- Email: [email protected]
Purification, characterization and end product analysis of dextran degrading endodextranase from Bacillus licheniformis KIBGE-IB25
International Journal of Biological Macromolecules 78 (2015) 243–248
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Purification, characterization and end product analysis of dextran degrading endodextranase from Bacillus licheniformis KIBGE-IB25 Rashida Rahmat Zohra a , Afsheen Aman a , Asma Ansari a , Muhammad Samee Haider b , Shah Ali Ul Qader a,∗ a b
The Karachi Institute of Biotechnology & Genetic Engineering (KIBGE), University of Karachi, Karachi 75270, Pakistan Food & Marine Resource Research Centre, Pakistan Council of Scientific & Industrial Research (PCSIR) Laboratories Complex, Karachi 75280, Pakistan
a r t i c l e
i n f o
Article history: Received 17 January 2015 Received in revised form 31 March 2015 Accepted 1 April 2015 Available online 13 April 2015 Keywords: Bacillus licheniformis Dextranase Enzyme purification Enzyme kinetics 6-alpha-d-glucan 6-glucanohydrolase
a b s t r a c t Degradation of high molecular weight dextran for obtaining low molecular weight dextran is based on the hydrolysis using chemical and enzymatic methods. Current research study focused on production, purification and characterization of dextranase from a newly isolated strain of Bacillus licheniformis KIBGE-IB25. Dextranase was purified up to 36 folds with specific activity of 1405 U/mg and molecular weight of 158 kDa. It was found that enzyme performs optimum cleavage of dextran (5000 Da, 0.5%) at 35 ◦ C in 15 min at pH 4.5 with a Km and Vmax of 0.374 mg/ml and 182 mol/min, respectively. Relative amino acid composition analysis of purified enzyme suggested the presence of higher number of hydrophobic, acidic and glycosylation promoting amino acids. The N-terminal sequence of dextranase KIBGE-IB25 was AYTVTLYLQG. It exhibited distinct amino acid sequence yet shared some inherent characteristics with glycosyl hydrolases (GH) family 49 and also testified the presence of O-glycosylation at N-terminal end. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Dextran is a complex, branched exopolysaccharide (homopolymer of d-glucose) produced by variety of organisms [1]. It is hydrolyzed in to different low molecular weight fractions of immense industrial importance by chemical and enzymatic methods [1–3]. Dextranase [E.C. 3.2.1.11] is a group of enzymes catalyzing the hydrolysis of ␣-1 → 6 glycosidic bond in dextran; generating glucose, isomaltose, isomaltotriose and various other linear or branched oligosaccharides. Among the hydrolytic products, isomaltooligosaccharides have prebiotic effect in humans and reduce the cariogenic effect of sucrose in oral cavity [4–6]. Commercial usage of dextran and its derivatives was initiated in 1944 in Sweden and since then these have been used worldwide in pharmaceutics, food, cosmetics, oral care and research products [1,7]. Apart from several optimistic industrial application of dextran, it also acts as a contaminant in sugar processing industry [8]. Various physical methods have been reported to remove contaminating dextran but these attempts increase the production cost and affect the economic feasibility of the project [9]. The most applicable method in
the sugar processing industry is the depolymerization of dextran using dextranase which decreases the viscosity of the solution and hence recovery of sugar is restored [1,10]. Dextranase are produced by a number of microorganisms which have different substrate utilization capability. Dextranases have been isolated from different origins using ammonium sulfate [11–13] and organic solvents [6,14] for partial purification and then a variety of chromatographic techniques have been employed for their final purification to homogeneity. Keeping in view the utility of dextranases, current study is focused on purification and characterization of kinetic parameters, relative amino acid composition and N-terminal sequencing of a dextranolytic enzyme from Bacillus licheniformis KIBGE-IB25. Elucidation of these parameters will not only lead to better understanding of its structure and physico-chemical properties but it will also help in improving the commercial utility of the enzyme in various industrial processes.
