Purification and characterization of silkworm hemocytes by flow cytometry

Developmental and Comparative Immunology 33 (2009) 439–448

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Purification and characterization of silkworm hemocytes by flow cytometry Yuichi Nakahara 1, Sachiko Shimura 1, Chihiro Ueno, Yasushi Kanamori, Kazuei Mita, Makoto Kiuchi, Manabu Kamimura * National Institute of Agrobiological Sciences, 1-2 Ohwashi, Tsukuba, Ibaraki 305-8634, Japan

A R T I C L E I N F O

A B S T R A C T

Article history: Received 15 May 2008 Received in revised form 3 September 2008 Accepted 3 September 2008 Available online 7 October 2008

Hemocyte functions are well-investigated in the silkworm, Bombyx mori, however, detailed analysis of each hemocyte subset has been hampered by the lack of appropriate separation method. Here we use an array of flow cytometric analyses to characterize silkworm hemocytes with various molecular probes, such as propidium iodide, green fluorescence protein, monoclonal antibodies, and fluorescent lectins. Of these, separation using propidium iodide was the simplest and provided most reliable results for the isolation of the hemocyte subsets. cDNAs were then synthesized from these sorted populations and subset-specific gene expression was examined by RT-PCR. Granulocytes, plasmatocytes, and oenocytoids expressed different classes of immune genes, suggesting that they have multiple roles in silkworm immunity. In contrast, a contribution of spherulocytes to immunity was not documented in that they failed to express most of the genes. The functions of spherulocytes are thus likely to be distinct from those of the other three hemocyte subsets. ß 2008 Elsevier Ltd. All rights reserved.

Keywords: Bombyx mori Cell sorting Immunity Green fluorescence protein Lectin Pattern recognition protein Scavenger receptor Paralytic peptide

1. Introduction There are extensive similarities in functions and developmental processes between insect hemocytes and mammalian leukocytes [1,2]. Insect hemocyte research is most advanced in Drosophila melanogaster (Diptera), which has provided exciting insights into innate immunity, hematopoiesis, and hemocyte differentiation [1,2]. Hemocyte functions have also been closely studied in the silkworm, Bombyx mori (Lepidoptera) through the ages [3,4] because of its economic value in silk production. A lot of studies have demonstrated that Bombyx hemocytes play important roles in defense reactions such as phagocytosis, encapsulation, nodule formation, and melanin synthesis [4]. Silkworm hemocytes are morphologically classified into five subsets; i.e. prohemocytes, plasmatocytes, granulocytes, spherulocytes, and oenocytoids [3,5]. Generally, it is believed that prohemocyte is a multipotent stem cell [6], plasmatocytes and granulocytes are cells involved in cellular defense reactions [4], and oenocytoids are involved in melanization [7], whereas function of spherulocytes is completely unknown. However, recent studies have shown multiple functions of single hemocyte

subsets: e.g. granulocytes are also involved in the production of the antibacterial peptide cecropin B [8]. For detailed analyses at the molecular level, each subset needs to be available at high purity. Thus far, classifications of hemocyte subsets have been based only on subjective morphological observation, which often lead to misunderstanding and discrepancies of data among researchers [9]. Therefore, development of reliable molecular probes that discriminate between each hemocyte subset, such as specific antibodies or fluorescently labeled lectins, are matters of great importance [10]. Such molecular probes would also be useful for isolating pure hemocytes by flow cytometry. Flow cytometry has been used in the field of developmental biology and for purification of hemocytes of various animals including Drosophila [11]. Here we introduced flow cytometry to isolate silkworm hemocyte subsets and characterize them with various molecular probes. Using the isolated cells, immune gene expression profiles were established and their roles in humoral and cellular defense reactions are discussed. 2. Materials and methods 2.1. Silkworm

* Corresponding author. Tel.: +81 298 38 6073; fax: +81 298 38 6028. E-mail address: [email protected] (M. Kamimura). 1 These authors made equal contributions. 0145-305X/$ – see front matter ß 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2008.09.005

An F1 hybrid line between C145 and N140, was used for most experiments and referred to as the standard line. A transgenic line that expresses the green fluorescent protein (GFP) under the

440

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

control of the B. mori cytoplasmic actin A3 gene promoter [12] was referred to as the A3-GFP line. Silkworm larvae were reared on a commercial artificial diet (Silkmate1, Nihon Nosan Kogyo Co., Yokohama, Japan) under a 12-h light–dark photoregime at 25 8C. Larvae on day 1 of the 5th (final) stadium (L5-D1) were used for experiments unless otherwise indicated. 2.2. Hemocyte classification Akai and Sato [5] classified silkworm hemocytes into five morphotypes: prohemocytes, plasmatocytes, granulocytes, spherulocytes, and oenocytoids. However, here we include prohemocytes within the plasmatocyte subset, as in previous studies [13,14], because they are difficult to distinguish from small plasmatocytes and their population is very small in size in the early last larval instar. 2.3. Flow cytometric analysis and cell sorting The first and second abdominal prolegs of larvae chilled in iced water for 30 min were cut-off with scissors and hemolymph was collected in an anticoagulant buffer (98 mM NaOH, 186 mM NaCl, 17 mM EDTA and 41 mM citric acid, pH 4.5) on ice and centrifuged at 500  g for 1 min at 4 8C. The pellet was washed twice and resuspended in Pringle’s saline (154.1 mM NaCl, 27 mM KCl, 14 mM CaCl2, 22.2 mM dextrose) containing 2 mg/ml of propidium iodide (PI). Samples were held on ice until analysis, and passed through a cell-strainer (Falcon1 8235, Becton Dickinson Franklin, NJ) immediately before use in flow cytometry. Hemocytes were analyzed and sorted on an EPICS ELITE (Beckman Coulter) equipped with an argon laser (488 nm), and data were compensated, analyzed, and presented by EXPO32TM software (Beckman Coulter). Green (GFP and fluorescein) and red (PI and rhodamine) fluorescence were detected by using a 488 and 575/26 bandpass filter, respectively. The machine was standardized with fluorescent-beads and its detection sensitivities were adjusted based on hemocytes of the standard line (C145  N140) after dying with PI. 2.4. Fluorescent lectin staining Approximately, 100 ml of hemolymph was directly collected into chilled anticoagulant buffer, and washed twice with PBS. Hemocytes were suspended in 200 ml of PBS and 1 ml of a fluorescein-labeled lectin solution (Fluorescein Lectin Kit I, II, and III: Vector Laboratories Inc., Burlingame, CA) was added. Hemocytes were stained on ice for over 1 h. The sample was mixed with 800 ml of PBS containing 2 mg/ml of PI, and passed through the cell-strainer just before analysis. 2.5. RT-PCR analysis on sorted hemocytes The four hemocyte subsets at L5-D1 were sorted after staining with PI, and total RNA was extracted by the acid guanidinium– phenol–chloroform method using TRIzol (Invitrogen, Carlsbad, CA). Total RNA was also extracted from several L5-D1 tissues: the whole circulating hemocytes, hematopoietic organs, fat body, mid gut, posterior silk gland, and hemocytes newly discharged from the cultured L5-D1 hematopoietic organs. Discharged hemocytes were collected according to Nakahara et al. [13]. One hundred nanograms of total RNA was reverse-transcribed with an oligo (dT) primer using Ready-To-Go You-Prime First-Strand Beads (Amersham Pharmacia Biotech, Uppsala, Sweden). By using these cDNAs as templates for RT-PCR, we could compare mRNA expression levels of a total of 22 genes involved in immunity or

