second restriction enzyme, 32P-end-labeled and analyzed by polyacrylamidegel electrophoresis as in [8]. The buffer for the A-repressor experiments was 10 mM Tris-HCl, pH 7.0, 2.5 mM MgCI2, 1 mM CaC12, 0.1 mM EDTA, 200 mM KCI, 100/~g/ml BSA and 2.5/~g/ml calf thymus DNA. For experiments with RNA polymerase 40 mM Tris-HCl, pH 8.0, 100 mM KCI, 5 mM MgC12 was used. All samples were incubated at 37°C for 10 min prior to being irradiated.
1
2
3
M
80
50 40
TA27 _
30
3. R E S U L T S A N D D I S C U S S I O N It is well e s t a b l i s h e d t h a t 5 ' - T A sites are m u c h m o r e efficiently c r o s s l i n k e d b y p s o r a l e n s as c o m p a r e d to 5 ' - A T sites [8,15,16] T h e A-repressor O t l o p e r a t o r D N A sequence contains two 5'-TA psoralen photocrosslinking sites (fig. 1, TA27, TA42) a n d o u r p l a s m i d c o n s t r u c t f u r t h e r m o r e has a 5 ' - T A site 13 b a s e - p a i r s o u t s i d e t h e OR1 sequence (fig. 1, TA14). T h e TA14 a n d TA27 sites were used to s t u d y the effect o f A-repressor b i n d i n g to the OR1 o p e r a t o r o n the p s o r a l e n D N A i n t e r s t r a n d p h o t o c r o s s l i n k i n g o f T A sites (fig.2). T h e s e results clearly s h o w t h a t the TA27 site which is e f f i c i e n t l y c r o s s l i n k e d in n a k e d D N A b e c o m e s c o m p l e t e l y p r o t e c t e d in the presence o f Arepressor. T h e a b s e n c e o f d e t e c t a b l e c r o s s l i n k i n g at TA42 is a s c r i b e d to t h e i n h i b i t i o n o f e n z y m a t i c a c t i o n b y p s o r a l e n crosslinks. I n this case i n h i b i t i o n o f H i n d I I I cleavage a n d / o r e n d - l a b e l i n g b y D N A polymerase. T h e a p p a r e n t relative increase in c r o s s l i n k i n g o f 74
TA14
-
Fig.2. Psoralen photofootprinting of binding of A-repressor to the OR~ operator. The psoralen-treated plasmid was linearized with HindIII, treated with BAL31, cleaved with EcoRI and endlabeled. Lanes: 1, no repressor; 2,3, psoralen-treated in the presence of A-repressor (0.7 and 2/~g, respectively); M, DNA size marker. DNA analysis was performed on a 2007o polyacrylamide gel followed by autoradiography.
Volume 229, number 1
FEBS LETTERS
The open complex between E. coil RNA polymerase and a strong promoter, deol, was used to study the effect of specific protein-DNA interactions on the interstrand photocrosslinking of DNA by 4,5',8-tdmethylpsoraien in more detail, since more psoralen crosslinking sites can be analyzed in this system. The BamHI-SalI DNA fragment used in this study (fig.l) contains 11 5'-TA sites which are all crosslinked by the psoralen (fig.3a, lane 6; fig.3b, lane 5). Furthermore, faint bands (< 10°70 intensities) are observed at positions corresponding to 5'-AT sites. Upon binding of RNA polymerase complete inhibition of psoralen photocrosslinking occurs at sites TA10o, TAx0s and TAI~3 and ATs2, while partial inhibition is seen at TA73 (figs 1,2).
February 1988
DNase I footprinting results have shown that RNA polymerase protects to the - 5 0 to + 15 sequence of the deol promoter [17]. Accordingly, 5'-TA sites 100, 108 and 113 are not photocrosslinked with 4,5' ,8-trimethylpsoralen when RNA polymerase is bound to the promoter, in either the open or closed (not shown) complex. T~-ese results show that tight binding of protein to M
1
2
3
4
5
6
M
1419 Q
M
1
2
3
4
5
6
7
8
M
1419
$17
396 517 396
TA 15
TA
214
56
- 223
214
27
73 -
182 172
-
146
!13
113
146
I00
108
-
7S 65
108 100
- 73 Q
i
!
