Purification, cDNA structure and biological significance of a single insulin-like growth factor-binding domain protein (SIBD-1) identified in the hemocytes of the spider Cupiennius salei

Insect Biochemistry and Molecular Biology 41 (2011) 891e901

Contents lists available at SciVerse ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Purification, cDNA structure and biological significance of a single insulin-like growth factor-binding domain protein (SIBD-1) identified in the hemocytes of the spider Cupiennius salei Lucia Kuhn-Nentwiga, *, Carlo R. Largiadèrb, Kathrin Streitbergera, Sathyan Chandrua, Tommy Baumanna, Urs Kämpferc, Johann Schallerc, Stefan Schürchc, Wolfgang Nentwiga a b c

Institute of Ecology and Evolution, University of Bern, Baltzerstrasse 6, CH-3012 Bern, Switzerland Institute of Clinical Chemistry, Bern University Hospital, University of Bern, INO F, CH-3010 Bern, Switzerland Department of Chemistry and Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern, Switzerland

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 May 2011 Received in revised form 16 August 2011 Accepted 18 August 2011

Cupiennius salei single insulin-like growth factor-binding domain protein (SIBD-1), which exhibits an IGFBP N-terminal domain-like profile, was identified in the hemocytes of the spider C. salei. SIBD-1 was purified by RP-HPLC and the sequence determined by a combination of Edman degradation and 50 e30 RACE PCR. The peptide (8676.08 Da) is composed of 78 amino acids, contains six intrachain disulphide bridges and carries a modified Thr residue at position 2. SIBD-1 mRNA expression was detected by quantitative real-time PCR mainly in hemocytes, but also in the subesophageal nerve mass and muscle. After infection, the SIBD-1 content in the hemocytes decreases and, simultaneously, the temporal SIBD-1 expression seems to be down-regulated. Two further peptides, SIBD-2 and IGFBP-rP1, also exhibiting IGFBP N-terminal domain variants with unknown functions, were identified on cDNA level in spider hemocytes and venom glands. We conclude that SIBD-1 may play an important role in the immune system of spiders. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Cupiennius salei SIBD-1 SIBD-2 IGFBP-rP1 Tissue expression Insulin-like growth factor-binding protein (IGFBP) N-Terminal domain

1. Introduction Besides relying on physical barriers and their exoskeleton, spiders depend, as do other arthropods, on their innate immune system to control or eliminate microbial invaders by humoral and cellular responses. Cellular mechanisms are characterized by phagocytosis, nodulation and, encapsulation, while humoral mechanisms are mediated by cytotoxicity, antimicrobial peptides, hemolymph coagulation and melanization of microbials (Jiravanichpaisal et al., 2006,

Abbreviations: SIBD-1, single insulin-like growth factor-binding domain protein 1 from Cupiennius salei; SIBD-2, single insulin-like growth factor-binding domain protein 2 from Cupiennius salei; IGFBP-rP1, insulin-like growth factor-binding protein-related protein 1 from Cupiennius sale; GH, growth hormone; GlcNAc, N-acetylglucosamine; IGF, insulin-like growth factor; IGFBP, insulin-like growth factor-binding protein; RT-PCR, real-time polymerase chain reaction; RTq-PCR, quantitative real-time polymerase chain reaction; RACE PCR, Rapid amplification of cDNA ends with PCR; RP-HPLC, reverse phase HPLC; PTM, posttranslational modification; THC, total hemocyte count. * Corresponding author. Tel.: þ41 31 631 4532; fax: þ41 31 631 4888. E-mail address: [email protected] (L. Kuhn-Nentwig). 0965-1748/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2011.08.003

2010). A leading role in this defense system is played largely by circulating hemocytes, which are produced as prohemocytes in a special inner layer of the heart wall of spiders (Seitz, 1972a). In Cupiennius salei, hemocytes are not only used in fighting invaders and healing wounds but also in molting and yolk integration of oocytes (Baumann et al., 2010a, 2010b; Seitz, 1971, 1972b, 1976). Apart from the identification of antimicrobially acting peptides isolated from hemocytes of the mygalomorph spider Acanthoscurria gomesiana (Lorenzini et al., 2003; Silva et al., 2000), only limited information concerning the innate immune system of spiders is available (Fukuzawa et al., 2008). Our investigations into the immune system of non-infected araneomorph spiders (C. salei, Ctenidae) resulted in the identification of two families of antimicrobial peptides constitutively stored in hemocytes. The first family of these peptides is composed of Gly-rich ctenidins 1e3, which seem to be expressed mainly in hemocytes (Baumann et al., 2010a). From the second family, a defensin was identified on cDNA level, which is expressed in hemocytes, ovaries, subesophageal nerve mass, hepatopancreas, and muscle (Baumann et al., 2010b). RP-HPLC analysis of hemocytes exhibits a reduced content of ctenidins after an infection

892

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

on the peptide level. Furthermore, a peptide which we have named SIBD-1, single insulin-like growth factor-binding domain protein 1, shows the same post-infection reduction as the ctenidins. What is particularly noteworthy is the identification of an IGFBP N-terminal domain-like motif in SIBD-1 and its high cysteine content. Insulin-like growth factor-binding proteins (IGFBPs) were first identified as components of the growth hormone/insulin-like growth factor (GH/IGF) axis of vertebrates, regulating their metabolism and growth. These pleiotropically secreted proteins bind insulin-like growth factors (IGF-I and IGF-II), thereby acting as their transporter, protecting them against degradation, and functioning as their reservoir (Hwa et al., 1999). In vertebrates, the IGFBP superfamily is represented by IGFBP-1 to IGFBP-6, which control anabolic and mitogenic functions of the IGF peptide hormones, binding IGFs with high affinity. Furthermore, IGFBP-related proteins 1e10 bind IGFs with low affinity and share high N-terminal sequence similarities with IGFBP1e6 (Hwa et al., 1999; Lopez-Bermejo et al., 2003). IGFBPs of vertebrates are characterized by an N-terminal Cys-rich domain, which is connected by a spacer region to the C-terminal Cys-rich domain (Vilmos et al., 2001). The N-terminal IGF binding domain is highly conserved by the presence of six intramolecular disulphide bridges as well as the C-terminal domain with two to three disulphide bridges, and both regions are involved in binding IGF (Schneider et al., 2002). The sequence similarity between the IGFBPs and IGFBP-rPs is restricted to the N-terminal Cys-rich domain (CDR) (Collet and Candy, 1998), which is described as the IGFBP N-terminal domain (Hwa et al., 1999). The biological functions of the IGFBP-rPs are multifarious, being involved in reproduction, development and differentiation, as well as in inflammation, wound repair, and tumorigenesis. Furthermore, they control such different cellular functions as cell growth, cell migration, and cell adhesion (Hwa et al., 1999). Remarkably, IGFBP-rP1, also known as IGFBP-7/MAC25 (Murphy et al., 1993; Oh et al., 1996), mediates IGFs’ independent biological functions in tumor growth suppression, proliferation of glioma cells, and induction of apoptosis (Heesch et al., 2011, 2010). Recently, additional members of the evolutionarily conserved Cys-rich IGFBP/IGFPB-rP superfamily have not only been reported for vertebrates but also for various arthropods such as ticks (Mulenga and Khumthong, 2010), shrimps (Castellanos et al., 2008), crabs (Gai et al., 2010), crayfish (Lin et al., 2011), and insects (Alic and Partridge, 2008; Andersen et al., 2000; Honegger et al., 2008). With perlustrin, a first homolog protein to the vertebrate IGFBP family, an N-terminal module was isolated from the shell of the abalone Haliotis laevigata, exhibiting binding of human IGF-I, IGF-II, and bovine insulin (Weiss et al., 2001, 2000). In addition, a single insulinlike binding domain protein (SIBD) was identified in a hemocyte cDNA library of the shrimp Litopenaeus vannamei (Castellanos et al., 2008). It was assumed that the protein is likely a member of the IGFBP superfamily that is involved in the shrimp immune response after bacterial challenge (Castellanos et al., 2008). Interestingly, a further putative SIBD, associated with the endocrine and immune system, is reported for the Chinese mitten crab Eriocheir sinensis on mRNA level (Gai et al., 2010). In Chelicerata, three tick IGFBP-rP sequences on the mRNA level are expressed in multiple tick organs, which seem to be responsive to tick feeding activity as shown by RNAi silencing of the three genes (Mulenga and Khumthong, 2010). Very recently, an antimicrobial peptide (AMP-IBP5) arising from secreted human IGFPB-5 (human pancreatic neuroendocrine tumor cell line QGP-1) has been reported (Osaki et al., 2011), as well as a crustacean astakine-dependent novel hematopoietic factor (CHF). Comparable to SIBD-1, CHF is cysteinerich and also exhibits an IGFBP N-terminal domain variant. CHF is involved in hematopoiesis in the freshwater crayfish Pacifastacus leniusculus and prevents apoptosis of hematopoietic tissue cells and hemocytes (Lin et al., 2011).