proteolysis. Of these, six novel cDNA sequences were identified here by sequencing cDNA clones registered in silkworm EST databases. We obtained cDNA clones containing the full open reading frames for four of these in a public silkworm EST database, KAIKObase (http://sgp.dna.affrc.go.jp/KAIKO/index.html [15]). cDNA clones for the remaining two genes were found in an unpublished full length EST database synthesized from the corpora allata of 4th instar larvae, which Dr. T. Shinoda kindly permitted us to screen. Names, accession numbers of genes analyzed here, primer sets used, and PCR cycles are listed in Table 1. Annealing was done at 50 8C for all reactions. 3. Results 3.1. Flow cytometry of live hemocytes Whole hemocytes of silkworm larvae at L5-D1 were subjected to flow cytometry after staining with PI. Although only dead hemocytes were stained with PI as assessed by fluorescence microscopy (PIhigh), increased sensitivity using flow cytometry enabled us to separate live hemocytes into two populations (PIlow and PInegative) (Fig. 1a). Plotted by forward scatter (FS) and side scatter (SS), PIlow cells presented as a single large cluster (Gate A), whereas PInegative cells formed two dense clusters (Gates B and C) (Fig. 1b). Light microscopy after cell sorting revealed that each cluster was composed of cells nearly uniform in morphology but belonging to different hemocyte subsets: Gates A–C cells consisted of granulocytes, spherulocytes, and plasmatocytes, respectively (Fig. 1c–e). Oenocytoids were PIlow and failed to form a cluster but were rather dispersed (Gate D) (Fig. 1f), probably reflecting large differences in size (ca. 10–40 mm) and complexity (density of cytoplasmic inclusions). Purity of oenocytoids in Gate D was 80% at a maximum because of contamination with aggregated granulocytes (Fig. 1f). Because oenocytoids constitute about 10% of all hemocytes at L5-D1 [14], the proportion of these cells was increased eightfold by this sorting procedure. Thus, we could obtain nearly pure populations of granulocytes, spherulocytes, plasmatocytes and highly enriched oenocytoids by cell sorting of whole larval hemocytes stained with PI. Next, we examined hemocytes from the transgenic line A3-GFP, in which plasmatocytes and oenocytoids appear bright green but granulocytes fluoresce very weakly [13]. A3-GFP hemocytes formed 2 peaks (GFPlow and GFPhigh) according to their fluorescence intensity (Fig. 2a). Plotted as FS/SS, GFPlow cells were found to represent granulocytes (Gate A), whereas GFPhigh cells were plasmatocytes (Gate C), and those not forming clusters were oenocytoids (Gate D). These results indicate that the distributions of these hemocyte subsets within the A3-GFP line were very similar to those of the standard line (Fig. 2b). Few, if any, spherulocytes (Gate B of the standard line) were detected, consistent with the rarity of this hemocyte subset in the A3-GFP line [13]. 3.2. Hemocyte-specific monoclonal antibodies Antibodies specific for molecules present only in particular cell populations represent powerful tools for discriminating between subsets in heterogeneous cell populations. Therefore, we attempted to generate monoclonal antibodies that reacted with a single hemocyte subset. We isolated 42 hybridomas that produced antibodies binding to hemocyte cell membranes. Of these, 22 recognized only granulocytes and one labeled a fraction of both plasmatocytes and oenocytoids. Of the granulocyte-specific antibodies, two designated mAbGR13 and mAbGR28 were selected for production in larger amounts, purified, and used for subsequent

Table 1 Information for genes expression of which was analyzed by RT-PCR and for PCR conditions. Gene name

Gene name in original papers

Abbreviation

Accession No.

EST clone name of novel gene

Reference

Forward primer

Reverse primer

PCR cycles

Product size (bp)

Pattern recognition protein

Peptidoglycan recognition protein Beta-1,3-glucan recognition protein 1 Beta-1,3-glucan recognition protein 2

Peptidoglycan recognition protein Beta-1,3-glucan recognition protein Gram-negative bacteria-binding protein –

PGRP

AB016249

–

[39]

CTCTCAGCTCGCTTCTCACA

GATGAATGCGACTCCGATGG

35

338

bGRP1

AB026441

–

[16]

ACCACCATCTGAAGGCTATC

GGTATACGTTGAAGGGAAAG

35

179

bGRP2

L38591

–

[17]

GGACGCGTGTTGTGTCTGAT

GGTGCTGTCCAGTTTATGGT

35

168

bGRP3

AB436166

wdV40436

CCCTCCAGCTAAACTTGAAG

GTCCATTCGCCGTTATCCTG

35

272

–

SCR-C

AB436164

heS01053

This paper This paper

TCCTCTAGCCCATCCCAGAA

GCAGGTTTTACTGTAGTGCT

30

160

Prophenoloxidase activating enzyme Prophenoloxidase subunit 1 Prophenoloxidase subunit 2 Serine protease homolog 1

