- Email: [email protected]
Purification and characterization of the clostridium josui porphobilinogen deaminase encoded by the hemC gene from a recombinant escherichia coli
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 87, No. 4, 535-537. 1999
Purification and Characterization of the Clostridium josui Porphobilinogen Deaminase Encoded by the hemC Gene from a Recombinant Escherichia coli EM1 FUJINO,’
TSUCHIYOSHI
FUJIN0,2 SHUICHI KARITA,3 TETSUYA KIMURA,’ KAZUO SAKKA,’ AND KUNIO OHMIYA’* Faculty of Bioresour& and Center for Molecular Biology and Genetics,’ Me University, 1515 Kamihama-cho, Tsu, Me 514-8507 and Biodevelopment Division, Nagoya Seiraku Co. Ltd., 310 Nakasuna-cho, Tenpaku-ku, Nagoya, Aichi 468-8588,2 Japan Received 26 October 1998/Accepted 24 December 1998
The porphobilinogen deaminase encoded by the Clostridium joszd hemC gene was purified from a recombinant Escherichia coli strain and its properties were characterized. The optimal temperature and pH of the purified enzyme were 65°C and 7.0, respectively. This enzyme was quite thermostable: it retained 86% of the original activity after incubation at 70°C for 1 h. The K,,, and V,, values of the enzyme were 65 ,uM and 3.3 wol/h/mg for porphobilinogen, respectively. [Key words: Clostridium josui, hemC, porphobilinogen
deaminase, hydroxymethylbilane
synthase, porphy-
rin biosynthesis]
Porphobilinogen deaminase (PBGD; EC 4.3.1.8, also referred to as hydroxymethylbilane synthase) catalyzes the formation of the linear tetrapyrrole, l-hydroxymethylbilane, from four molecules of porphobilinogen (1, 2). 1-Hydroxymethylbilane is then transformed into uroporphyrinogen III, an important intermediate in the biosynthesis of all hemes, chlorophylls and vitamin B12, by uroporphyrinogen III synthase (3, 4). PBGDs have been isolated and characterized from several prokaryotic and eukaryotic sources such as Rhodopseudomonas spheroides (5), Escherichia coli (6, 7) and human erythrocytes (8). The her& gene encoding PBGD was first cloned from E. cofi by Thomas and Jordan (9) and the E. coli enzyme was characterized in detail. From these studies, a clear understanding of the catalytic mechanism emerged (10). Clostridium josui FERM P-9684 was isolated as a cellulolytic anaerobic bacterium from compost in Thailand (11) and several cellulases and their genes were analyzed (12, 13). We previously cloned and sequenced a DNA fragment containing a cluster of the hem genes responsible for porphyrin synthesis in C. josui (14). The cloned hem genes are arranged in the following order: hemA, hemC, hemD and incomplete hemB (Fig. 1A). The amino acid sequence of PBGD encoded by hemC of C. josui is homologous with those of other PBGDs. In this study, the C. josui PBGD encoded by hemC was expressed as a fusion protein with a six-His affinity tag in E. coli, purified, and characterized. The chimera plasmid pQhc was constructed as follows. The hemC gene was amplified by PCR from pOR1 (14) as a template with primers 1 and 2, and Taq DNA polymerase. Primer 1,5’-GCGGATCCGATGACGATGA -3’, includes an CAAAATGGTATTTGACATGAAAAA artificial BamHI sequence and encodes an enterokinase recognition sequence (DDDDK), and primer 2,5’-CTGGT ASTTAAATACTCTTGCTGCT-3’, contains an artificial KpnI site. The PCR product was digested with BamHI * Corresponding