Here, we report the RP-HPLC purification of SIBD-1 from the hemocytes of C. salei and the determination of its cDNA structure. By investigations on the peptide level and by quantitative real-time PRC (RTq-PCR), we explored its possible role in the immune response after sterile or septic injury. Screening our recently compiled cDNA libraries of hemocytes and venom glands, we additionally identified a further SIBD-2 and, in the venom glands of C. salei, IGFBP-rP1. Their structures and possible physiological roles are discussed. 2. Material and methods 2.1. Spider breeding, peptide purification and bioanalytical characterization Spider breeding and hemocyte isolation were carried out as previously reported (Baumann et al., 2010a). Hemocytes were resuspended in double distilled water (ddH2O) containing 0.1% trifluoroacetic acid (TFA) and homogenized by ultrasonication (Sonoplus, Bandelin, Switzerland) twice for 1 min at 30% power, pulse level 5, on ice. Lysed hemocytes were centrifuged at 20,800 g, 4  C for 30 min to remove cell debris. In a first step, all supernatants were combined and aliquots were separated by reversed-phase HPLC (RP-HPLC) on an AtlantisÒ Prep T3 column (10  100 mm, 5 mm; Waters, USA). Equilibration was done with ddH2O, 0.1% TFA and peptides were eluted at a flow rate of 2 ml/min, first under isocratic conditions of 0% acetonitrile (ACN), 0.1% TFA for 10 min, followed by a stepwise gradient of 0e21% ACN, 0.1% TFA for 2 min and of 21e35% ACN, 0.1% TFA for 15 min. Final purification was performed on a NUCLEOSIL 100-5 C18 Nautilus column (4  250 mm, Macherey & Nagel, Switzerland). The column was equilibrated with 20% ACN, 0.1% TFA and peptides were eluted at a flow rate of 0.5 ml/min, starting under isocratic conditions of 20% ACN, 0.1% TFA for 10 min, followed by a gradient of 20e40% for 40 min. RP-HPLC separation was carried out at room temperature first on an Aekta purifier HPLC system (Pharmacia, Sweden) with a fraction sampler, and further on a Jasco HPLC System (Jasco, Japan) and hand collected. Amino acid analysis and amino acid sequence analysis were done as described previously (Baumann et al., 2010a). For N-terminal sequence analysis 30 mg of SIBD-1 was dissolved in 100 ml of 0.1 mM tris buffer, pH 8, 6 M guanidine hydrochloride. Reduction of cystines occurred by addition of 3 ml of DTT (100 mM) at 37  C for 90 min under N2 atmosphere and alkylation was performed with iodacetamide. For further sequence analysis, 10 mg R/A peptide was digested with Asp-N (Boehringer Ingelheim sequencing grade, Germany) at a ratio of 1:100 in 0.1 M ammonium bicarbonate buffer, pH 8 at 37  C for 1 h. The digested fragments obtained were separated by RP-HPLC on a NUCLEOSIL 120-5 C18 column (Macherey & Nagel), lyophilized and sequenced (Supplementary material 1) (Baumann et al., 2010a). Electrospray-ionizationemass spectrometric (ESIeMS) analyses were performed on a SCIEX Q-STARÔ mass spectrometer (Applied Biosystem) equipped with a nanoelectrospray ion source, resulting in monoisotopic masses. Samples were dissolved in ACN/ddH2O (1:1, vol/vol) containing 1% formic acid. All analyses were carried out in the positive ion mode. 2.2. cDNA cloning and sequencing of SIBD-1 (30 - and 50 -RACE PCR) Total RNA was isolated from hemocytes using the Absolutely RNAÒ Miniprep Kit (Stratagene, Switzerland) following the instructions of the manufacturer. 30 - and 50 -RACE ready cDNAs were synthesized from 1 mg of the isolated total RNA using the BD SMARTÔ RACE cDNA amplification kit (BD, Biosciences Clontech, Switzerland). Based on the N-terminal 31 residue sequence determined by Edman degradation,

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

a gene specific degenerated primer was designed for 30 -RACE: 50 GAYGCYTGTGAYTGCTGYCCHGTBG-30 . PCR was performed for 5 min at 94  C, followed by 5 cycles of 94  C for 30 s, 68  C for 30 s, 72  C for 2 min, 5 cycles of 94  C for 30 s, 65  C for 30 s, 72  C for 2 min, 5 cycles of 94  C for 30 s, 63  C for 30 s, 72  C for 2 min, 5 cycles for 94  C for 30 s, 61  C for 30 s, 72  C for 2 min, 5 cycles for 94  C for 30 s, 60  C for 30 s, 72  C for 2 min, and 10 cycles for 94  C for 30 s, 59  C for 30 s, 72  C for 2 min, and a final elongation at 72  C for 7 min. Taking the sequence results from the 30 -RACE into account, a 50 - gene specific primer was designed, namely: 50 -CTAATGGAACGCAGGCAAAACCATCGGCAC-30 and PCR was performed as described above. PCR products were run on 1.5% agarose gel containing 0.5 mg ethidium bromide/ml. Single bands were cut out using a scalpel, and DNA was extracted from the gel using a MinEluteÒ gel extraction kit (Qiagen). The DNA obtained was cloned into a pDrive cloning vector (PCR Cloning Kit, Qiagen) and transformed into EZ competent cells (Qiagen). The products in the pDrive vector were sequenced using the Big DyeÒ Terminator v3.1 cycle sequencing kit; sequences were separated on an AB13130XL automated sequencer using POP7 polymer on a 50 cm array and acquired using sequence detection software v.3.0 (all from Applied Biosystems). Sequences were analyzed with BioEdit v7.0.8 software. 2.3. cDNA library of venom glands and hemocytes of C. salei Venom glands and hemocytes from 5  4 adult female spiders were prepared after milking at different time intervals (24 h, 48 h, 62 h, 8 d and 14 d), stored in RNAlater (Qiagen) and sent on dry ice to SKULDTECH (Montpellier, France) to commercially generate the two cDNA libraries by 454 sequencing. SIBD-2 was identified in the hemocyte cDNA library (520,000 ESTs) using the SKULDTECH generated database screening with BLASTp and analysis of the cDNA sequences of 12 contigs containing 199 cDNA sequences. IGFBP-rP1 was identified in the venom gland cDNA library (460,000 ESTs) by analyzing 13 contigs containing 54 cDNA sequences. 2.4. Quantitative RT(q)-PCR of SIBD-1 from different tissues of non-infected and infected spiders For RTq-PCR, tissue from dissected spiders was mixed with RNAlater (Qiagen) to obtain enough material for RNA extraction from hemocytes, venom glands, muscles, subesophageal nerve mass, hepatopancreas and ovaries. Total RNA was extracted from the tissues using the RNeasy Mini Kit (Qiagen). Approximately 2 mg of total RNA was reverse transcribed into cDNA (Omniscript RT Kit, Qiagen). For RTq-PCR, a custom TaqManÒ gene expression assay (Applied Biosystems, Switzerland) was used. The primers for SIBD-1 were designed as 50 -GATTGCTGTCCCGTTTGCTT-30 (fwd) and 50 CCATCGGCACAGATACCAAAGAC-30 (rev) and, as reporter, 50 CCACCGCAATATCCAC-30 . As an endogenous control the expression of the ribosomal protein S3A of C. salei (Supplementary material 2) with the following primers was used: 50 -AGCTAATGTTGATGTTAAAACTACTGATGGT-30 (fwd), and 50 -TGGGCATAACATGTCTTTTTACTGTGT30 (rev) and as reporter 50 -CCGATGCAAAACATTC-30 . RTq-PCR was performed with the 7500 fast real-time PCR system (Applied Biosystems) using 96 well plates (MicroAmp, fast optical 96-well reaction plate and MicroAmp optical adhesive film, Applied Biosystems) according to the Custom TaqManÒ gene expression assay protocol. Relative quantification of the gene expression was carried out with the comparative CT Method (Schmittgen and Livak, 2008). Briefly, each sample was run in triplicate and the CT for the target amplified SIBD-1 and the CT for the internal control (S3A from C. salei) was determined. The DCT was obtained by subtraction of the SIBD-1 CT value from the CT value of S3A to normalize the