Prophenoloxidase activating enzyme Prophenoloxidase subunit 1 Prophenoloxidase subunit 2 –

POAE

AB009670

–

[24]

AGCATCGCGCCTTTTACAGA

ACCACCCGAGTCACCCTTAC

35

304

proPO1

D49370

–

[38]

AACAACACAGGAGGCAGCAG

GGACACCATGACGAACAGCA

35

354

proPO2

D49371

–

[38]

GACAACCGAACACGCTGAAC

GAATATCCAGGGGACATTGC

30

224

SPH1

AB436165

heS30477

This paper

CAAGTTCGGGAAGGAAGGTA

TATGCCCCAGGCTACGATGC

35

259

BAEEase

BAEEase

BAEEase

AB035418

–

[25]

TTCTACTGCGGAGGTGTGCT

CTGCGCATTCCTTGAGAGTC

35

273

Cecropin A Cecropin B Cecropin D Lebocin

Cecropin A Cecropin B Cecropin D Lebocin

CecA CecB CecD Lebo

D17394 D11113 AB010825 S79612

– – – –

[40] [41] [42] [43]

GTATTTTGAGCTTCGTCTTC TTCGCAAAGATCCTATCCTT CGTGTTCGCTATTGTTTTCG CCGATCGAGAGCCACCGTAA

CTATAGCTGGACCCGCTTTG AGGACCTCGATCGCCGGGCC TGTCCGAGAGCTTTTGCTTT CCTCGGAATCAGAAAGTGCT

35 30 35 35

144 158 153 189

Paralytic peptide

Paralytic peptide

PP

AB064522

–

[44]

GGATAGATTGATTTTCCGAGAC

CTGCTGATGTTGGAGTAGGC

35

164

Paralytic peptide binding protein 1 Paralytic peptide binding protein 2

Paralytic peptidebinding protein –

PPBP1

DQ306881

–

[19]

TGCCCGCAGACTTGAAGACC

TTGTAATGGTTGCCGATGAG

30

331

PPBP2

AB436163

heS00256

This paper

TCAACGGGGGACTGTATTCG

ATGCCGTAGATGACGACCAT

30

265

Cathepcin B Cathepcin L like protein Egg cysteine proteinase Hemocyte protease 1

Cathepcin B –

CatB Cat L-like

AB045595 AB436161

– fcaL-P44H09

ACAAATGGCCTGACTGTCCA GGACTGACGTCACGCCACTT

AGGGATCTCGTAAGGTCTGC GTTGGTTCTGTTGCGATACC

35 25

293 298

Egg cysteine proteinase –

ECP

S77508

–

[45] This paper [46]

TGGCTCGTGAAGAACTCGTG

TGTGGTATTGCCGTCCTCAG

30

319

HP1

AB436162

fcaL-P35P12

CATAGAGGCTCTGGCTGGAG

CGGCGTCCCATCTTCTTGTA

25

272

Cathepsin D

Cathepsin D

CatD

NM_001043886

–

This paper [47]

GACACGTACTGGGAGTTCCA

CGTGTAGTACTTGCCGATGA

35

384

Ribosomal protein L3

Ribosomal protein L3 Ribosomal protein P2

RpL3

AB024901

–

[48]

AAAGAGGTCCCGTCGTCATC

ACATATGCTCCGCCCAGACA

35

275

RpP2

AM260708

–

[49]

TGCCGCTGACGTTGAGAAGA

CCTACTGGCATTGACGACAG

35

147

Beta-1,3-glucan recognition protein 3 Scavenger receptor type C Phenol oxidase cascade

Anti-microbial peptide induction

Paralytic peptide signaling

Proteases

Ribosomal proteins

Ribosomal protein P2

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

Category

441

442

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

Fig. 1. Flow cytometric analysis of live hemocytes from the silkworm. (a) L5D1 hemocytes from a standard line were stained with PI and subjected to flow cytometry with enhanced PI-sensitivity. Based on PI intensity, whole live hemocytes form two peaks (PInegative and PIlow), with dead cells (PIhigh). (b) PInegative (red dots) and PIlow (blue dots) were plotted as FS/SS and cells in each gate were sorted. (c) Cells in Gate A for PIlow were uniformly granulocytes. (d) Cells in Gate B for PInegative were uniformly spherulocytes. (e) Cells in Gate C for PInegative were uniformly plasmatocytes. (f) Cells (80% at a maximum) in Gate D for PIlow were oenocytoids with contaminations by granulocytes. Insets are enlarged views of a typical cell of each subset. Bars are 10 mm.

Fig. 2. Flow cytometric analysis of live hemocytes from a L5D1 larva of the GFP-transgenic line A3-GFP. (a) A3-GFP hemocytes showed bimodal distribution based on GFP expression. (b) Cells with GFPlow (red dots) were granulocytes (Gate A) and GFPhigh (blue dots) were plasmatocytes (Gate C) and oenocytoids (Gate D). Spherulocytes (Gate B) are absent in this line.

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

443

Fig. 3. Immunostaining of fixed hemocytes with the granulocyte-specific antibodies, mAbGR13 and mAbGR28. (a) Histogram of L5D1 hemocytes stained with only secondary antibody (control: black), mAbGR13 (blue) or mAbGR28 (red). Negative cells (b and f) and positive cells (c and g) plotted as FS/SS and gated as in Fig. 1a. Positive cells clustered in Gate A but not in Gate B and C (c and g). Hemocytes stained with granulocyte-specific antibodies, mAbGR13 (d and e) and mAbGR28 (h and i) observed under a differential interference microscope (d and h) and a fluorescence microscope (e and i). GR: granulocytes, PL: plasmatocytes, SP: spherulocytes, OE: oenocytoids.