2. Materials and methods 2.1. Bacterial culture
∗ Corresponding author. Tel.: +92 3212160109. E-mail address: ali [email protected] (S.A.U. Qader). http://dx.doi.org/10.1016/j.ijbiomac.2015.04.007 0141-8130/© 2015 Elsevier B.V. All rights reserved.
Bacterial culture used for dextranase production was isolated from decayed sugar cane chunks obtained from the field. Strain
244
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
was tentatively characterized as Bacillus licheniformis KIBGE-IB25 by studying the biochemical and morphological characters [15]. Phylogeny of the bacterium was confirmed by 16S rDNA analysis following the protocol described earlier [16]. Quantified genomic DNA was amplified by PCR using universal primers (forward primer: GAGTTTGATCCTGGCTCA; reverse primer: AGAAAGGAGGTGATCCAGCC) and the amplified product (1.5 kb) obtained was purified by using PCR purification kit (Bioneer, USA) and nucleotide sequencing was performed. For enhanced extracellular dextranase production, strain was improved by random mutagenesis using UV rays producing seven times higher dextranase as compared to wild. Stock culture was stored at −20 ◦ C in nutrient broth containing 15% glycerol whereas working culture was maintained over nutrient agar slant at 4 ◦ C. 2.2. Dextranase production Bacterium was cultured in medium reported earlier, containing (g/L) dextran T50 (5000 Da) 10.0, yeast extract 1.0, peptone 10.0, K2 HPO4 1.0, MgSO4 ·7H2 O 0.2 and NaCl 3.0; at pH 6.0 [15]. Cell free fluid (CFF) was obtained by centrifugation of cultured fluid at 40,000 × g for 30 min at 4 ◦ C and kept at −20 ◦ C until processed for enzyme purification. Enzyme activity was measured by reported method [17] and one unit of dextranase is defined as the amount of enzyme required to catalyze the formation of 1.0 mol of maltotriose at standard assay conditions (35 ◦ C, 0.1 M citrate phosphate buffer, pH 4.5, 15 min). Total protein of sample was calculated by the method of using bovine serum albumin as standard [18]. 2.3. Dextranase purification 2.3.1. Precipitation and desalting of crude dextranase Dextranase was precipitated from cell free fluid using ammonium sulfate. Precipitant was added gradually in cell free fluid; allowing it to dissolve completely and kept on magnetic stirrer for 15–20 min. After complete dissolution of precipitant, it was refrigerated overnight. Precipitated protein was removed from the mixture by centrifugation at 35,000 × g for 10 min and dissolved in 0.1 M citrate phosphate buffer (pH 6.0). For gradient precipitation, precipitant was repeatedly added to the supernatant in the increment batches of 10% each time until it reached 80% saturation. Precipitates were collected after each precipitation and enzyme activity and total protein content was estimated using standard assay procedures. Partially purified dextranase was desalted using PD-10 prepacked desalting column (GE healthcare, UK) containing Sephadex G-25. Column was equilibrated by washing it extensively with 0.1 M citrate phosphate buffer at pH 6.0 and 2.5 ml sample was loaded and centrifuged at 700 × g at 4 ◦ C for 5 min. Eluent was checked for enzyme activity and total protein content and stored at −20 ◦ C for further purification. 2.3.2. Ultrafiltration of partially purified dextranase Millipore ultra-filtration unit Centricon Ultracel YM-10 (cut off 10 kDa) was used for ultra-filtration of dextranase sample. Sample (2.5 ml) was loaded each time and centrifuged at 3000 × g at 4 ◦ C until sample was concentrated to a desired volume. 2.3.3. Gel permeation chromatography Dextranase sample (1.0 ml) obtained after ultrafiltration was loaded on Sepharose CL6B (GE Healthcare Bio-Sciences AB, Sweden) column (1.5 × 55 cm) integrated with gel permeation chromatography system (Econo pump EP-1, Bio-Rad, USA). Before loading the sample, gel was equilibrated with 0.1 M citrate phosphate buffer (pH 6.0). Sample was eluted with flow rate of 1.0 ml/min and