and KpnI, and ligated between the BamHI and KpnI sites of pQE-30 (Qiagen, Hilden, Germany) to yield pQhc (Fig. 1B). The plasmid pQhc produces a HemC protein (PBGD) containing a six-His affinity tag and an enterokinase recognition sequence at its N-terminus. Recombinant E. coli strain JM109 harboring pQhc contained nearly 22 times as much PBGD activity as did the parental strain JM109 transformed with the vector pQE30. PBGD activity was determined by the method of Jordan et al. (7) with modifications, i.e., the volume of reaction mixture was 45 ~1 and Tris-HCI buffer was replaced by more appropriate buffers. Porphobilinogen was obtained from Sigma Chemical Co. (St. Louis, MO, USA). One unit of PBGD activity is defined as the amount of enzyme which catalyzed the utilization of 1 pmol of porphobilinogen in 1 h at 37°C. Protein concentrations were measured by the method of Bradford (15), using the Bio-Rad protein assay kit with bovine serum albumin as standard. A six-His tagged protein of HemC was purified as follows. E. coli JM109 harboring pQhc was aerobically grown at 37°C for 22 h in 1 I of Luria-Bertani broth containing ampicillin (100 pg/ml). Cells were harvested by centrifugation at 4000 x g for 20 min, resuspended in 14 ml of the sonication buffer (50mM NaHtP04, 300 mM NaCl, pH7.8), and then stored overnight at -2O’C. The frozen cells were thawed in cold water and incubated on ice for 30 min with lysozyme (1 mg/ml) prior to sonication. Cell debris was removed by centrifugation at 10,000 X g for 20 min. The cell-free extract was incubated at 60°C for 10min and rapidly cooled to O”C, followed by centrifugation at 10,OOOXg for 20min to allow heatdenatured proteins to precipitate. The supernatant solution was applied to an Ni-NTA (nitrilo-tri-acetic acid) resin column (1.5 ml; Qiagen) previously equilibrated with sonication buffer. The column was washed successively with sonication buffer and wash buffer (50mM NaH2P04, 300 mM NaCl, 10% glycerol, pH 6.0) until AZ80 of the eluate was reduced to 0.009. The enzyme was eluted with a stepwise gradient of 5 ml each of 0, 25, 50, 75, 100,
author.
535
536
J. BIOSCI. BIOENG.,
FUJINO ET AL.
kDa 64.0 + 67.0 + 43.0 -+ (BamHI)
4-
Hindill
pOR1
Purified enzyme
30.0 -b
20.1 + FIG. 2. Sodium dodecyl sulfate-polyacrylamide gel electrophoretogram of PBGD preparations. Lane 1, Molecular weight markers; lane 2, crude cell extracts of JM 1091pQhc; lane 3, purified PBGD. The molecular weight standards were phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa) and soybean trypsin inhibitor (20.1 kDa).
FIG. 1. Physical map of the hem locus in C. josui chromosomal DNA (A) and construction of plasmid pQhc (B).
125 mM of imidazole in wash buffer. Active fractions were collected and dialyzed against 100 mM Tris-HCl buffer (PH 8.2). Chromatography on the Ni-NTA column gave 6.0mg of the purified protein with a 51-fold purification and a 95% recovery and its specific activity was 1.68 units/mg protein at pH 8.2. The purified enzyme showed a single band with an apparent molecular weight of 38 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis performed according to the method of Laemmli (16) (Fig. 2). This molecular weight was consistent with that estimated from the deduced amino acid sequence (34,644). The Nterminal amino acid sequence of the fusion protein was determined by a PE Applied Biosystems model 476A protein sequencer (Foster, CA, USA). As a result, it was found that the recombinant HemC from pQhc contained 17 extra amino acid residues corresponding to a six-His tag and an enterokinase recognition sequence at the Nterminus of the intact HemC protein of C. josui. We attempted to digest the fusion protein with enterokinase to remove the six-His affinity tag, but unfortunately the protein was not susceptible to enterokinase despite the presence of the enterokinase recognition sequence. Therefore, the fusion form of HemC was used for characterization of PBGD activity. The maximum activity of the enzyme was observed at pH7.0 and at 65 to 75°C. The optimal pH (7.0) for PBGD activity, which was consistent with that for the growth of C. josui, was lower than those for PBGDs from other sources such as E. coli (8.4 to 9.0) (7), R. @zeroides (7.6 to 8.0) (5, 17), human erythrocytes (8.2) (8), Euglena gracilis (7.5) (18) and Chlorella regularis (7.4) (19). The optimal temperature for enzyme activity (65 to 75“C) was much higher than that for the growth