893

differences in the amount of template and the efficiency of the RTq-PCR. As reference sample (calibrator), the DCT value for the untreated tissue sample was used. The DDCT value was calculated by subtracting the DCT value of the test sample from the DCT value of the calibrator sample. Expression level of SIBD-1 relative to the calibrator sample was calculated by 2DDCT. 2.5. Infection experiment Three adult female sibling spiders were individually analyzed at 3 h and 6 h after a sterile or septic injury. For the septic injury, 3e5 ml (w4  106 cells) of a mixture of Escherichia coli and Staphylococcus aureus was injected into the lateral opisthosoma of the spiders. Three further spiders served as the control group and received 3e5 ml of a physiological saline solution. These (6 þ 6 þ 3¼) 15 spiders were used for RP-HPLC analyses and another 15 spiders were expended for RTq-PCR; thus in total 2  15 ¼ 30 spiders were used. Hemolymph was obtained from spiders as previously reported (Baumann et al., 2010a). Briefly, individual hemolymph was diluted in 200 ml of sodium citrate buffer, at pH 4.6, to avoid coagulation (Söderhäll and Smith, 1983). After two washings with the above mentioned buffer and subsequent centrifugation, hemocytes were weighed before being preparing for RP-HPLC separation. Determination of the total hemocyte count (THC) of each spider was done in an improved Neubauer hemocytometer, counting both chambers, each with five squares. In a next step, the hemocytes of each spider were individually sonicated and centrifuged, and aliquots of the supernatant were used to estimate in duplicate the amino acid composition. Furthermore, one fourth of the material was individually separated by RP-HPLC on a Jasco HPLC System (Jasco, Japan). Briefly, the column (4.6  250 mm Nucleosil 100-5 C18 Nautilus, Macherey & Nagel) was equilibrated with ddH2O, 0.1% TFA and peptides were eluted at a flow rate of 0.5 ml/min, starting by a gradient of 0e20% ACN, 0.1% TFA for 20 min, followed by a gradient of 20e30% ACN, 0.1% TFA for 30 min and a further gradient of 30e50% ACN, 0.1% TFA for 40 min. SIBD-1 was quantified by RP-HPLC by integration of the peptide peak area using a calibration curve (0.66 mge5.8 mg SIBD-1) and related to mg of hemocytes. 2.6. Bioinformatics The amino acid sequence obtained for SIBD-1 was compared with other sequences using the BLASTp, BLASTx and BLASTn homology search program (Expasy Proteomic Server, UniProtKB/Swiss-Prot: release 2011_03 e Mar 8, 2011; and NCBI, Protein database and GenBank). Prediction of signal peptides was performed using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/) and for the identification of domains and amino acid motifs the following internet addresses were used: http://www.expasy.org/prosite/ and http://www.ebi.ac.uk/Tools/pfa/iprscan/. For translation of cDNA sequence data obtained by GenBank or our libraries, the ExPASy Proteomics Server (http://www.expasy.org/tools/dna.html) was used. Sequence alignment was calculated with ClustalW2 (http://www.ebi. ac.uk/Tools/msa/clustalw2/). 3. Results 3.1. Purification, cloning and characterization of full length SIBD-1 from the hemocytes of C. salei In searching for further peptides involved in the immune response, hemocytes from the hemolymph of non-infected or infected mature female spiders were isolated, sonicated and the acetic extract was separated by RP-HPLC (Fig. 1a,b). Obviously,

894

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

Fig. 1. RP-HPLC separation of 200 ml of an acetic extract of hemocytes as described in materials and methods: (a) non-infected spider (b) 6 h after a septic injury to the spider C. salei.

several major peptide peaks are reduced after infection (Fig. 1b), because the peptides are released into the hemolymph as a rapid response to bacterial infection (Fukuzawa et al., 2008). The three most important peaks involved in this physiological change are mygalin (Baumann, 2009; Pereira et al., 2007), ctenidins (Baumann et al., 2010a), and a hitherto unknown cysteine-rich peptide, SIBD-1 (Fig. 1a,b). For structural investigations of this unknown peptide, hemocytes of non-infected spiders were used as starting material. After sonication of the hemocytes and subsequent centrifugation, the supernatant was separated by RP-HPLC. The purity and mass of the SIBD-1 obtained were determined by electrospray-ionizationemass spectrometry (ESIeMS) and resulted in a pure peptide of 8676.08 Da. Due to cystines identified by the amino acid analysis, the peptide was further reduced and alkylated before amino acid sequencing. Edman degradation stopped after the first 31 residues: FXCPECRPELCGDPGYCEYGTKDACDCCPV. Residue 2 could not be identified. Therefore, based on these sequence data, a set of degenerative primers was designed for 30 - as well as 50 -RACE-PCRs of hemocyte cDNA, resulting in the complete cDNA sequence of this peptide. The

cDNA consists of 487 bp, starting with a 50 -UTR of 57 bp, followed by an open reading frame (ORF) of 294 bp, and a 30 -UTR of 136 bp. The deduced amino acid sequence starts with a putative signal peptide of 19 amino acids. Prediction of the cleavage site for the signal peptide shows the cleavage site most likely located after the Ala residue preceding the Phe in position 20 (Fig. 2). The mature peptide is composed of 78 residues and residue 2 was identified as Thr. The amino acid composition is rather unique with high amounts of Cys (15.4%), Gly (15.4%), Pro (11.5%), and Asp (9%) with a pI of 3.91. The theoretical mass of the peptide obtained by cDNA sequencing is calculated as 8151.11 Da, taking 6 disulfide bridges into account. The mass difference to the measured mass of the purified peptide amounts to 524.96 Da. Because Thr 2 could not be identified by Edman degradation, a posttranslational modification (PTM) of this amino acid was proposed, which could explain the above mentioned mass difference. To verify this assumption, the reduced and alkylated peptide was further digested with Asp-N. The proteolytic fragments were separated by RP-HPLC and seven fractions were obtained. All fractions were characterized by ESIeMS measurements and amino acid sequence analyses (Supplementary material 1). With the exception of fraction 2 and 3, all other fractions affirm the acquired cDNA sequence data and the ESIeMS measurements. Fraction 2 was identified as containing the fragment corresponding to amino acid residues 1e12 (theoretical mass 1524.62 Da; ESIeMS mass 2050.74 Da) and fraction 3 contained the fragment corresponding to amino acid residues 1e23 (theoretical mass 2796.13 Da; ESIeMS mass 3321.40 Da). For fragment 2 a mass difference of 526.12 Da and, for fragment 3 a mass difference of 525.27 Da was identified. The mass difference of 524.96 Da between purified peptide and its theoretical mass corresponds to the mass differences of 526.12 Da/525.27 Da between the RP-HPLC purified proteolytic fragments of residues 1e12/1e23 and their theoretical peptide masses, suggesting a PTM of Thr 2 by an O-glycosylation. The concentration of SIBD-1 in hemocytes of non-infected spiders was determined by quantitative RP-HPLC, related to mg of processed hemocytes and amounts to 67.1  12.9 pmol/mg hemocytes (N ¼ 12, mean  SD). 3.2. Protein domain and homology analysis of SIBD-1 Scanning the obtained sequence of SIBD-1 against PROSITE patterns and profiles resulted in the identification of IGFBP N-terminal domain profile (“IGFBP_N_2” matrix entry type PS51323 and PROSITE pattern entry type PS00222). BLASTp analysis of the sequence against the UniProtKB database (Release 2011_05 e May 3, 2011) revealed scores of sequence similarities to other

1ACGCGGGGAGACTCGTTTCTTTAGCATTCCTGTGCAGTTCTTTCCGTTAAAGACGAA 58- ATGAAGACTCTTTTTGTATTTGCTGTTGGAATTATGCTTTCAATGAGGGCTTCAGCATTT M K T L F V F A V G I M L S M R A S A F 118- ACTTGTCCGGAATGCAGACCTGAACTGTGTGGGGATCCTGGCTACTGTGAATACGGTACC T C P E C R P E L C G D P G Y C E Y G T 178- ACAAAAGATGCATGTGATTGCTGTCCCGTTTGCTTCCAGGGACCTGGTGGATATTGCGGT T K D A C D C C P V C F Q G P G G Y C G 238- GGACCAGAAGACGTCTTTGGTATCTGTGCCGATGGTTTTGCCTGCGTTCCATTAGTTGGC G P E D V F G I C A D G F A C V P L V G 298- GAAAGGGACAGCCAAGATCCTGAGATAGTCGGAACCTGTGTCAAAATACCCTAAAACTTC E R D S Q D P E I V G T C V K I P *** 358- CTACCAGTCCTGAAGTTACCTGTCCTTATCGGCTGAATAACTATCAACAATATTTTAACA 418- TAAAAAACTGTGTATTAACGAAGCTAAGATTTTTTTATTAGTATTCACCAATAAATATAT 478- TCAATGCTAA

- 57 -117 -177 -237 -297 -357 -417 -477 -487

Fig. 2. SIBD-1 cDNA sequence of C. salei. The deduced amino acid sequence is presented under the nucleotide sequence. The mature peptide sequence is underlined; the nucleotide sequence of the mature peptide is in bold letters. The asterisks mark the stop codon. The polyadenylation signal is shown in bold italics.