analysis, because of their fine staining of hemocytes. These antibodies bound to the cell membrane of fixed granulocytes, but neither to live granulocytes nor to other hemocyte subsets (Fig. 3d, e, h and i). Examination of whole body paraffin sections of 4th instar larvae revealed no cross-reactive staining of any other tissues (data not shown). Flow cytometric analysis of fixed whole hemocytes showed that approximately 80% and 60% of cells from the standard line were labeled with mAbGR13 and mAbGR28, respectively (Fig. 3a). Cells staining with either antibody formed a cluster of granulocytes (Fig. 3c and g), whereas mAbGRnegative cells were plasmatocytes and spherulocytes (Fig. 3b and f). When mAbGRpositive cells in Gate A (Fig. 3c and g) were sorted, purity of the granulocytes obtained was nearly 100% with either antibody (data not shown). 3.3. Lectin staining and cell sorting We stained live whole hemocytes with 21 different fluorescein-conjugated lectins and assessed the binding affinity of each to cells contained in gates of granulocytes, spherulocytes, and plasmatocytes (Gates A–C in Fig. 1) in flow cytometry (Fig. 4). Oenocytoids were excluded from the analyses because of the difficulty of identifying this subset in the FS/SS plots due to the wide scatter of events recorded. Granulocytes had the highest affinities for most lectins regardless of their major hapten sugars. However, there were some exceptions, e.g. the GlcNAc-binding lectins WGA and suc-WGA bound to spherulocytes with the highest binding affinities, and a fucose-binding lectin, UEA-1, showed higher binding affinity to plasmatocytes than to other two hemocyte subsets. Some lectins showed distinct binding affinities to one hemocyte subset and not the others. Because binding affinities of GlcNAcbinding lectins LEL and STL to spherulocytes were much lower than to granulocytes and plasmatocytes, these lectins may be useful to isolate spherulocytes. LCA, Jacalin, and RCA120 clearly distin-

guished granulocytes from the other two subsets. Using these lectins, each subset could be isolated by a combination of FS/SS plotting, because Gate B and Gate C are far apart on the FS/SS plots. Thus, some lectins could be useful tools for isolating the silkworm hemocyte subsets by cell sorting. 3.4. Identification of new cDNAs To examine hemocyte subset-specific gene expression, we focused on 22 genes encoding proteins involved in innate immunity and proteolysis. We isolated six novel cDNA clones from silkworm EST databases and sequenced them. Beta-1, 3glucan recognition protein 3 (bGRP3), the third member of this family to be found in the silkworm, had a deduced amino acid sequence 55% and 33% homologous to the previously reported bGRP1 (beta-1, 3-glucan recognition protein [16]) and bGRP2 (Gram-negative bacteria-binding protein [17]), respectively. Class C scavenger receptor (SCR-C) is the second scavenger receptor identified in the silkworm and 29% homologous to the D. melanogaster scavenger receptor CII [18]. The paralytic peptide binding protein 2 (PPBP2) is the second member of this family in the silkworm. Its deduced amino acid sequence is 51% identical to the recently reported PPBP1 [19]. Serine protease homolog 1 (SPH1) is a serine protease-like protein but its active site serine is replaced by a glycine residue, suggesting that it has no proteolytic activity. Because its homologous proteins in Manduca sexta [20] (64% homologous) and Holotrichia diomphalia [21] (46% homologous) are involved in prophenol oxidase activation, SPH1 likely has the same function in the silkworm. Cathepsin L-like protein is a member of the papain family of cysteine proteases and showed high sequence similarity to cathepsin L of various other species. This is most similar (38% homologous) to Sarcophaga peregrina 26, 29 kDa protease [22]. Hemocyte protease 1 is a serine protease most similar (73% homologous) to M. sexta hemocyte protease 1 [23].

444

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

Fig. 4. Flow cytometric analysis of live hemocytes stained with lectins conjugated with fluorescein. First, cells were plotted as FS/SS and gated as shown in Fig. 1a. Cells in each gate are presented in a histogram. Gate A (red line) contained mainly granulocytes, Gate B (green line) spherulocytes, and Gate C (blue line) plasmatocytes. Note that some contamination of one hemocyte subset with others, especially granulocytes with spherulocytes and plasmatocytes, occurred. Lectins were classified based on their hapten sugar. For GalNAc- and GluNAc-binding lectins, histograms showing similar binding patterns are arranged in one row. Man: mannose binding lectin, GalNAc: N-acetyl-Dgalactosamine binding lectin, Fuc: fucose binding lectin, GlcNAc: N-acetyl-D-glucosamine binding lectin, ConA: concanavalin A, DBA: Dolichos bifrorus agglutinin, DSL: Datura stramonium lectin, ECL: Erythrina cristagalli lectin, GSL-I: Griffonia (Bandeiraea) simplicifolia lectin I, GSL-II: Griffonia (Bandeiraea) simplicifolia lectin II, Jacalin: Artocarpus integrifolia (Jackfruit) seed lectin,LCA: Lens culinaris agglutinin, LEL: Lycopersicon esculentum (Tomato) lectin, PHA-E: Phaseolus vulgaris erythroagglutinin, PHA-L: Phaseolus vulgaris leucoagglutinin, PNA: Peanut agglutinin, PSA: Pisum sativum agglutinin, RCA120: Ricinus communis agglutinin I, SBA: Soybean agglutinin, SJA: Sophora japonica agglutinin, STL: Solanum tuberosum (Potato) lectin, UEA-I: Ulex europaeus agglutinin I, VVA: Vicia villosa agglutinin, WGA: wheat germ agglutinin, suc.WGA: succinylated wheat germ agglutinin.

3.5. Gene expression in hemocyte We compared mRNA expression levels of 17 genes involved in innate immunity and 5 genes encoding various proteases in different L5-D1 larval tissues and the 4 hemocyte subsets by RTPCR (Fig. 5). First, we examined mRNA expression of three types of pattern recognition proteins that detect invading microorganisms: a peptidoglycan recognition protein (PGRG), three beta-1, 3-glucan recognition proteins (bGRP1, 2, 3) and a class C scavenger receptor (SCR-C). They showed different tissuespecific expression profiles. PGRP was expressed strongly in the whole hemocytes and fat body and weakly in the mid gut and posterior silk gland. The three bGRPs were expressed much more strongly in the fat body than in whole hemocytes. bGRP1 and bGRP 2 were expressed weakly also in the mid gut. In contrast, expression of SCR-C was detected only in the whole hemocyte population. Hemocyte subset-specific expression profiles of these genes were also different. Expression of bGRP3 was detected only in plasmatocytes. The remaining four genes were expressed in granulocytes, plasmatocytes, and oenocytoids, but not, or only very weakly, in spherulocytes. bGRP1, bGRP2, and SCR-C were expressed most strongly in plasmatocytes, granulocytes, and oenocytoids, respectively.