fractions of 2.0 ml were collected using automated fraction collector (2110 Fraction collector, Bio-Rad, USA). Fractions containing enzyme activity were pooled and concentrated using Centricon Ultracel YM-10 (Millipore) 10 kDa filter membrane. 2.4. Dextranase characterization 2.4.1. Molecular weight estimation Concentrated enzyme fraction obtained after purification was assessed for enzyme purity and molecular weight using 10% polyacrylamide gel electrophoresis (PAGE) [19]. Glycoprotein staining of purified dextranase was performed using periodic acid Schiff’s staining method [20,21]. 2.4.2. Relative amino acid composition analysis and N-terminal sequencing Relative amino acid content of purified dextranase was processed on Amino Acid Analyzer (Shimadzu LC -10A/C - R7A, USA). For the sequencing of N-terminal portion of dextranase, the sample was loaded on PAGE and blotted to polyvinylidene difluoride membrane (PVDF) using semi-dry electro blotter (Owl Separation systems) [22] and sequencing was performed by Alta Biosciences, University of Birmingham, UK. 2.5. Kinetic parameters analysis 2.5.1. Effect of pH and temperature on enzyme activity Dextran T50 (0.5%) was dissolved in different buffering solutions (0.1 M) including glycine–HCl (pH: 2.0–4.0), citrate phosphate (pH: 4.0–6.0), sodium phosphate (pH: 6.0–8.0). Enzyme activity was performed using standard assay procedure. To determine optimum temperature for enzyme catalysis, enzyme–substrate reaction mixture (0.5% dextran T50, 0.1 M citrate phosphate buffer pH 4.5, 15 min) was carried out at different temperatures between 25 and 75 ◦ C. 2.5.2. Effect of ionic strength of buffer on enzyme activity After selection of suitable buffer, molarity of citrate phosphate buffer was varied from 0.025 to 0.25 M keeping pH constant at 4.5. Substrate (0.5%) for enzyme activity was dissolved in each buffer solution separately and subjected to estimation of enzyme activity according to standard assay procedure. 2.5.3. Optimal reaction time for enzyme catalysis For investigation of optimum time required for enzyme–substrate reaction, reaction mixture was kept at standard assay conditions for up to 1 h and enzyme activity was calculated after a regular interval of 15 min. Optimum time for reaction was estimated based on amount of reducing sugar liberated in that specific time duration. 2.5.4. Substrate selection, Km , Vmax of the reaction Optimal substrate and its concentration for enzyme catalysis was investigated by using different molecular weight dextrans (dextran T50: 5000 Da; dextran T100: 10,000 Da; dextran T700: 70,000 Da) in a range of 0.001–0.01 mg/ml. Dextran T50 was selected and dissolved in 0.1 M citrate phosphate buffer (pH 4.5) at varying percentages to calculate initial velocity of reaction. The Michaelis–Menten constant (Km ) and maximum velocity of reaction Vmax were determined by Lineweaver–Burk plot [23]. 2.5.5. End product analysis Reaction end products were analyzed by a modified thin layer chromatography method [24,25]. Enzyme–substrate reaction mixture was prepared in a ratio of 1:2 and subjected to hydrolysis for
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
Fig. 1. Phylogenetic tree of Bacillus licheniformis KIBGE-IB25.