Fig.3. Psoralen photofootprinting of binding of RNA polymerase to the deol promoter. (a) the plasmid (pC J200) was linearized with Sail, digested with BAL31 and cleaved with BamHI. The labeled DNA fragments were analyzed on a 10% polyacrylamide gel. Lanes: 5, no psoralen, control; 6, psoralen, no polymerase; 7,8, psoralen-treated in the presence of RNA polymerase (3 and 7/zg, respectively); 1-4, as lanes 5-8 but without BAL31 treatment. (b) The plasmid was linearized with BamHI, digested with BAL31 and cleaved with HindIII. Lanes: 4, no psoralen, control; 5, psoralen, no polymerase; 6, psoralen-treated in the presence of polymerase; 1-3, as lanes 4-6 but without BAL31. The crosslinking degree was 0.005 per basepair. M, DNA size marker (pUCI9 x HinfI).
75
Volume 229, n u m b e r 1
FEBS L E T T E R S
DNA inhibits psoralen photocrosslinking, presumably due to a rigid conformation of the DNA. This rigidity prevents the helix extension and unwinding which are prerequisites for psoralen intercalation and photobinding. Interestingly, photocrosslinking of 5'-TA73 is only partly inhibited, indicating a less tight association of the enzyme with this part of the promoter. A more loose protein DNA contact around this site is also indicated by DNase I cleavage at positions - 34 and - 35 [17]. These results clearly show that 4,5' ,8-trimethylpsoralen (and presumably other psoralens as well) can be used for photofootprinting studies of protein-DNA interactions, and also firmly establish that psoralens do not induce DNA interstrand crosslinks in DNA which is tightly associated with protein. Acknowledgements: The financial support of the NOVO Foundation (a Hallas Moiler fellowship to P.E,N.), the Weimann Foundation (W.Z.) and the Danish Medical Science Research Council (C.J.) is gratefully acknowledged.
76
February 1988
REFERENCES [1] Hanson, C.V., Shen, C.J. and Hearst, J.E. (1976) Science 193, 62-64. [2] Wiesehahn, G.P., Hyde, J.E. and Hearst, J.E. (1977) Biochemistry 16, 925-932. [3] Potter, D.A., Fostel, J.M., Berninger, M., Pardue, M.L. and Cech, T.R. (1980) Proc. Natl. Acad. Sci. USA 77, 4118-4122. [4] Sogo, J.M., Ness, P.J., Widmer, R.M., Parish, R.W. and Koller, T. (1984) J. Mol. Biol. 178, 897-928. [5] De Bernardi, W., Koller, T. and Sogo, J.M. (1986) J. Mol. Biol. 191, 469-482. [6] Cech, T. and Pardue, M.L. (1977) Cell II, 631-640. [7] Kondoleon, S.K., Robinson, G.W. and Hallick, L.M. (1983) Virology 129, 261-273. [8] Zhen, W., Buchardt, O., Nielsen, H. and Nielsen, P.E. (1986) Biochemistry 25, 6598-6603. [9] Dandanell, G. (1985) Thesis, University of Copenhagen. [10] Valentin-Hansen, P., Aiba, H. and Schumperli, D. (1982) EMBO J. 1, 317-322. [1 l] Humayun, Z., Kleid, D. and Ptashne, M. (1977) Nucleic Acids Res. 4, 1595-1607. [12] Burgess, R.R. and Jendrisak, J.J. (1975) Biochemistry 14, 4634-4638. [13] Amann, E., Brosins, J. and Ptashne, M. (1983) Gene 25, 167-178. [14] Johnson, A.D., Pabo, C.O. and Sauer, R.T. (1980) Methods Enzymol. 65, 839-856. [15] Gamper, H., Piette, J. and Hearst, J.E. (1984) Photochem. Photobiol. 40, 29-34. [16] Sage, E. and Moustacchi, E. (1987) Biochemistry 26, 3307-3314. [17] Jeppesen, C., Buchardt, O., Henriksen, U. and Nielsen, P.E. (1987) submitted.