PGRP mRNA was detected in the three hemocyte subsets at similar levels. Detection of microorganisms by pattern recognition proteins triggers the phenol oxidase cascade, in which the pro-phenol oxidase activating enzyme (PPAE) is engaged to process prophenol oxidase into its active form [24]. PPAE was expressed more strongly in the whole hemocytes than in the other three tissues. PPAE mRNA was detected from all the four hemocyte subsets. mRNAs of the two prophenol oxidase subunits (proPO1 and proPO2) were also expressed in all the four hemocyte-subsets, among which oenocytoids showed the strongest signals for both. Tissue-specific expression profiles of proPO1 and proPO2 were, however, different from one another: proPO2 was hemocytespecific, whereas prPO1 seemed ubiquitous. Serine protease homolog 1 (SPH1) was expressed only in the whole hemocytes and fat body in the four L5-D1 tissues and expressed only in plasmatocytes in the four hemocyte subsets. Invasion of microorganisms activates Spatzle-Processing enzyme (SPE), which triggers the Toll cascade to induce expression of anti-microbial peptides in D. melanogaster [25]. mRNA of BAEEase, a homolog of SPE in the silkworm, was strongly expressed in the fat body. Its faint signal was detected in plasmatocytes, but not in the other hemocyte subsets. We analyzed mRNA expression

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

445

Fig. 5. mRNA expression analysis of genes involved in immunity and proteolysis in L5-D1 larval tissues and in purified hemocyte subsets. Full gene names are listed in Table 1. Expression of two ribosomal protein genes, RpL3 and RpP2, is shown as controls. Hm: whole hemocyte, FB: fat body, MG: mid gut, PSG: posterior silk gland, HPO; hematopoietic organ, new Hm: new hemocyte discharged from cultured hematopoietic organ, GR: granulocytes, SP: spherulocytes, PL: plasmatocytes, OE: oenocytoids.

of six anti-microbial peptides and detected cecropins A, B, D, and lebocin (Fig. 5) but not moricin or enbocin (data not shown) in the whole hemocytes and fat body. Cecropin D was expressed also in the mid gut. Expression of lebocin was detected only in plasmatocytes among the four hemocyte subsets. Cecropin D was expressed in granulocytes and oenocytoids. Cecropins A and B were expressed in three hemocyte subsets but not in spherulocytes. Note that expression levels of the antimicrobial peptides were sub-maximal because the silkworms from which the mRNA was sampled had not been subjected to any particular immune challenge. Bleeding or bacterial challenge activates an insect cytokine, paralytic peptide (PP), which induces spreading of plasmatocytes and increases immunity against bacterial infection [13,26]. PP was expressed in the whole hemocytes and fat body. Of the four hemocyte subsets, PP mRNA was detected only in plasmatocytes. The two PP binding proteins, PPBP1 and PPBP2, are counterparts of the growth blocking peptide (GBP)-binding protein of the noctuid moth Pseudaletia separata in Bombyx. mRNAs for both PPBP1 and PPBP2 were detected only in the whole hemocytes of the four L5D1 tissues. Similar to GBP binding protein, released from oenocytoids [27], mRNAs of the two PP binding proteins were expressed strongly in oenocytoids. We detected weak signals of PPBP2 in the other three hemocyte subsets but not those of PPBP1. Next, we examined mRNA expression of five proteases and found that expression of cathepsin L-like protein and hemocyte protease 1 (HP1) were hemocyte-specific. Cathepsin B was expressed in the whole hemocytes, fat body, and posterior silk glands. Cathepsin D and egg cysteine protease (ECP) were expressed in all the four tissues. In the four hemocyte subsets, cathepsin L-like protein was expressed very strongly in spher-

ulocytes. A faint signal was detected in plasmatocytes but not either in granulocytes or oenocytoids. Of the 22 genes tested here, this is the only one that we found to be expressed strongly in spherulocytes. HP 1 was expressed in all subsets except spherulocytes. Cathepsin B was expressed in oenocytoids and granulocytes, and ECP in plasmatocytes and oenocytoids. Cathepsin D was expressed in all the four hemocyte subsets. We also examined gene expression in the hematopoietic organs and hemocytes newly discharged from them. Both expressed all the genes tested, except PPBP1, PPBP2 and cathepsin-like protein. It is noteworthy that many genes were expressed very strongly in the hematopoietic organ and newly discharged hemocytes, even those expressed only weakly in circulating hemocytes, suggesting that their expression decreases with differentiation and maturation. 4. Discussion 4.1. Purification of silkworm hemocyte subsets by FACS Establishment of a simple and reliable method to discriminate and isolate a different cell types from heterogeneous populations is a cornerstone of cell and developmental biology. Thus far, however, techniques for the isolation of silkworm hemocyte subsets have not yielded satisfactory purities. When we tried to isolate plasmatocytes and granulocytes by Percoll density gradient centrifugation, which is conventionally the most reliable method for insect hemocytes [28,29], purities of plasmatocytes were only around 70% at a maximum [13]. Here, we introduced the use of flow cytometry, which is commonly employed to separate blood cells in mammals [30], but rarely in insects [11].