15 min at standard assay conditions. Reaction mixture was spotted on Silica gel plates (Sigma) using glass capillary tube. Maltose, maltotriose, maltopentose, maltoheptose and dextran T50 were spotted as standards (2.0% w/v in distilled water). Plate was placed in a TLC chamber containing n-butanol:acetic acid:water in a ratio of 5:3:1 (v/v/v) at room temperature. As the solvent front reached the top edge of plate, it was removed from chamber and air dried. Plate was sprayed with 20% H2 SO4 , dried and kept at 110 ◦ C for 10 min. 3. Results and discussion 3.1. 16S rDNA analysis Bacterial strain tentatively characterized as Bacillus licheniformis KIBGE-IB25 was confirmed by 16S rDNA analysis. Nucleotide sequence of 16S rDNA was compared with other related Bacillus species sequences using BLAST (http://blast.ncbi.nlm.nih.gov/ Blast.cgi). After multiple alignment it was found that the sequence is novel and showed similarity to Bacillus licheniformis. Sequence was deposited in GenBank database and received accession number KC465402. Phylogenetic and molecular evolutionary analysis was conducted using MEGA version 4 software [26] (Fig. 1). 3.2. Dextranase purification 3.2.1. Precipitation and desalting From gradient precipitation, 30% ammonium sulfate showed maximum enzyme precipitation from cell free fluid resulting in specific activity of 34.0 U/mg. However, enzyme was reversibly denatured during salt precipitation. It was reported that 80% ammonium sulfate resulted in 90% yield of a thermostable dextranase from thermophilic bacterium [13]. Sephadex G-25 pre-packed column was used to desalt the enzymatic fraction obtained after precipitation which resulted in 2 folds purification and increased specific activity of enzyme. 3.2.2. Ultrafiltration Prior loading the sample on gel permeation column, it was ultrafiltrated using Centricon Ultracel YM-10 (Millipore) 10 kDa filter membrane to remove any low molecular weight interfering proteins. Enzyme activity and total protein was estimated according to standard assay procedure and it was found that enzyme retained 100% of its activity in retenate and purified up to 4 folds. 3.2.3. Size exclusion chromatography The final step purification was approximately 36 folds (Table 1). Purified dextranase was analyzed using PAGE (Fig. 2). Ion exchange chromatography using DEAE-Sepharose was employed which successfully resulted in 733 fold purification [6]. Previously, Sephacryl
245
Fig. 2. Purified dextranase from Bacillus licheniformis KIBGE-IB25 on PAGE. Lane 1: BSA marker (Sigma); lane 2: Coomassie stained dextranase; lane 3: Schiff’s stained dextranase for glycoprotein analysis.
S-300 was successfully employed for the purification of a thermostable dextranase resulting in 25 purification fold [13]. Other chromatographic methods have also been attempted resulting in purification factor ranging from 4 to 925 folds [27,28]. 3.3. Characterization of dextranase 3.3.1. Molecular weight estimation Native PAGE analysis of purified dextranase from Bacillus licheniformis KIBGE-IB25 showed a single polypeptide band of 158 kDa (Fig. 2). In situ dextranolytic activity was studied using various concentrations of blue dextran which was incorporated during the polymerization of the gel. However, none of the trials led to appearance of hydrolytic zone although the protein fraction before loading was assessed for enzyme activity using Nelson Somogyi’s assay [17] and found to have catalytic activity. This could be attributed to pH shift during electrophoresis which might have distorted the structural conformation hence rendering inactive enzyme [29]. Dextranases are known to be glycosylated during post translational modification [30], therefore native PAGE gel was stained specifically for detection of glycosylation. Magenta bands of purified dextranase were seen against light pink background, confirming the dextranase to be a glycoprotein. Penicillium minioluteum dextranase is the most extensively studied dextranase which contain 10–12% carbohydrate as N-terminal glycosylation [31]. It was noted that three potential sites for glycosylation and differences in oligosaccharides secreted along with native and recombinant dextranase when P. minioluteum dextranase was expressed in Pichia pastoris [32]. Larsson et al. studied the structure of P. minioluteum and reported glycosylation at N5, N537 and N540 [33]. 