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

895

Fig. 3. SIBD-2 cDNA sequence of C. salei. The deduced amino acid sequence is presented under the nucleotide sequence. The mature peptide sequence is underlined; the nucleotide sequence of the mature peptide is in bold letters. The asterisks mark the stop codon.

proteins, e.g. the chordin-like peptide from Hydra magnipapillata (Q2VYC5; E-Value 5.0  109), human cDNA, FLJ78981 (B7Z9W7, E-value 3.0  108, which is highly similar to human IGFBP7 MAC25 PSF: Q16270, E-value 1.0  10163) and the Cys-rich motor neuron 1 protein (CRIM) from the crustacean Lepeophtheirus salmonis (D3PJM6, E-value 1.0  105). However, this domain similarity of SIBD-1 with its unknown function is only attributable to the N-terminal IGFBP domain present in all these proteins. After searching our hemocyte cDNA library of C. salei, we identified a further related peptide, SIBD-2 (Fig. 3). The SIBD-2 transcript is composed of 526 nucleotides, with an 86 bp 50 -UTR, a 300 bp ORF and a 140 bp 30 -UTR. The ORF codes for an 18 amino acid residue signal peptide, followed by the putative mature peptide of 81 amino acid residues, exhibiting a similar IGFBP N-terminal domain-like signature (PROSITE: PS00222). After scanning the sequence with BLASTn against different EST sequences, several similar sequences could be identified, and,

parallel to LvSIBD (Castellanos et al., 2008) and EsSIBD (Gai et al., 2010), we followed their proposed naming of the peptides as single insulin-like growth factor-binding domain protein, SIBD-1 and SIBD-2 from C. salei. Clustal W alignment analysis of the obtained EST sequences from different invertebrates with tentatively named putative SIBD peptides resulted in identities between 15% and 41%. Amino acid sequence alignment of SIBD-1 and SIBD-2 exhibits 42% identity between the two peptides, possibly pointing to similar biological functions. Identities between 34% and 41% were found between SIBD-1 and three other EST sequences originating from hemocytes of the mygalomorph spider A. gomesiana (Fig. 4). Interestingly, when comparing SIBD-2 with the crustacean astakine-dependent hematopoetic factor CHF (Lin et al., 2011), an identity of 41% was obtained. In contrast, only 34% identity was found, when SIBD-2 was compared with the three putative SIBD peptides from A. gomesiana mentioned above. One mRNA isolated from the Bombyx p50 strain, encoding a putative peptide identified

Fig. 4. Multiple sequence alignment analysis (ClustalW2) of mature SIBD-1 and putative mature SIBD-2 with putative mature SIBDs and IGFBP-rPs of invertebrates. The conserved Cys residues are highlighted in black and identical amino acid residues are highlighted in gray. Identities compared to SIBD-1 and SIBD-2 are summarized in the last column. The sequences have been divided in two parts: the first part contains predicted SIBD sequences from invertebrates, and the second, predicted IGFBP-rP sequences from ticks. The start of the mature peptides was estimated using the Signal3 server. Part 1: Csa SIBD-1 (Cupiennius salei, GenBank HE580153), Csa SIBD-2 (Cupiennius salei, GenBank HE580154), Ago SIBD-1 (Acanthoscurria gomesiana, GenBank DR445051), Ago SIBD-2 (Acanthoscurria gomesiana, GenBank DR443736), Ago SIBD-3 (Acanthoscurria gomesiana, GenBank DR443734), Beu SIBD (Buthus eupeus, UniProtKB E4VP27), Mgi SIBD (Mesobuthus gibbosus, GenBank CB334147), Rap SIBD (Rhipicephalus appendiculatus, GenBank CD796554), Ava SIBD (Amblyomma variegatum, GenBank BM291935), Isc SIBD (Ixodes scapularis, GenBank EW835647), Mro (Macrobrachium rosenbergii, GenBank EL696316), Lva SIBD (Litopenaeus vannamei, UniProtKB B6S691), Pmo SIBD (Penaeus monodon, GenBank BI784456), Esi SIBD (Eriocheir sinensis, GenBank FJ607954), Hla Perlustrin (Haliotis laevigata, UniProtKB P82595), Hvu SIBD (Hydra vulgaris, GenBank CV887667), Tca SIBD (Tribolium castaneum, (Veenstra, 2010)), Ame SIBD (Apis mellifera, (Veenstra, 2010)), Bmo NP (Bombyx mori, GenBank AB298927), Ple CHF (Pacifastacus leniusculus, GenBank GQ497446) and Bfl SIBD (Branchiostoma floridae, GenBank BW700784). Part 2: AamIGFBP-rP6S (Amblyomma americanum, GenBank GU907778) and AamIGFBP-rP6L (Amblyomma americanum, GenBank GU907779). # Presentation of the deduced amino acid sequence is limited to the N-terminal part of the sequence. * Sequences exhibiting the “LxCxxC” motif as introduced in (Lin et al., 2011).

896

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

as neuroparsin (AB298927) (Roller et al., 2008), also exhibits a closely related IGFBP N-terminal domain-like signature (Fig. 4). 3.3. Abundance of SIBD-1 in hemocytes after a sterile or septic injury of C. salei Because SIBD-1 did not reveal bactericidal activities against E. coli and S. aureus up to a concentration of 222.9 mM, we investigated a possible involvement of SIBD-1 in the immune response after an injury to C. salei. We treated spiders in two different ways by injecting them a physiological saline solution without (sterile injury) and with bacteria (septic injury) and analyzed the physiological reaction after 3 h (N ¼ 3) and 6 h (N ¼ 3). Non-infected spiders (N ¼ 3) were used as the control group. The total hemocyte count (THC) of non-infected spiders amounted to 57.1  6.6  106 cells/ml hemolymph. A significant decrease (ANOVA, F2,12 ¼ 8.925, p ¼ 0.0042) in the THC was observed when the control group (non-infected spiders) was compared with the sterile injury group (3 h and 6 h: 49.5  1.5  106 cells/ml hemolymph, Tukey HSD, p < 0.05) and with the septic injury group (3 h and 6 h: 47.0  2.9  106 cells/ml hemolymph, Tukey HSD, p < 0.01). There was no significant difference between the sterile and the septic infection group. We did not detect a significant difference in the THC with respect to time (3 h and 6 h) (Fig. 5a), and therefore merged the data within the sterile and septic groups. The SIBD-1 content of non-infected spiders amounts to 64.2  10.5 pmol/mg hemocytes and is significantly decreased (ANOVA, F2,12 ¼ 15.59, p ¼ 0.0005) in the sterile injury group (3 h and 6 h) to 34.5  12.0 pmol/mg hemocytes (Tukey HSD, p < 0.01), or after septic injury (3 h and 6 h) to 22.0  9.3 pmol/mg hemocytes (Tukey HSD, p < 0.001) (Fig. 5b). There was no difference in SIBD-1 content with respect to time (3 h and 6 h) within the sterile and the