446

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

We examined a number of fluorescent probes and specific antibodies for their utility for isolating the four major hemocyte subsets (granulocytes, plasmatocytes, oenocytoids and spherulocytes) present in the early last instar larvae. Whereas each approach had merits and demerits, we adopted the simplest method using PI in the present study in order to examine hemocyte subset-specific gene expression. Although PI is generally used to detect dead cells (PIhigh), increasing the sensitivity of fluorescence detection by flow cytometry enabled us to divide live hemocytes into two populations: PIlow for plasmatocytes and spherulocytes and PInegative for granulocytes and oenocytoids. These populations could then be further separated by their size (forward scatter) and complexity of cell contents (side scatter), enabling isolation of all the four hemocyte subsets by cell sorting (Fig. 1). Purities of the four hemocyte subsets obtained by this method were shown to be high enough to compare their gene expression levels by RT-PCR (Fig. 5). This simple method, requiring neither special antibodies nor transgenic markers, is potentially applicable to other insect species. Certain fluorescent lectins could be also useful for isolating silkworm hemocyte subsets (Fig. 4) as already shown in other insects [11,31–33]. For example, we found that the GlcNAc-binding lectins LEL and STL separated spherulocytes from granulocytes efficiently, and the GalNAc-binding lectins PNA and RCA 120 could be used for plasmatocytes (Fig. 4). However, lectin binding to hemocyte surface might affect immune gene expression in these cells, because sugar-chains play an important role in non-self recognition. Lectin binding strength may reflect physiological states of hemocytes, because binding affinities of Drosophila lamellocytes to the GlcNAc binding lectin WGA were correlated with intercellular Ca2+ concentrations [11]. Plasmatocytes showed very broad binding affinities to some lectins, for example the GalNAc binding RCA120 and PNA and the fucose-binding UEA-1 (Fig. 4), suggesting detection of subpopulations at different stages or different biological activities. It is known that there are subpopulations in lepidopteran plasmatocytes reacting differently to paralytic peptide [14] and with different affinities for a specific antibody [34], which may be isolated using these lectins. Likewise, the GlcNAc-binding lectin LEL could discriminate two sub-populations of spherulocytes. Hemocyte-specific monoclonal antibodies have already been generated in some insects and are expected to provide powerful tools for cytometric analyses [35]. However, contrary to our expectation, the granulocyte-specific antibodies that we newly generated are not suitable for use with live cells, and no antibody specific for other subsets was generated in these experiments. In order to analyze hemocyte function in silkworms, therefore, antibodies that react to live cells are still required. Green fluorescent protein (GFP) expressed by transgenesis was also found to be a good molecular marker to segregate hemocyte subsets (Fig. 2) as in transgenic flies [11]. In future, use of transgenic lines in which a fluorescent protein is expressed under the control of a hemocyte-subset specific promoter may enable simpler and more efficient purification of single hemocyte subsets. Such promoters will be available through transcriptional regulatory analysis for genes that are expressed only in one hemocyte subset (Fig. 5). 4.2. Characterization of hemocyte subsets We characterized the hemocyte subsets by analyzing their expression of 22 selected genes. The results revealed many new characteristics and functions of each hemocyte subset, as discussed below.

4.2.1. Granulocytes Granulocytes play a central role in cellular immunity in B. mori [4]. This is the main hemocyte subset that phagocytoses foreign bodies. When these are too large to be phagocytosed, the granulocytes encapsulate them in cooperation with plasmatocytes. Overall, granulocytes have the strongest affinities for most lectins tested here (Fig. 4), suggesting that a wide variety of sugars is present in abundance on the cell surface. This rich glycosylation likely contributes to recognition of and adherence to foreign bodies. Granulocytes express SCR-C (Fig. 5), the only protein expected to locate to the cell surface of all the pattern recognition proteins examined here. D. melanogaster scavenger receptor C1 can recognize both Gram-negative and Gram-positive bacteria to trigger their phagocytosis [36]. Also in the silkworm, therefore, SCR-C may mediate phagocytosis of bacteria by granulocytes. Although so far little is known about the contribution of granulocytes to humoral immunity in the silkworm [8], it has been shown that this hemocyte subset expresses various antimicrobial proteins in another lepidopteran insect Pseudoplusia includens [37]. In the present study, granulocytes were found to express cecropins A, B and D and various soluble pattern recognition protein genes (Fig. 5), indicating that these cells may have important roles in both cellular and humoral immunity. 4.2.2. Plasmatocytes Plasmatocytes play a role in encapsulation [4], but their contribution to humoral immunity is also largely unknown. RTPCR analysis showed that many immune genes including soluble pattern recognition proteins and anti-microbial proteins are expressed in plasmatocytes (Fig. 5), indicating that this hemocyte subset also plays multiple roles in silkworm immunity. In particular, lebocin, serine protease homolog 1, and paralytic peptide were expressed only in plasmatocytes and no other hemocyte subset. Secretion of these proteins is likely to be responsible for the specific immune function of plasmatocytes. In addition, these genes are expressed strongly at early stages of hematopoiesis, as they are present in the hematopoietic organ and newly discharged hemocytes, which consist mainly of young plasmatocytes [13,14]. Although the insect cytokine paralytic peptide triggers spreading of plasmatocyte [13], the paralytic peptide binding proteins, PPBP1 and PPBP2 were found to be expressd only very weakly or not at all in plasmatocytes (Fig. 5). Therefore, a different paralytic peptide receptor may be expressed on the plasmatocyte cell membrane, but this remains to be identified. In addition, the paralytic peptide probably acts in an autocrine manner, because it is expressed by plasmatocytes themselves. 4.2.3. Oenocytoids Oenocytoids are well known as the major source of prophenol oxidase (a heterodimer of proPO1 and proPO2) in B. mori [38] as well as in other insects [35], as confirmed by our results here (Fig. 5). Oenocytoids also strongly expressed PPBP1 and PPBP2 (Fig. 5). It is assumed that both PPBPs, which lack the N-terminal signal peptide, are released through oenocytoid cell rupture to terminate the inflammatory action of the paralytic peptide, as is GBP binding protein, the counterpart molecule of PPBPs, in P. separata [27]. In addition, a membrane-bound pattern recognition protein SCR-C was strongly expressed in oenocytoids (Fig. 5), suggesting that these cells are capable of recognizing bacterial infection directly. Our RT-PCR analysis also showed that oenocytoids express multiple soluble pattern recognition proteins and antimicrobial protein genes, similar to granulocytes (Fig. 5). However, this might