of C. josui (45°C). Like other PBGDs, the purified enzyme showed a high thermal stability. When the enzyme was incubated in the absence of substrate at 70°C for 1 h, it retained more than 86% of its initial activity. Previously, it has been shown that the dipyrromethane cofactor contributes significantly to folding and stability of the E. coli PBGD molecule (20). In E. coli PBGD this cofactor is covalently bound and is not itself turned over (21). Cys-242 of E. co/z’PBGD was identified as the binding site for the dipyrromethane cofactor (21) and this residue is conserved as Cys-237 in the C. josui PBGD (14) and all other PBGDs reported to date. The K,,, and V,, values for porphobilinogen were 65 PM and 3.3 pmol/h/mg, respectively, at pH 7.0 and 37°C. This Km value is similar to that of C. regularis PBGD (gf89 ,uM at pH 7.4) (19). However, it is lower than that of E. gracilis PBGD (195 PM at pH 8.0) (22) and higher than those for the enzymes from E. coli (16pM at pH 8.3 or 19t7 ,nM at pH 8.4 to 9) (6, 7), R. spheroides (13-20 PM at pH 7.6) (5) and human erythrocytes (6 pM at pH 8.0) (8). The V,, value of C. josui PBGD is lower than that of human erythrocytes PBGD (9.2 pmol/h/mg at pH 8.0, calculated from data which determine the amount of uroporphyrin produced in 1 h) (8). The effects of several chemical reagents on the PBGD activity of this enzyme are summarized in Table 1. One of the test reagents and the enzyme were sequentially added to the reaction mixture, and the reaction was allowed to proceed for 5 min at 37OC. Sulfhydryl reagents, p-chloromercuribenzoic acid and N-ethylmaleimide, inhibited the enzyme activity of C. josui PBGD as observed for the enzymes isolated from R. spheroides (5), human erythrocytes (8) and C. regularis (19), whereas iodoacetic acid did not inhibit the C. josui enzyme. This insensitivity to iodoacetic acid was also observed for R. spheroides PBGD (17). None of the reducing reagents tested affected the activity. The metal-chelating reagent EDTA had no effect on the enzyme activity as observed for R. spheroides (5) and C. regularis (19) PBGDs. CuS04 at a concentration of 1 mM, which inhibited human erythrocyte PBGD (8), did not affect PBGDs from C. josui or R. spheroides (5). Different sulfhydryl rea-
VOL. 87, 1999 TABLE
NOTES
1. Effects of chemical reagents on the PBG deaminase activity of the enzyme
Concentrationa (mM) . , None Cysteine HCI 1.0 Dithiothreitol 1.0 2-Mercaptoethanol 1.0 EDTA 1.0 Iodoacetic acid mono 10.0 N-Ethylmaleimide 5.0 pCHCC:loromercuribenzoic 2 acid 0.1 1.0 Reagent
cuso4 FeS04 MgClz
Relati;-Y&ivity 0 loo 104 100 99 100 106 66 816.3
10.0 1.0 10.0 1.0 10.0 1.0 10.0
19 100 48 9.5 17 86 31
a Final concentration in the enzyme-substrate mixture.
gents were observed to produce conflicting effects on the C. josui enzyme, i.e., p-chloromercuribenzoic acid and N-ethylmaleimide produced severe and slight inhibition, respectively, whereas iodoacetic acid showed no inhibitory effect. In conclusion, this paper is the first report characterizing PBGD from an anaerobic bacterium, although the protein in question contained a six-His tag. Since porphyrins are synthesized by the cooperative actions of many enzymes, characterization of the other hem gene products is necessary to understand the porphyrin biosynthesis system of C. josui. REFERENCES 1. Burton, G., Fagemess, P. E., Hosozawa, S., Jordan, P.M., and Scott, A. I.: r3C-Nmr evidence for a new intermediate preuroporphyrinogen in the enzymic transformation of porphobilinogen into uroporphyrinogens. J. Chem. Sot. Chem. Commun., 202-204 (1979). 2. Battersby, A. R., Fookes, C. J. R., Gustafssoo-Pottier, K. E., Matcbam, G. W. J., and McDonald, E.: Proof by synthesis that unrearranged hydroxymethylbilane is the product from deaminase and the substrate for cosynthase in the biosynthesis of UROGEN III. J. Chem. Sot. Chem. Commun., 1155-1158 (1979). 