septic group or between the two groups and we therefore merged these data. However, analysis of the SIBD-1 content 6 h after infection showed a significant decrease in the septic injury group (17.21  7.6 pmol/mg hemocytes) compared with the sterile injury group (42.7  12.5 pmol/mg hemocytes) (Tukey HSD, p < 0.05) (Fig. 5b). The amino acid contents of hemocytes from non-infected, sterile and septically injured spiders were significantly different (ANOVA, F4,10 ¼ 3.708, p ¼ 0.0422) (Fig. 5c). With respect to time (3 h and 6 h) there were no differences within either the sterile or the septic group; however there were clear differences between non-infected spiders (341.6  75.1 nmol amino acids/mg hemocytes) and both the sterile injury group after 3 h (153.1  13.7 nmol amino acids/mg hemocytes; Bonferroni, p < 0.05) and the septic injury group after 6 h (122.9  35.2 nmol amino acids/mg hemocytes; Bonferroni, p < 0.05). In addition, the relative Gly content of hemocytes was also significantly reduced (ANOVA, F2.12 ¼ 22.38, p < 0.0001) in both the sterile injury group (3 h and 6 h: 191.8  13.1 pmol Gly/nmol total amino acids of hemocytes, Tukey HSD, p < 0.05) and septic injury group (3 h and 6 h: 141.33  26.9 pmol Gly/nmol total amino acids of hemocytes, Tukey HSD, p < 0.001), when compared with the control group (3 h and 6 h: 248.8  31.0 pmol Gly/nmol total amino acids of hemocytes) (Fig. 5d). Furthermore, a significant difference in the Gly content between sterile and septic injury treatments was also found (Tukey HSD, p < 0.01). There was no difference in the relative Gly content of hemocytes with respect to time (3 h and 6 h) within the sterile or the septic groups and therefore we merged these data. In contrast, the relative content of Glu or Asp (nmol Glu or Asp/nmol total amino acids of hemocytes) was not affected with respect to a sterile or septic infection or by time (3 h or 6 h after infection), pointing to a selective delivery of glycine-rich peptides. These results indicate an immune response after a sterile or septic injury of spiders: the counts of hemocytes were reduced,

Fig. 5. Abundance of different hemocyte parameters after a sterile or septic injury of C. salei. Total hemocyte count (THC) per ml hemolymph (HL) (a), content of SIBD-1 per mg hemocytes (HC)(b), content of the total amino acids (AA) of hemocytes per mg hemocytes (HC) (c), Gly (white square), Glu (white circle) and Asp (asterisk) per nmol of amino acids of hemocytes (HC) (d). The control group was sacrificed one day after feeding. Spiders were injured by injection of saline solution (sterile injection) or by injection of bacteria (Gramþ and Gram) in saline solution one day after feeding and sacrificed 3 h and 6 h later. All data with mean  SD (N ¼ 3 per group). SIBD-1 (b) content was determined by quantitative RP-HPLC of sonicated hemocytes.

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

897

which goes along with a reduction of their amino acid content. In this context the delivery of SIBD-1 and of glycine-rich peptides (ctenidins) from hemocytes into the hemolymph, possibly at the site of injury (Fukuzawa et al., 2008), has to be contemplated. 3.4. RTq-PCR of SIBD-1 in different tissues of non-infected spiders and after a sterile or septic injury of C. salei We first analyzed the expression of SIBD-1 in different tissues of non-infected spiders relative to the expression of mRNA of the ribosomal peptide S3A by RTq-PCR. The expression of hemocyte mRNA was used as calibrator. SIBD-1 mainly occurs in hemocytes. Its expression in the subesophageal nerve mass is only 1/3 as much as in hemocytes, and in muscles only 1/10. The lowest expression was identified in ovaries, venom glands, and hepatopancreas, which revealed less than 1/133 the amount of SIBD-1 expressed in hemocytes (Fig. 6). To investigate the mRNA expression of SIBD-1 in different tissues after an injury, we performed RTq-PCR with the same experimental design as above. We measured the expression of mRNA of SIBD-1 in different tissues relative to the expression of mRNA of the ribosomal peptide S3A (endogenous control). For each tissue the expression of SIBD-1 of the control group was used as calibrator. Surprisingly, we detected a decrease in the mRNA expression of SIBD-1 in hemocytes after infection (sterile or septic injury after 3 h and 6 h), when compared with the control group. The expression of SIBD-1 in hemocytes from injured spiders exhibits only 1/6 and 1/15 (sterile injury after 3 h or 6 h) or 1/9 and 1/13 (septic injury after 3 h or 6 h) the amount of SIBD-1 of non-infected spiders (Fig. 7). The relative SIBD-1 expression in hepatopancreas, venom glands, and ovaries after injury remains at negligible values. In muscles we identified an apparent up-regulation of mRNA expression of SIBD-1 6 h after a sterile injury and a down-regulated expression 3 h after a septic injury in comparison with muscles of non-infected spiders (Fig. 7). These effects are in the same range as the down-regulated expression of SIBD-1 in hemocytes after a sterile or septic injury and might be caused by a contamination of muscle tissue with hemocytes. The decrease in subesophageal nerve mass may have occurred for the same reason. 3.5. Expression of an additional member of the IGFBP-superfamily in C. salei venom glands Identification of SIBD-1 and SIBD-2 in the cDNA library of the venom glands of C. salei was not successful. Remarkably, in this cDNA library, we identified one putative peptide (IGFBP-rP1)

Fig. 7. RTq-PCR of SIBD-1 mRNA in different tissues in dependence on a sterile injury measured after 3 h (hatched bars) and 6 h (dotted bars) and a septic injury after 3 h (gray bars) and 6 h (white bar). mRNA of non-treated spider tissues were adopted as calibrator (black bars) for every tissue and compared with the levels of SIBD-1 relative to S3A mRNA. The tissue calibrators were fitted to the relative expression of hemocytes (see Fig. 6). Error bars indicate the range of fold differences calculated on the standard deviation of the DDCT values. Expression was assayed in hemocytes (a), muscles (b), hepatopancreas (c), venom glands (d), subesophageal nerve mass (e), and ovaries (f).

exhibiting high similarities to EST-derived sequences of other Chelicerata, e.g. from ticks (AamIGFBP-rP1, D5LHI8) (Mulenga and Khumthong, 2010), and from human IGFBP-rP1 (Q16270) (LopezBermejo et al., 2003; Murphy et al., 1993). The IGFBP-rP1 transcript is 916 nucleotides long, with a 78 bp 50 -UTR, a 786 bp ORF, and a 52 bp 30 -UTR (Supplementary material 3). The ORF codes for a 17 amino acid residue signal peptide and the putative mature peptide is composed of 244 amino acid residues, exhibiting N-terminally a similar IGFPB N-terminal domain signature (“XCGCCXXC” PROSITE: PS00222), as verified for different IGFBPs, such as IGFPB-4 (Chelius et al., 2001; Qin et al., 1998) and human IGFBP-rP1 (Oh et al., 1996). The mid-region and the C-terminus of IGFBP-rP1 presents two further domains: the Kazal-type serine proteinase inhibitor (PROSITE: PS51465) and the immunoglobulinlike C2 domain (PROSITE: PS50835) as shown for human IGFBP-rP1 and tick AamIGFPB-rP1 (Hwa et al., 1999; Mulenga and Khumthong, 2010). The above mentioned three domains identified in IGFBP-rP1 of C. salei seem to be well conserved in spiders, mites, and vertebrates (Fig. 8). Sequence comparison of IGFBP-rP1 with SIBD-1 and SIBD-2 from C. salei showed only 32% amino acid identity even though the comparison was restricted to the N-terminal IGFBP domain (up to residue 82). Scanning IGFBP-rP1 with BLASTn against different EST sequences (http://www.ncbi.nlm.nih.gov), restricted to chelicerates (spiders, mites including ticks, and horseshoe crabs), identities of 49%e70% between IGFBP-rP1 and the different translated peptides were obtained (Fig. 8). Interestingly, when C. salei IGFBP-rP1 is compared with an EST translational product from the theridiid spider Parasteatoda tepidariorum (FY219746), 70% amino acid identity is observed. A comparison with the horseshoe crab Limulus polyphemus (FN230334) yields 57% amino acid identity and, with human IGFPB-rP1, only 36% identity is indicated. 4. Discussion 4.1. SIBD-1, SIBD-2 and IGFBP-rP1 from C. salei exhibit N-terminal IGFPB domain-like variant

Fig. 6. RTq-PCR of SIBD-1 mRNA in different tissues relative to SIBD-1 in hemocytes. The relative expression of S3A mRNA was used as reference expression for every tissue, with SIBD-1 from hemocytes as calibrator. Error bars indicate the range of fold differences calculated on the standard deviation of the DDCT values. Expression was assayed in hemocytes (a), muscles (b), hepatopancreas (c), venom glands (d), subesophageal nerve mass (e), and ovaries (f).