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

partly be caused by contamination of oenocytoids by granulocytes (Fig. 1). A pure population of oenocytoids is necessary before certainty in the gene expression profiles can be achieved. 4.2.4. Spherulocytes A distinct biological role for the spherulocytes in any insect species has so far eluded definition [35]. mRNAs of many immune genes expressed in other hemocyte subsets were rarely detected in spherulocytes (Fig. 5), suggesting that these cells make little or no contribution to silkworm immunity and that they may have roles distinct from the other hemocyte subsets. Instead, cathepsin L-like protein of unknown function was found to be strongly expressed in spherulocytes (Fig. 5). Analysis of this protein will help elucidate a biological role of spherulocytes. In addition, this gene can be used as a spherulocyte-specific molecular marker, something not available before in any insect species [35]. 4.3. Future perspectives The goal of this study was to define the biological functions of each hemocyte subset. We showed here that flow cytometry can be a powerful tool for purifying and characterizing these cells. In vitro biological experiments and more detailed gene expression analysis using hemocyte subsets purified by flow cytometry will facilitate greater insight into insect humoral and cellular defense systems and may lead to detection of other functions of insect hemocytes. In addition, this technique will also be useful in analyzing the hematopoietic lineage of the silkworm. So far, the hematopoietic lineage and its regulatory mechanisms are not well understood in any insect species except for D. melanogaster [1,35]. In this report, we documented that a fluorescent protein reporter introduced by transgenesis facilitated the determination of the different hemocyte subsets (Fig. 2). Exploitation of different transgenic silkworms in in vivo and ex vivo analyses will illuminate processes of hemocyte growth, differentiation, and maturation both in the hematopoietic organ and in hemolymph. Acknowledgements We thank Dr. Tetsuro Shinoda for permitting us to search an unpublished silkworm corpora allata EST database, Dr. Toshiki Tamura for the gift of the B. mori transgenic line A3-GFP, Drs. Jun Ishibashi and Hiromitsu Tanaka for their valuable advice about the insect immune system, and the National Bio-Resource Project (NBRP) for supplying cDNA clones. This work was supported by the Bio-oriented Technology Research Advancement Institution (BRAIN) of Japan. EST sequencing was partly supported by grants (Insect Genome) from the Ministry of Agriculture, Forestry and Fisheries of Japan. References [1] Williams MJ. Drosophila hemopoiesis and cellular immunity. J Immunol 2007;178:4711–6. [2] Wood W, Jacinto A. Drosophila melanogaster embryonic haemocytes: masters of multitasking. Nat Rev Mol Cell Biol 2007;8:542–51. [3] Nittono Y. Studies on the blood cells in the silkworm, Bombyx mori L. Bull Sericul Exp Station 1960;16:171–266. [4] Wago H. Phagocytic recognition in Bombyx mori. In: Gupta AP, editor. Immunology of insects and other arthropods. Boca Raton: CRC Press; 1991. [5] Akai H, Sato S. Ultrastructure of the larval hemocytes of the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae). Int J Insect Morphol Embryol 1973;2:207–31. [6] Yamashita M, Iwabuchi K. Bombyx mori prohemocyte division and differentiation in individual microcultures. J Insect Physiol 2001;47:325–31. [7] Iwama R, Ashida M. Biosynthesis of prophenoloxidase in hemocytes of larval hemolymph of the silkworm, Bombyx mori. Insect Biochem 1986;16:547–55.

447

[8] Imamura M, Nakahara Y, Kanda T, Tamura T, Taniai K. A transgenic silkworm expressing the immune-inducible cecropin B-GFP reporter gene. Insect Biochem Mol Biol 2006;36:429–34. [9] Lavine MD, Strand MR. Insect hemocytes and their role in immunity. Insect Biochem Mol Biol 2002;32:1295–309. [10] Ling E, Shirai K, Kanekatsu R, Kiguchi K. Classification of larval circulating hemocytes of the silkworm, Bombyx mori, by acridine orange and propidium iodide staining. Histochem Cell Biol 2003;120:505–11. [11] Tirouvanziam R, Davidson CJ, Lipsick JS, Herzenberg LA. Fluorescence-activated cell sorting (FACS) of Drosophila hemocytes reveals important functional similarities to mammalian leukocytes. Proc Natl Acad Sci USA 2004;101: 2912–7. [12] Tamura T, Thibert C, Royer C, Kanda T, Abraham E, Kamba M, et al. Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposonderived vector. Nat Biotechnol 2000;18:81–4. [13] Nakahara Y, Kanamori Y, Kiuchi M, Kamimura M. Effects of silkworm paralytic peptide on in vitro hematopoiesis and plasmatocyte spreading. Arch Insect Biochem Physiol 2003;52:163–74. [14] Nakahara Y, Kanamori Y, Kiuchi M, Kamimura M. In vitro studies of hematopoiesis in the silkworm: cell proliferation in and hemocyte discharge from the hematopoietic organ. J Insect Physiol 2003;49:907–16. [15] Mita K, Morimyo M, Okano K, Koike Y, Nohata J, Kawasaki H, et al. The construction of an EST database for Bombyx mori and its application. Proc Natl Acad Sci U S A 2003;100:14121–6. [16] Ochiai M, Ashida M. A pattern-recognition protein for beta-1,3-glucan. The binding domain and the cDNA cloning of beta-1,3-glucan recognition protein from the silkworm, Bombyx mori. J Biol Chem 2000;275:4995–5002. [17] Lee WJ, Lee JD, Kravchenko VV, Ulevitch RJ, Brey PT. Purification and molecular cloning of an inducible gram-negative bacteria-binding protein from the silkworm, Bombyx mori. Proc Natl Acad Sci USA 1996;93:7888–93. [18] Pearson A, Lux A, Krieger M. Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster. Proc Natl Acad Sci USA 1995;92:4056–60. [19] Hu ZG, Chen KP, Yao Q, Gao GT, Xu JP, Chen HQ. Cloning and characterization of Bombyx mori PP-BP a gene induced by viral infection. Yi Chuan Xue Bao 2006;33:975–83. [20] Yu XQ, Jiang H, Wang Y, Kanost MR. Nonproteolytic serine proteinase homologs are involved in prophenoloxidase activation in the tobacco hornworm, Manduca sexta. Insect Biochem Mol Biol 2003;33:197–208. [21] Kwon TH, Kim MS, Choi HW, Joo CH, Cho MY, Lee BL. A masquerade-like serine proteinase homologue is necessary for phenoloxidase activity in the coleopteran insect, Holotrichia diomphalia larvae. Eur J Biochem 2000;267: 6188–96. [22] Fujimoto Y, Kobayashi A, Kurata S, Natori S. Two subunits of the insect 26/29kDa proteinase are probably derived from a common precursor protein. J Biochem 1999;125:566–73. [23] Jiang H, Wang Y, Kanost MR. Four serine proteinases expressed in Manduca sexta haemocytes. Insect Mol Biol 1999;8:39–53. [24] Satoh D, Horii A, Ochiai M, Ashida M. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori. Purification, characterization, and cDNA cloning. J Biol Chem 1999;274:7441–53. [25] Jang IH, Chosa N, Kim SH, Nam HJ, Lemaitre B, Ochiai M, et al. A Spatzleprocessing enzyme required for toll signaling activation in Drosophila innate immunity. Dev Cell 2006;10:45–55. [26] Ishii K, Hamamoto H, Kamimura M, Sekimizu K. Activation of the silkworm cytokine by bacterial and fungal cell wall components via a reactive oxygen species-triggered mechanism. J Biol Chem 2008;283:2185–91. [27] Matsumoto Y, Oda Y, Uryu M, Hayakawa Y. Insect cytokine growth-blocking peptide triggers a termination system of cellular immunity by inducing its binding protein. J Biol Chem 2003;278:38579–85. [28] Mead GP, Ratcliffe NA, Renwrantz LR. The separation of insect haemocyte types on percoll gradients; methodology and problems. J Insect Physiol 1986; 32:167–77. [29] Pech LL, Trudeau D, Strand MR. Separation and behavior in vitro of hemocytes from the moth, Pseudoplusia includens. Cell Tissue Res 1994;277:159–67. [30] Matteucci E, Giampietro O. Flow cytometry study of leukocyte function: analytical comparison of methods and their applicability to clinical research. Curr Med Chem 2008;15:596–603. [31] Hillyer JF, Christensen BM. Characterization of hemocytes from the yellow fever mosquito, Aedes aegypti. Histochem Cell Biol 2002;117:431–40. [32] Nardi JB. Embryonic origins of the two main classes of hemocytes – granular cells and plasmatocytes – in Manduca sexta. Dev Genes Evol 2004;214:19–28. [33] Nardi JB, Zhuang S, Pilas B, Bee CM, Kanost MR. Clustering of adhesion receptors following exposure of insect blood cells to foreign surfaces. J Insect Physiol 2005;51:555–64. [34] Gardiner EM, Strand MR. Hematopoiesis in larval Pseudoplusia includens and Spodoptera frugiperda. Arch Insect Biochem Physiol 2000;43:147–64. [35] Strand MR. The insect cellular immune response. Insect Sci 2008;15:1–14. [36] Ramet M, Pearson A, Manfruelli P, Li X, Koziel H, Gobel V, et al. Drosophila scavenger receptor CI is a pattern recognition receptor for bacteria. Immunity 2001;15:1027–38. [37] Lavine MD, Chen G, Strand MR. Immune challenge differentially affects transcript abundance of three antimicrobial peptides in hemocytes from the moth Pseudoplusia includens. Insect Biochem Mol Biol 2005;35:1335–46.