3. Jordan, P.M., Burton, G., Nordlov, H., Schneider, M. M., Pryde, L. M., and Scott, A. I.: Preuroporphyrinogen, a substrate for uroporphyrinogen III cosynthetase. J. Chem. Sot. Chem. Commun., 204-205 (1979). 4. Jordan, P.M. and Berry, A.: Preuroporphyrinogen, a universal intermediate in the biosynthesis of uroporphyrinogen III. FEBS Lett., 112, 86-88 (1980). 5. Jordan, P.M. and Shemin, D.: Purification and properties of uroporphyrinogen I synthetase from Rhodopseudomonas suheroides. J. Biol. Chem.. 248. 1019-1024 (1973). 6. Hart, G. J., Abell, C., and Battersby, A. B.: Purification, Nterminal amino acid sequence and properties of hydroxymethylbilane synthase (porphobilinogen deaminase) from Escherichia
537
coli. Biochem. J., 240, 273-276 (1986). 7. Jordan, P. M., Thomas, S. D., and Warren, M. 1.: Purification, crystallization and properties of porphobilinogen deaminase from a recombinant strain of Escherichia coli K12. Biochem. J., 254, 427-435 (1988). 8. Anderson, P.M. and Desnick, R. J.: Purification and properties of uroporphyrinogen I synthase from human erythrocytes. J. Biol. Chem., 255, 1993-1999 (1980). 9. Thomas, S. D. and Jordan, P. M.: Nucleotide sequence of the hew2 locus encoding porphobilinogen deaminase of Escherichia coli K12. Nucl. Acids Res., 14, 6215-6226 (1986). 10. Sboolingin-Jordan, P. M.: Porphobilinogen deaminase and uroporphyrinogen III synthase: structure, molecular biology, and mechanism. J. Bioenerg. Biomembr., 27, 181-195 (1995). 11. Sukhumavasi, J., Ohmiya, K., Shimizu, S., and Ueno, K.: Cfostridium josui sp. nov., a cellulolytic, moderate thermophilic species from Thai compost. Int. J. Syst. Bacterial., 38, 179182 (1988). 12. Fujino, T., Sukhumavasi, J., Sasaki, T., Ohmiya, K., and Shimizu, S.: Purification and properties of an endo-1,4-,9glucanase from Clostridium josui. J. Bacterial., 171, 4076 4079 (1989). 13. Fujino, T., Sasaki, T., Ohmiya, K., and Shimizu, S.: Purification and properties of an endo-1,4+glucanase translated from a Clostridium josui gene in Escherichia cob. Appl. Environ. Microbial., 56, 1175-1178 (1990). 14. Fujino, E., Fujino, T., Karita, S., Sakka, K., and Ohmiya, K.: Cloning and sequencing of some genes responsible for porphyrin biosynthesis from the anaerobic bacterium Clostridium josui. J. Bacterial., 177, 5169-5175 (1995). 15. Bradford, M. M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem., 72, 248-254 (1976). 16. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London), 227, 680-685 (1970). 17. Davies, R. C. and Neuberger, A.: Polypyrroles formed from porphobilinogen and amines by uroporphyrinogen synthetase of Rhodopseudomonas spheroides. Biochem. J., 133, 471-492 (1973). 18. Williams, D. C., Morgan, G. S., McDonald, E., and Battersby, A. R.: Purification of porphobilinogen deaminase from Euglena gracilis and studies of its kinetics. Biochem. J., 193, 301-310 (1981). 19. Shioi, Y., Nagamine, M., Kuroki, M., and Sasa, T.: Purification by aflinity chromatography and properties of uroporphyrinogen I synthetase from Chlorella regularis. Biochim. Biophys. Acta, 616, 300-309 (1980). 20. Scott, A. I., Clemens, K. R., Stolowich, N. J., Santander, P. J., Gonzalez, M. D., and Roessner, C. A.: Reconstitution of apoporphobilinogen deaminase: structural changes induced by cofactor binding. FEBS Lett., 242, 319-324 (1989). 21 Jordan, P.M., Warren, M. J., Williams, H. J., Stolowich, N. J., Roessner, C. A., Grant, S. K., and Scott, A. I.: Identification of a cysteine residue as the binding site for the dipyrromethane cofactor at the active site of Escherichia coli porphobihnogen deaminase. FEBS Lett., 235, 189-193 (1988). 22. Battersby, A. R., Fookes, C. J. R., Hart, G., Matcham, G. W. J., and Pandey, P.S.: Biosynthesis of porphyrins and related macrocycles. XXI. The interaction of deaminase and its product (hydroxymethylbilane) and the relationship between deaminase and cosynthetase. J. Chem. Sot. Perkin Trans., 1, 3041-3047 (1983).