We report here the purification of SIBP-1 from hemocytes of the spider C. salei, which beside the gastropod perlustrin (Weiss et al., 2000) is the second peptide to be isolated from an invertebrate organism and investigated on peptide level. Perlustrin was isolated from the nacre of H. laevigata. Additionally, on mRNA level, several

898

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

Fig. 8. Multiple sequence alignment analysis (ClustalW2) of putative mature IGFBP-rP1 with putative mature IGFBP-rPs of Chelicerata and human IGFBP-rP1. The conserved Cys residues are highlighted in black and identical amino acid residues are highlighted in gray. Identities compared to C. salei IGFBP-rP1 are summarized in the last column. The IGFBP N-terminal domain is indicated by a dotted line, the Kazal-type serine proteinase inhibitor domain by a line, and the immunoglobulin-like C2 domain by a dashed line. Only EST sequences exhibiting the signal peptide and the STOP codon were used for the alignment. Abbreviations: Csa, Cupiennius salei (GenBank HE580155); Pte, Parasteatoda tepidariorum (GenBank FY219746); Rap, Rhipicephalus appendiculatus (GenBank CD788267); Ava, Amblyomma variegatum (GenBank BM290867); Aam, Amblyomma americanum (GenBank GU907780); Isc, Ixodes scapularis (GenBank EW898644); Lpo, Limulus polyphemus (GenBank FN230334); Btr, Blomia tropicalis (GenBank CB283230); Hsa, Homo sapiens (UniProtKB Q16270).

invertebrate peptides, showing similarities to SIBD-1 and SIBD-2, have been identified in hemocytes, but also in salivary glands, venom glands, and whole body extractions (Fig. 4). Up to now, only very limited information about their biological function is available. Characteristic for all these peptides is the occurrence of an

N-terminal IGFBP motif variant with unknown function. This motif was first described for vertebrate IGFPBs and IGFPB-related proteins (rP). For these proteins the typical IGFBP motif “GCGCCXXC” is located within the N-terminal protein part and is stated to be essential for IGF-binding (Kim et al., 1997).

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

Interestingly, perlustrin also binds IGF-I, IGF-II, and insulin and exhibits a modified N-terminal IGFBP motif “XCGCCXXC” (Weiss et al., 2001) which could be identified in some of the presented putative SIBDs from scorpions, mites, and the spider A. gomesiana, but not from C. salei (Fig. 4). Recently, an astakine-dependent novel hematopoietic factor (CHF) from the crustacean P. leniusculus was identified to play a key role in the survival of hemocytes. The peptide exhibits a modified IGFBP motif “XC(X/G)CCXXC”. (Lin et al., 2011). This motif is also present in SIBD-1 and SIBD-2 from C. salei and in putative SIBD peptides from A. gomesiana and further crustaceans and insects (Fig. 4). Lin and coworkers proposed a further N-terminal motif “LXCXXC” integrating the first two N-terminal cysteines of CHF and related peptides. They stated that both motifs (“LXCXXC” and “XCX/GCCXXC”) are present not only in CHF and CHF-like peptides but also in vertebrate CRIM 1 genes (cysteine-rich transmembrane bone morphogenetic protein (BMP) regulator 1 (chordin-like)). CRIM1 is supposed to reduce the production and secretion of active BMPs to the cell surface (Wilkinson et al., 2003). Furthermore, we report here for the first time the identification of a transcript encoding IGFBP-rP1 in venom glands of C. salei, which seems also to be present in ticks (Mulenga and Khumthong, 2010). Beside the IGFBP motif variant “XCGCCXXC”, it exhibits two further domains (Kazal-type serine proteinase domain, and immunoglobulinlike C2 domain). Interestingly, a multiple sequence alignment restricted to mites, spiders and human IGFBP-rP1 of EST-sequences (Fig. 8) shows high identities of between 49% and 70% with IGFBP-rP1. According to Mulenga and Khumthong (Mulenga and Khumthong, 2010), physiological functions of tick feeding activity in the early stage seem to be controlled by the shorter variants AamIGFBP-rP6L and AamIGFBP-rP6S (Fig. 4). In contrast, AamIGFBPrP1 (Fig. 8) is up-regulated in a later phase of blood feeding. These genes are highly conserved in other ticks (Mulenga and Khumthong, 2010). The ancient N-terminal domain of invertebrate SIBDs could be the ancestral origin of the N-terminal IGFBP domain of some protein families, such as the IGFPB superfamily (IGFBPs and IGFBP-rPs) (Hwa et al., 1999), chordin-like proteins (Garcia Abreu et al., 2002) and Cys-rich motor neuron proteins (CRIM1) of vertebrates (Kolle et al., 2000). Apart from the joint N-terminal IGFBP domain, some of these proteins exhibit no further related structures and their biological functions are highly diverse. As already described in detail by Hwa, Castellanos and coworkers (Castellanos et al., 2008; Hwa et al., 1999), the modular composition of these various proteins points to exon/domain shuffling as an evolutionary mechanism rather than to sharing a common ancestral gene. 4.2. Posttranslational modification of SIBD-1 The combination of molecular biological methods and Edman degradation revealed a posttranslational modification of SIBD-1. A well-known modification of Thr/Ser residues occurs by O-glycosylation, in which O-GlcNAc is attached to the side chain oxygen atom of the amino acid (Comer and Hart, 2000). O-linked glycosylation of proteins influences their biological activity, protein folding and solubility (Chen et al., 2010). In addition, such an O-glycosylation of Thr/Ser in the midregion of the proteins is well-known for several members of the IGFBP superfamily (Bach et al., 1993; Neumann et al., 1998; Ständker et al., 1998) and in the case of human IGFBP-6, delays clearance of the protein from the circulation (Marinaro et al., 2000a) and binding to glycosaminoglycans (Marinaro et al., 2000b), which could also be its function in the case of SIBD-1. Remarkably, 11 out of 21 amino acid sequences of putative SIBDs (Fig. 4) exhibit a Thr or a Ser in

899

position 2, which could possibly be posttranslationally modified by O-glycosylation; but Ser 2 is not posttranslationally modified in the case of perlustrin (Weiss et al., 2001). 4.3. Expression of SIBD-1, SIBD-2 and IGFBP-rP1 SIBD-1 is mainly expressed in hemocytes and to a lesser extent in the subesophageal nerve mass and muscles. An infiltration of hemocytes into different tissues, especially into muscles, is possible. Because small arteries (Sinus thoracalis) are arranged directly on top of the subesophageal nerve mass of C. salei (Barth, 2001), a contamination with the remains of invisible collapsed arteries enclosing hemocytes or hemocyte infiltrated tissue cannot be excluded, and could be responsible for the expression of SIBD-1 therein. Two further invertebrate peptides exhibiting a comparable N-terminal IGFBP domain-like motif have been identified from hemocytes of crustaceans. A tissue expression profile is reported for EsSIBD from the Chinese mitten crab E. sinensis (Gai et al., 2010). In contrast to SIBD-1 from C. salei, EsSIBD is eight-fold more expressed in gill, four-fold more in muscle and two-fold more in hepatopancreas than in hemocytes. However LvSIBD identified from L. vannamei is expressed in hemocytes (Castellanos et al., 2008). Beside the general statement that EsSIBD (Gai et al., 2010) and LvSIBD (Castellanos et al., 2008) are involved in immune response and endocrine processes, the target and exact function of such peptides are still unclear. A recent report on an astakine-dependent novel hematopoietic factor identified on cDNA level from the hematopoietic tissue (HPT) of the freshwater crayfish P. leniusculus (GQ497446) might shed light on the matter (Lin et al., 2011). The crustacean hematopoietic factor (CHF) exhibits an N-terminal IGFBP domain variant (Fig. 4). This peptide is assumed to play an important role in hematopoiesis, since it is critical for the survival of hemocytes and HPT-cells, preventing their apoptosis by interacting with astakine 1, a hematopoietic growth factor of this crayfish (Lin et al., 2010, 2011). Like SIBD-1, CHF is mainly expressed in hemocytes and HPT-cells and to a lesser extent in the heart, possibly due to an infiltration of hemocytes into the tissue. What is important is the finding that CHF is exclusively expressed in semigranular cells and not in granular cells because it indicates different functions of distinct hemocyte types (Lin et al., 2011). ClustalW alignment of CHF with SIBD-1 exhibits an identity of 28%. Remarkably, when aligned with SIBD-2, an identity of 41% is observed (Fig. 4). It is tempting to speculate that SIBD-2 could have a comparable biological function to that reported for CHF (Lin et al., 2011). This potentially similar biological function of SIBD-2 is even more plausible since we have detected an astakine 1 homolog in the cDNA library of C. salei (unpublished results Kuhn-Nentwig). Astakine 1 is essential for the release of hemocytes from the hematopoetic tissue into the hemolymph of P. leniusculus and is also necessary for the transcription of CHF in HPT-cells (Lin and Söderhäll, 2011). After an infection or injury, circulating hemocytes may migrate to the site of infection and secrete various antimicrobial peptides and factors to fight microbial invaders. Additionally, wound repair by coagulation prevents the loss of hemolymph from the open circulatory system (Fukuzawa et al., 2008; Theopold et al., 2004). As with crustaceans (Giulianini et al., 2007; Söderhäll et al., 2003), a reduction of THC after a septic or even a sterile injury is also observed in C. salei. Additionally, the hemocytes content of SIBD-1 and especially the Gly content is reduced after an injury, which is explained by the secretion of Gly-rich antimicrobial peptides to the place of injury to fight against the bacterial challenge (Fig. 5b,d). This demonstrates the strong immune response of spiders to any kind of injury, even after a sterile lesion. We hypothesize the synchronous release of SIBD-1 together with ctenidins, further