448

Y. Nakahara et al. / Developmental and Comparative Immunology 33 (2009) 439–448

[38] Kawabata T, Yasuhara Y, Ochiai M, Matsuura S, Ashida M. Molecular cloning of insect pro-phenol oxidase: a copper-containing protein homologous to arthropod hemocyanin. Proc Natl Acad Sci USA 1995;92:7774–8. [39] Ochiai M, Ashida M. A pattern recognition protein for peptidoglycan. Cloning the cDNA and the gene of the silkworm, Bombyx mori. J Biol Chem 1999;274:11854–8. [40] Yamano Y, Matsumoto M, Inoue K, Kawabata T, Morishima I. Cloning of cDNAs for cecropins A and B, and expression of the genes in the silkworm, Bombyx mori. Biosci Biotechnol Biochem 1994;58:1476–8. [41] Taniai K, Kato Y, Hirochika H, Yamakawa M. Isolation and nucleotide sequence of cecropin B cDNA clones from the silkworm, Bombyx mori. Biochim Biophys Acta 1992;1132:203–6. [42] Yang J, Furukawa S, Sagisaka A, Ishibashi J, Taniai K, Shono T, et al. cDNA cloning and gene expression of cecropin D, an antibacterial protein in the silkworm. Bombyx mori Comp Biochem Physiol B Biochem Mol Biol 1999; 122:409–14. [43] Chowdhury S, Taniai K, Hara S, Kadono-Okuda K, Kato Y, Yamamoto M, et al. cDNA cloning and gene expression of lebocin, a novel member of antibacterial peptides from the silkworm. Bombyx mori Biochem Biophys Res Commun 1995;214:271–8.

[44] Kamimura M, Nakahara Y, Kanamori Y, Tsuzuki S, Hayakawa Y, Kiuchi M. Molecular cloning of silkworm paralytic peptide and its developmental regulation. Biochem Biophys Res Commun 2001;286:67–73. [45] Xu Y, Kawasaki H. Isolation and expression of cathepsin B cDNA in hemocytes during metamorphosis of Bombyx mori. Comp Biochem Physiol B Biochem Mol Biol 2001;130:393–9. [46] Yamamoto Y, Takimoto K, Izumi S, Toriyama-Sakurai M, Kageyama T, Takahashi SY. Molecular cloning and sequencing of cDNA that encodes cysteine proteinase in the eggs of the silkmoth, Bombyx mori. J Biochem 1994;116: 1330–5. [47] Gui ZZ, Lee KS, Kim BY, Choi YS, Wei YD, Choo YM, et al. Functional role of aspartic proteinase cathepsin D in insect metamorphosis. BMC Dev Biol 2006;6:49. [48] Matsuoka T, Fujiwara H. Expression of ecdysteroid-regulated genes is reduced specifically in the wing discs of the wing-deficient mutant (fl) of Bombyx mori. Dev Genes Evol 2000;210:120–8. [49] Koumarianou P, Marcos AG, Ballesta JP, Kouyanou-Koutsoukou S. In vivo analysis of the acidic ribosomal proteins BmP1 and BmP2 of the silkworm Bombyx mori in the yeast Saccharomyces cerevisiae. Gene 2007;388:27–33.