Purification and Characterization of the Clostridium josui Porphobilinogen Deaminase Encoded by the hemC Gene from a Recombinant Escherichia coli EM1 FUJINO,’
TSUCHIYOSHI
FUJIN0,2 SHUICHI KARITA,3 TETSUYA KIMURA,’ KAZUO SAKKA,’ AND KUNIO OHMIYA’* Faculty of Bioresour& and Center for Molecular Biology and Genetics,’ Me University, 1515 Kamihama-cho, Tsu, Me 514-8507 and Biodevelopment Division, Nagoya Seiraku Co. Ltd., 310 Nakasuna-cho, Tenpaku-ku, Nagoya, Aichi 468-8588,2 Japan Received 26 October 1998/Accepted 24 December 1998
The porphobilinogen deaminase encoded by the Clostridium joszd hemC gene was purified from a recombinant Escherichia coli strain and its properties were characterized. The optimal temperature and pH of the purified enzyme were 65°C and 7.0, respectively. This enzyme was quite thermostable: it retained 86% of the original activity after incubation at 70°C for 1 h. The K,,, and V,, values of the enzyme were 65 ,uM and 3.3 wol/h/mg for porphobilinogen, respectively. [Key words: Clostridium josui, hemC, porphobilinogen
deaminase, hydroxymethylbilane
synthase, porphy-
rin biosynthesis]
Porphobilinogen deaminase (PBGD; EC 4.3.1.8, also referred to as hydroxymethylbilane synthase) catalyzes the formation of the linear tetrapyrrole, l-hydroxymethylbilane, from four molecules of porphobilinogen (1, 2). 1-Hydroxymethylbilane is then transformed into uroporphyrinogen III, an important intermediate in the biosynthesis of all hemes, chlorophylls and vitamin B12, by uroporphyrinogen III synthase (3, 4). PBGDs have been isolated and characterized from several prokaryotic and eukaryotic sources such as Rhodopseudomonas spheroides (5), Escherichia coli (6, 7) and human erythrocytes (8). The her& gene encoding PBGD was first cloned from E. cofi by Thomas and Jordan (9) and the E. coli enzyme was characterized in detail. From these studies, a clear understanding of the catalytic mechanism emerged (10). Clostridium josui FERM P-9684 was isolated as a cellulolytic anaerobic bacterium from compost in Thailand (11) and several cellulases and their genes were analyzed (12, 13). We previously cloned and sequenced a DNA fragment containing a cluster of the hem genes responsible for porphyrin synthesis in C. josui (14). The cloned hem genes are arranged in the following order: hemA, hemC, hemD and incomplete hemB (Fig. 1A). The amino acid sequence of PBGD encoded by hemC of C. josui is homologous with those of other PBGDs. In this study, the C. josui PBGD encoded by hemC was expressed as a fusion protein with a six-His affinity tag in E. coli, purified, and characterized. The chimera plasmid pQhc was constructed as follows. The hemC gene was amplified by PCR from pOR1 (14) as a template with primers 1 and 2, and Taq DNA polymerase. Primer 1,5’-GCGGATCCGATGACGATGA -3’, includes an CAAAATGGTATTTGACATGAAAAA artificial BamHI sequence and encodes an enterokinase recognition sequence (DDDDK), and primer 2,5’-CTGGT ASTTAAATACTCTTGCTGCT-3’, contains an artificial KpnI site. The PCR product was digested with BamHI * Corresponding
and KpnI, and ligated between the BamHI and KpnI sites of pQE-30 (Qiagen, Hilden, Germany) to yield pQhc (Fig. 1B). The plasmid pQhc produces a HemC protein (PBGD) containing a six-His affinity tag and an enterokinase recognition sequence at its N-terminus. Recombinant E. coli strain JM109 harboring pQhc contained nearly 22 times as much PBGD activity as did the parental strain JM109 transformed with the vector pQE30. PBGD activity was determined by the method of Jordan et al. (7) with modifications, i.e., the volume of reaction mixture was 45 ~1 and Tris-HCI buffer was replaced by more appropriate buffers. Porphobilinogen was obtained from Sigma Chemical Co. (St. Louis, MO, USA). One unit of PBGD activity is defined as the amount of enzyme which catalyzed the