900

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901

unknown antimicrobial peptides and different coagulation factors from hemocytes to fight against infection and induce wound closure. Lorenzini and co-workers reported (Lorenzini et al., 2006) that nearly all components of the coagulation cascade of the horseshoe crab Tachypleus tridentatus (Iwanaga, 2002) have been identified in a cDNA library of the spider A. gomesiana. In contrast to EsSIBD and SvSIBD, which seem to be upregulated after challenge with bacteria (Castellanos et al., 2008; Gai et al., 2010), the expression of SIBD-1 is more likely to be down-regulated in hemocytes. This effect is here reported for all hemocytes since we did not distinguish between different hemocyte types. However, the same effect could be achieved if SIBD-1 is expressed only in one type of hemocyte which is then strongly reduced due to its involvement in the immune defense. Further investigations are necessary to identify the hemocyte type(s) (Seitz, 1972a) in which SIBD-1 is expressed. Identification of upstream genes of SIBD-1 could be the key to the elucidation of its possible regulatory function. 4.4. Conclusions To summarize, we purified SIBD-1 from hemocytes of C. salei and elucidated its primary structure and posttranslational modification by means of protein chemistry and molecular biological methods. RTq-PCR experiments show the involvement of this peptide as a possible regulator in the immune response of spiders, although an involvement in other physiological regulation mechanisms is possible. Furthermore, besides the identification of SIBD2 mRNA in hemocytes, IGFBP-rP1 mRNA was identified in the venom gland of C. salei, which allows us deeper insight into the complex situation of invertebrate peptides and proteins exhibiting an IGFBP N-terminal domain-like motif. Acknowledgments We thank the Swiss National Science Foundation for funding (grants 310030_127500 and 31003A-113681), Dr. Heather Murray for critical comments on the manuscript and Gabriela Mäder for technical support. We also thank three anonymous reviewers for valuable comments on an earlier draft of the manuscript. The sequences have been deposited (EMBL/Genbank) as follows: the cDNA for S3A under the accession number HE580152, the cDNA for SIBD-1 under the accession number HE580153, the cDNA for SIBD-2 under the accession number HE580154, the cDNA for IGFBP-rP1 under the accession number HE580155. Appendix. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ibmb.2011.08.003. References Alic, N., Partridge, L., 2008. Stage debut for the elusive Drosophila insulin-like growth factor binding protein. J. Biol. 7, 18. Andersen, A., Hertz Hansen, P., Schaffer, L., Kristensen, C., 2000. A new secreted insect protein belonging to the immunoglobulin superfamily binds insulin and related peptides and inhibits their activities. J. Biol. Chem. 275, 16948e16953. Bach, L.A., Thotakura, N.R., Rechler, M.M., 1993. Human insulin-like growth factor binding protein-6 is O-glycosylated. Growth Regul. 3, 59e62. Barth, F.G., 2001. Sinne und Verhalten: aus dem Leben einer Spinne. Springer, Berlin. Baumann, T., 2009. Immune defence of Cupiennius salei. Dissertation, University of Bern, Switzerland. Baumann, T., Kämpfer, U., Schürch, S., Schaller, J., Largiadèr, C., Nentwig, W., KuhnNentwig, L., 2010a. Ctenidins: antimicrobial glycine-rich peptides from the hemocytes of the spider Cupiennius salei. Cell. Mol. Life Sci. 67, 2787e2798.

Baumann, T., Kuhn-Nentwig, L., Largiadèr, C.R., Nentwig, W., 2010b. Expression of defensins in non-infected araneomorph spiders. Cell. Mol. Life Sci. 67, 2643e2651. Castellanos, M., Jimenez-Vega, F., Vargas-Albores, F., 2008. Single IB domain (SIBD) protein from Litopenaeus vannamei, a novel member for the IGFBP family. Comp. Biochem. Physiol. Part D Genomics Proteomics 3, 270e274. Chelius, D., Baldwin, M.A., Lu, X., Spencer, E.M., 2001. Expression, purification and characterization of the structure and disulfide linkages of insulin-like growth factor binding protein-4. J. Endocrinol. 168, 283e296. Chen, S.A., Lee, T.Y., Ou, Y.Y., 2010. Incorporating significant amino acid pairs to identify O-linked glycosylation sites on transmembrane proteins and nontransmembrane proteins. BMC Bioinformatics 11, 536. Collet, C., Candy, J., 1998. How many insulin-like growth factor binding proteins? Mol. Cell. Endocrinol. 139, 1e6. Comer, F.I., Hart, G.W., 2000. O-Glycosylation of nuclear and cytosolic proteins. Dynamic interplay between O-GlcNAc and O-phosphate. J. Biol. Chem. 275, 29179e29182. Fukuzawa, A.H., Vellutini, B.C., Lorenzini, D.M., Silva Jr., P.I., Mortara, R.A., da Silva, J.M., Daffre, S., 2008. The role of hemocytes in the immunity of the spider Acanthoscurria gomesiana. Dev. Comp. Immunol. 32, 716e725. Gai, Y., Wang, L., Song, L., Zhao, J., Qiu, L., Xing, K., 2010. A putative endocrine factor SIBD (single insulin binding domain protein) involved in immune response of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 28, 10e17. Garcia Abreu, J., Coffinier, C., Larrain, J., Oelgeschlager, M., De Robertis, E.M., 2002. Chordin-like CR domains and the regulation of evolutionarily conserved extracellular signaling systems. Gene 287, 39e47. Giulianini, P.G., Bierti, M., Lorenzon, S., Battistella, S., Ferrero, E.A., 2007. Ultrastructural and functional characterization of circulating hemocytes from the freshwater crayfish Astacus leptodactylus: cell types and their role after in vivo artificial non-self challenge. Micron 38, 49e57. Heesch, S., Bartram, I., Neumann, M., Reins, J., Mossner, M., Schlee, C., Stroux, A., Haferlach, T., Goekbuget, N., Hoelzer, D., Hofmann, W.K., Thiel, E., Baldus, C.D., 2011. Expression of IGFBP7 in acute leukemia is regulated by DNA methylation. Cancer Sci. 102, 253e259. Heesch, S., Schlee, C., Neumann, M., Stroux, A., Kuhnl, A., Schwartz, S., Haferlach, T., Goekbuget, N., Hoelzer, D., Thiel, E., Hofmann, W.K., Baldus, C.D., 2010. BAALCassociated gene expression profiles define IGFBP7 as a novel molecular marker in acute leukemia. Leukemia 24, 1429e1436. Honegger, B., Galic, M., Kohler, K., Wittwer, F., Brogiolo, W., Hafen, E., Stocker, H., 2008. Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance. J. Biol. 7, 10. Hwa, V., Oh, Y., Rosenfeld, R.G., 1999. The insulin-like growth factor-binding protein (IGFBP) superfamily. Endocr. Rev. 20, 761e787. Iwanaga, S., 2002. The molecular basis of innate immunity in the horseshoe crab. Curr. Opin. Immunol. 14, 87e95. Jiravanichpaisal, P., Lee, B.L., Söderhäll, K., 2006. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 211, 213e236. Jiravanichpaisal, P., Söderhäll, K., Söderhäll, I., 2010. Inflammation in arthropods. Curr. Pharm. Des. 16, 4166e4174. Kim, H.S., Nagalla, S.R., Oh, Y., Wilson, E., Roberts Jr., C.T., Rosenfeld, R.G., 1997. Identification of a family of low-affinity insulin-like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP superfamily. Proc. Natl. Acad. Sci. USA 94, 12981e12986. Kolle, G., Georgas, K., Holmes, G.P., Little, M.H., Yamada, T., 2000. CRIM1, a novel gene encoding a cysteine-rich repeat protein, is developmentally regulated and implicated in vertebrate CNS development and organogenesis. Mech. Dev. 90, 181e193. Lin, X., Novotny, M., Söderhäll, K., Söderhäll, I., 2010. Ancient cytokines, the role of astakines as hematopoietic growth factors. J. Biol. Chem. 285, 28577e28586. Lin, X., Söderhäll, I., 2011. Crustacean hematopoiesis and the astakine cytokines. Blood 117, 6417e6424. Lin, X., Söderhäll, K., Söderhäll, I., 2011. Invertebrate hematopoiesis: an astakinedependent novel hematopoietic factor. J. Immunol. 186, 2073e2079. Lopez-Bermejo, A., Khosravi, J., Corless, C.L., Krishna, R.G., Diamandi, A., Bodani, U., Kofoed, E.M., Graham, D.L., Hwa, V., Rosenfeld, R.G., 2003. Generation of antiinsulin-like growth factor-binding protein-related protein 1 (IGFBP-rP1/MAC25) monoclonal antibodies and immunoassay: quantification of IGFBP-rP1 in human serum and distribution in human fluids and tissues. J. Clin. Endocrinol. Metab. 88, 3401e3408. Lorenzini, D.M., da Silva Jr., P.I., Fogaca, A.C., Bulet, P., Daffre, S., 2003. Acanthoscurrin: a novel glycine-rich antimicrobial peptide constitutively expressed in the hemocytes of the spider Acanthoscurria gomesiana. Dev. Comp. Immunol. 27, 781e791. Lorenzini, D.M., da Silva Jr., P.I., Soares, M.B., Arruda, P., Setubal, J., Daffre, S., 2006. Discovery of immune-related genes expressed in hemocytes of the tarantula spider Acanthoscurria gomesiana. Dev. Comp. Immunol. 30, 545e556. Marinaro, J.A., Casley, D.J., Bach, L.A., 2000a. O-glycosylation delays the clearance of human IGF-binding protein-6 from the circulation. Eur. J. Endocrinol. 142, 512e516. Marinaro, J.A., Neumann, G.M., Russo, V.C., Leeding, K.S., Bach, L.A., 2000b. O-glycosylation of insulin-like growth factor (IGF) binding protein-6 maintains high IGF-II binding affinity by decreasing binding to glycosaminoglycans and susceptibility to proteolysis. Eur. J. Biochem. 267, 5378e5386.