utilization of 1 pmol of porphobilinogen in 1 h at 37°C. Protein concentrations were measured by the method of Bradford (15), using the Bio-Rad protein assay kit with bovine serum albumin as standard. A six-His tagged protein of HemC was purified as follows. E. coli JM109 harboring pQhc was aerobically grown at 37°C for 22 h in 1 I of Luria-Bertani broth containing ampicillin (100 pg/ml). Cells were harvested by centrifugation at 4000 x g for 20 min, resuspended in 14 ml of the sonication buffer (50mM NaHtP04, 300 mM NaCl, pH7.8), and then stored overnight at -2O’C. The frozen cells were thawed in cold water and incubated on ice for 30 min with lysozyme (1 mg/ml) prior to sonication. Cell debris was removed by centrifugation at 10,000 X g for 20 min. The cell-free extract was incubated at 60°C for 10min and rapidly cooled to O”C, followed by centrifugation at 10,OOOXg for 20min to allow heatdenatured proteins to precipitate. The supernatant solution was applied to an Ni-NTA (nitrilo-tri-acetic acid) resin column (1.5 ml; Qiagen) previously equilibrated with sonication buffer. The column was washed successively with sonication buffer and wash buffer (50mM NaH2P04, 300 mM NaCl, 10% glycerol, pH 6.0) until AZ80 of the eluate was reduced to 0.009. The enzyme was eluted with a stepwise gradient of 5 ml each of 0, 25, 50, 75, 100,
author.
535
536
J. BIOSCI. BIOENG.,
FUJINO ET AL.
kDa 64.0 + 67.0 + 43.0 -+ (BamHI)
4-
Hindill
pOR1
Purified enzyme
30.0 -b
20.1 + FIG. 2. Sodium dodecyl sulfate-polyacrylamide gel electrophoretogram of PBGD preparations. Lane 1, Molecular weight markers; lane 2, crude cell extracts of JM 1091pQhc; lane 3, purified PBGD. The molecular weight standards were phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa) and soybean trypsin inhibitor (20.1 kDa).
FIG. 1. Physical map of the hem locus in C. josui chromosomal DNA (A) and construction of plasmid pQhc (B).
125 mM of imidazole in wash buffer. Active fractions were collected and dialyzed against 100 mM Tris-HCl buffer (PH 8.2). Chromatography on the Ni-NTA column gave 6.0mg of the purified protein with a 51-fold purification and a 95% recovery and its specific activity was 1.68 units/mg protein at pH 8.2. The purified enzyme showed a single band with an apparent molecular weight of 38 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis performed according to the method of Laemmli (16) (Fig. 2). This molecular weight was consistent with that estimated from the deduced amino acid sequence (34,644). The Nterminal amino acid sequence of the fusion protein was determined by a PE Applied Biosystems model 476A protein sequencer (Foster, CA, USA). As a result, it was found that the recombinant HemC from pQhc contained 17 extra amino acid residues corresponding to a six-His tag and an enterokinase recognition sequence at the Nterminus of the intact HemC protein of C. josui. We attempted to digest the fusion protein with enterokinase to remove the six-His affinity tag, but unfortunately the protein was not susceptible to enterokinase despite the presence of the enterokinase recognition sequence. Therefore, the fusion form of HemC was used for characterization of PBGD activity. The maximum activity of the enzyme was observed at pH7.0 and at 65 to 75°C. The optimal pH (7.0) for PBGD activity, which was consistent with that for the growth of C. josui, was lower than those for PBGDs from other sources such as E. coli (8.4 to 9.0) (7), R. @zeroides (7.6 to 8.0) (5, 17), human erythrocytes (8.2) (8), Euglena gracilis (7.5) (18) and Chlorella regularis (7.4) (19). The optimal temperature for enzyme activity (65 to 75“C) was much higher than that for the growth
of C. josui (45°C). Like other PBGDs, the purified enzyme showed a high thermal stability. When the enzyme was incubated in the absence of substrate at 70°C for 1 h, it retained more than 86% of its initial activity. Previously, it has been shown that the dipyrromethane cofactor contributes significantly to folding and stability of the E. coli PBGD molecule (20). In E. coli PBGD this cofactor is covalently bound and is not itself turned over (21). Cys-242 of E. co/z’PBGD was identified as the binding site for the dipyrromethane cofactor (21) and this residue is conserved as Cys-237 in the C. josui PBGD (14) and all other PBGDs reported to date. The K,,, and V,, values for porphobilinogen were 65 PM and 3.3 pmol/h/mg, respectively, at pH 7.0 and 37°C. This Km value is similar to that of C. regularis PBGD (gf89 ,uM at pH 7.4) (19). However, it is lower than that of E. gracilis PBGD (195 PM at pH 8.0) (22) and higher than those for the enzymes from E. coli (16pM at pH 8.3 or 19t7 ,nM at pH 8.4 to 9) (6, 7), R. spheroides (13-20 PM at pH 7.6) (5) and human erythrocytes (6 pM at pH 8.0) (8). The V,, value of C. josui PBGD is lower than that of human erythrocytes PBGD (9.2 pmol/h/mg at pH 8.0, calculated from data which determine the amount of uroporphyrin produced in 1 h) (8). The effects of several chemical reagents on the PBGD activity of this enzyme are summarized in Table 1. One of the test reagents and the enzyme were sequentially added to the reaction mixture, and the reaction was allowed to proceed for 5 min at 37OC. Sulfhydryl reagents, p-chloromercuribenzoic acid and N-ethylmaleimide, inhibited the enzyme activity of C. josui PBGD as observed for the enzymes isolated from R. spheroides (5), human erythrocytes (8) and C. regularis (19), whereas iodoacetic acid did not inhibit the C. josui enzyme. This insensitivity to iodoacetic acid was also observed for R. spheroides PBGD (17). None of the reducing reagents tested affected the activity. The metal-chelating reagent EDTA had no effect on the enzyme activity as observed for R. spheroides (5) and C. regularis (19) PBGDs. CuS04 at a concentration of 1 mM, which inhibited human erythrocyte PBGD (8), did not affect PBGDs from C. josui or R. spheroides (5). Different sulfhydryl rea-
VOL. 87, 1999 TABLE
NOTES
1. Effects of chemical reagents on the PBG deaminase activity of the enzyme
Concentrationa (mM) . , None Cysteine HCI 1.0 Dithiothreitol 1.0 2-Mercaptoethanol 1.0 EDTA 1.0 Iodoacetic acid mono 10.0 N-Ethylmaleimide 5.0 pCHCC:loromercuribenzoic 2 acid 0.1 1.0 Reagent
cuso4 FeS04 MgClz
Relati;-Y&ivity 0 loo 104 100 99 100 106 66 816.3
10.0 1.0 10.0 1.0 10.0 1.0 10.0
19 100 48 9.5 17 86 31
a Final concentration in the enzyme-substrate mixture.
gents were observed to produce conflicting effects on the C. josui enzyme, i.e., p-chloromercuribenzoic acid and N-ethylmaleimide produced severe and slight inhibition, respectively, whereas iodoacetic acid showed no inhibitory effect. In conclusion, this paper is the first report characterizing PBGD from an anaerobic bacterium, although the protein in question contained a six-His tag. Since porphyrins are synthesized by the cooperative actions of many enzymes, characterization of the other hem gene products is necessary to understand the porphyrin biosynthesis system of C. josui. REFERENCES 1. Burton, G., Fagemess, P. E., Hosozawa, S., Jordan, P.M., and Scott, A. I.: r3C-Nmr evidence for a new intermediate preuroporphyrinogen in the enzymic transformation of porphobilinogen into uroporphyrinogens. J. Chem. Sot. Chem. Commun., 202-204 (1979). 2. Battersby, A. R., Fookes, C. J. R., Gustafssoo-Pottier, K. E., Matcbam, G. W. J., and McDonald, E.: Proof by synthesis that unrearranged hydroxymethylbilane is the product from deaminase and the substrate for cosynthase in the biosynthesis of UROGEN III. J. Chem. Sot. Chem. Commun., 1155-1158 (1979). 3. Jordan, P.M., Burton, G., Nordlov, H., Schneider, M. M., Pryde, L. M., and Scott, A. I.: Preuroporphyrinogen, a substrate for uroporphyrinogen III cosynthetase. J. Chem. Sot. Chem. Commun., 204-205 (1979). 