L. Kuhn-Nentwig et al. / Insect Biochemistry and Molecular Biology 41 (2011) 891e901 Mulenga, A., Khumthong, R., 2010. Silencing of three Amblyomma americanum (L.) insulin-like growth factor binding protein-related proteins prevents ticks from feeding to repletion. J. Exp. Biol. 213, 1153e1161. Murphy, M., Pykett, M.J., Harnish, P., Zang, K.D., George, D.L., 1993. Identification and characterization of genes differentially expressed in meningiomas. Cell. Growth Differ. 4, 715e722. Neumann, G.M., Marinaro, J.A., Bach, L.A., 1998. Identification of O-glycosylation sites and partial characterization of carbohydrate structure and disulfide linkages of human insulin-like growth factor binding protein 6. Biochemistry 37, 6572e6585. Oh, Y., Nagalla, S.R., Yamanaka, Y., Kim, H.S., Wilson, E., Rosenfeld, R.G., 1996. Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J. Biol. Chem. 271, 30322e30325. Osaki, T., Sasaki, K., Minamino, N., 2011. Peptidomics-based discovery of an antimicrobial peptide derived from insulin-like growth factor-binding protein 5. J. Proteome Res. 10, 1870e1880. Pereira, L.S., Silva Jr., P.I., Miranda, M.T., Almeida, I.C., Naoki, H., Konno, K., Daffre, S., 2007. Structural and biological characterization of one antibacterial acylpolyamine isolated from the hemocytes of the spider Acanthocurria gomesiana. Biochem. Biophys. Res. Commun. 352, 953e959. Qin, X., Strong, D.D., Baylink, D.J., Mohan, S., 1998. Structure-function analysis of the human insulin-like growth factor binding protein-4. J. Biol. Chem. 273, 23509e23516. Roller, L., Yamanaka, N., Watanabe, K., Daubnerová, I., Zitnan, D., Kataoka, H., Tanaka, Y., 2008. The unique evolution of neuropeptide genes in the silkworm Bombyx mori. Insect Biochem. Mol. Biol. 38, 1147e1157. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101e1108. Schneider, M., Wolf, E., Hoeflich, A., Lahm, H., 2002. IGF-binding protein-5: flexible player in the IGF system and effector on its own. J. Endocrinol. 172, 423e440. Seitz, K.A., 1971. Licht- und elektronenmikroskopische Untersuchungen zur Ovarentwicklung und Oogenese bei Cupiennius salei KEYS. (Araneae, Ctenidae). Z. Morph. Tiere 69, 283e317. Seitz, K.A., 1972a. Zur Histologie und Feinstruktur des Herzens und der Hämocyten von Cupiennius salei KEYS. (Araneae, Ctenidae). Zool. Jb. Anat. 89, 351e384.

901

Seitz, K.A., 1972b. Zur Histologie und Feinstruktur des Herzens und der Hämocyten von Cupiennius salei KEYS. (Araneae, Ctenidae). Zool. Jb. Anat. 89, 385e397. Seitz, K.A., 1976. Zur Feinstruktur der Häutungshämocyten von Cupiennius salei KEYS. (Araneae, Ctenidae). Zool. Jb. Anat. 96, 280e292. Silva Jr., P.I., Daffre, S., Bulet, P., 2000. Isolation and characterization of gomesin, an 18-residue cysteine-rich defense peptide from the spider Acanthoscurria gomesiana hemocytes with sequence similarities to horseshoe crab antimicrobial peptides of the tachyplesin family. J. Biol. Chem. 275, 33464e33470. Söderhäll, I., Bangyeekhun, E., Mayo, S., Söderhäll, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in hematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661e672. Söderhäll, K., Smith, V.J., 1983. Separation of the haemocyte populations of Carcinus maenas and other marine decapods, and prophenoloxidase distribution. Dev. Comp. Immunol. 7, 229e239. Ständker, L., Wobst, P., Mark, S., Forssmann, W.G., 1998. Isolation and characterization of circulating 13-kDa C-terminal fragments of human insulin-like growth factor binding protein-5. FEBS Lett. 441, 281e286. Theopold, U., Schmidt, O., Söderhäll, K., Dushay, M.S., 2004. Coagulation in arthropods: defence, wound closure and healing. Trends Immunol. 25, 289e294. Veenstra, J.A., 2010. What the loss of the hormone neuroparsin in the melanogaster subgroup of Drosophila can tell us about its function. Insect Biochem. Mol. Biol. 40, 354e361. Vilmos, P., Gaudenz, K., Hegedus, Z., Marsh, J.L., 2001. The twisted gastrulation family of proteins, together with the IGFBP and CCN families, comprise the TIC superfamily of cysteine rich secreted factors. Mol. Pathol. 54, 317e323. Weiss, I.M., Göhring, W., Fritz, M., Mann, K., 2001. Perlustrin, a Haliotis laevigata (Abalone) nacre protein, is homologous to the insulin-like growth factor binding protein N-terminal module of vertebrates. Biochem. Biophys. Res. Commun. 285, 244e249. Weiss, I.M., Kaufmann, S., Mann, K., Fritz, M., 2000. Purification and characterization of perlucin and perlustrin, two new proteins from the shell of the mollusc Haliotis laevigata. Biochem. Biophys. Res. Commun. 267, 17e21. Wilkinson, L., Kolle, G., Wen, D., Piper, M., Scott, J., Little, M., 2003. CRIM1 regulates the rate of processing and delivery of bone morphogenetic proteins to the cell surface. J. Biol. Chem. 278, 34181e34188.