4. Jordan, P.M. and Berry, A.: Preuroporphyrinogen, a universal intermediate in the biosynthesis of uroporphyrinogen III. FEBS Lett., 112, 86-88 (1980). 5. Jordan, P.M. and Shemin, D.: Purification and properties of uroporphyrinogen I synthetase from Rhodopseudomonas suheroides. J. Biol. Chem.. 248. 1019-1024 (1973). 6. Hart, G. J., Abell, C., and Battersby, A. B.: Purification, Nterminal amino acid sequence and properties of hydroxymethylbilane synthase (porphobilinogen deaminase) from Escherichia
537
coli. Biochem. J., 240, 273-276 (1986). 7. Jordan, P. M., Thomas, S. D., and Warren, M. 1.: Purification, crystallization and properties of porphobilinogen deaminase from a recombinant strain of Escherichia coli K12. Biochem. J., 254, 427-435 (1988). 8. Anderson, P.M. and Desnick, R. J.: Purification and properties of uroporphyrinogen I synthase from human erythrocytes. J. Biol. Chem., 255, 1993-1999 (1980). 9. Thomas, S. D. and Jordan, P. M.: Nucleotide sequence of the hew2 locus encoding porphobilinogen deaminase of Escherichia coli K12. Nucl. Acids Res., 14, 6215-6226 (1986). 10. Sboolingin-Jordan, P. M.: Porphobilinogen deaminase and uroporphyrinogen III synthase: structure, molecular biology, and mechanism. J. Bioenerg. Biomembr., 27, 181-195 (1995). 11. Sukhumavasi, J., Ohmiya, K., Shimizu, S., and Ueno, K.: Cfostridium josui sp. nov., a cellulolytic, moderate thermophilic species from Thai compost. Int. J. Syst. Bacterial., 38, 179182 (1988). 12. Fujino, T., Sukhumavasi, J., Sasaki, T., Ohmiya, K., and Shimizu, S.: Purification and properties of an endo-1,4-,9glucanase from Clostridium josui. J. Bacterial., 171, 4076 4079 (1989). 13. Fujino, T., Sasaki, T., Ohmiya, K., and Shimizu, S.: Purification and properties of an endo-1,4+glucanase translated from a Clostridium josui gene in Escherichia cob. Appl. Environ. Microbial., 56, 1175-1178 (1990). 14. Fujino, E., Fujino, T., Karita, S., Sakka, K., and Ohmiya, K.: Cloning and sequencing of some genes responsible for porphyrin biosynthesis from the anaerobic bacterium Clostridium josui. J. Bacterial., 177, 5169-5175 (1995). 15. Bradford, M. M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem., 72, 248-254 (1976). 16. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London), 227, 680-685 (1970). 17. Davies, R. C. and Neuberger, A.: Polypyrroles formed from porphobilinogen and amines by uroporphyrinogen synthetase of Rhodopseudomonas spheroides. Biochem. J., 133, 471-492 (1973). 18. Williams, D. C., Morgan, G. S., McDonald, E., and Battersby, A. R.: Purification of porphobilinogen deaminase from Euglena gracilis and studies of its kinetics. Biochem. J., 193, 301-310 (1981). 19. Shioi, Y., Nagamine, M., Kuroki, M., and Sasa, T.: Purification by aflinity chromatography and properties of uroporphyrinogen I synthetase from Chlorella regularis. Biochim. Biophys. Acta, 616, 300-309 (1980). 20. Scott, A. I., Clemens, K. R., Stolowich, N. J., Santander, P. J., Gonzalez, M. D., and Roessner, C. A.: Reconstitution of apoporphobilinogen deaminase: structural changes induced by cofactor binding. FEBS Lett., 242, 319-324 (1989). 21 Jordan, P.M., Warren, M. J., Williams, H. J., Stolowich, N. J., Roessner, C. A., Grant, S. K., and Scott, A. I.: Identification of a cysteine residue as the binding site for the dipyrromethane cofactor at the active site of Escherichia coli porphobihnogen deaminase. FEBS Lett., 235, 189-193 (1988). 22. Battersby, A. R., Fookes, C. J. R., Hart, G., Matcham, G. W. J., and Pandey, P.S.: Biosynthesis of porphyrins and related macrocycles. XXI. The interaction of deaminase and its product (hydroxymethylbilane) and the relationship between deaminase and cosynthetase. J. Chem. Sot. Perkin Trans., 1, 3041-3047 (1983).