3.3.2. Relative amino acid composition analysis Relative percentage of each amino acid present in KIBGE-IB25 dextranase is shown in Table 2. It largely consists of residues with hydrophobic side chains like methionine (15.6%), leucine (19.1%), isoleucine (3.6%) and others alike. Among the charged residues, it consists of 5.13% negatively charged amino acids and only 2.5% positively charged amino acids which indicated that the protein may have low isoelectric point. It also contains approximately 3% of serine and threonine residues which might be providing site for O-glycosylation of dextranase during the post translational modification [30]. Among all residues, tyrosine and glycine showed highest relative percentage to be precise 21.8 and 21.8%, respectively. 3.3.3. N-terminal amino acid sequencing Sequence analysis of N-terminus of KIBGE-IB25 dextranase revealed unique pattern and showed no significant homology
246
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
Table 1 Purification chart of dextranase from Bacillus licheniformis KIBGE-IB25. Steps
Total enzyme activity (U)
Total protein (mg)
Specific activity (U/mg)
Purification (fold)
Yield (%)
Crude enzyme Salt precipitation Desalting Ultrafiltration Gel permeation chromatography
2.36 × 105 5.670 × 103 1.1754 × 104 1.170 × 104 5.620 × 103
6000 168 175 75 4
39 34 67 156 1405
1 1 2 4 36
100 3 5 5 2
Table 2 Relative amino acid composition of purified dextranase from Bacillus licheniformis KIBGE-IB25. Amino acid
Molar ratio (%)
Amino acid
Molar ratio (%)
Alanine Arginine Aspartic acid Asparagine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine
4.64 0.76 1.15 – 2.84 3.98 – 21.84 0.49 3.65
Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine
9.17 1.22 15.0 – 9.54 1.28 1.71 – 21.82 0.92
“–” represents amino acids which could not be detected due to acid hydrolysis or conversion to some other form during the analytical procedure.
with N-terminal region of other known dextranases (Table 3). The N-terminal sequence of dextranase obtained from Bacillus licheniformis KIBGE-IB25 though exhibits a unique sequence, however there are certain inherent characteristics which it shares with family 49 glycolsyl hydrolases (GH49). First and foremost is the presence of alanine as the first N-terminal amino acid which is a common character of family GH 49 enzymes. In comparison to an endodextranase of a Bacillus spices, 1st and 3rd amino acid namely alanine and threonine are at identical positions [6]. However, in the current study this alanine–valine pair was not observed. It is possible that during the UV-mutagenesis, the end terminal portion may have mutated. However, this could only be confirmed by dextranase gene sequencing. Comparison of mutated and wild strain N-terminal region was not possible as dextranase production from wild strain was insufficient to lead to complete purification of the enzyme. From relative amino acid composition analysis it was suggested that the dextranase from KIBGE-IB25 could be O-glycosylated due to higher content of serine, threonine and tyrosine. Purified dextranase was subjected to periodic Schiff’s staining method and the technique was found to validate the presence of glycosylation (Fig. 2). It has now been confirmed that dextranase is O-glycosylated as it contains two threonine and two tyrosine residues at 2nd, 3rd, 5th and 7th positions among the 10 amino acid sequence of N-terminal region.
Table 3 N-terminal amino acid sequence of dextranase from Bacillus licheniformis KIBGEIB25. Organism
N-terminal amino acid sequence
Reference
Bacillus licheniformis KIBGE-IB25 Bacillus species Lipomyces starkeyi (NCYC 1436) dex1 Lipomyces starkeyi (NCYC 1436) dex2 Lipomyces starkeyi
AYTVTLYLQG
Current study
ASTGL AVNDNDEISSSQQ/P
[6] [30]
AVVLPID/GIVS/-V
[30]
AAVLPRDNRTV
[60]
3.4. Kinetic parameters analysis 3.4.1. Effect of pH on enzyme activity Dextranase from Bacillus licheniformis KIBGE-IB25 exhibited comparatively higher activity in a pH range of 4.0–5.0 and upon further experimentation, citrate phosphate buffer (pH 4.5) was found to be the most suitable buffering solution (Fig. 3A). It was reported that Penicillium minioluteum dextranase expressed in Pichia pastoris showed conformational stability in acidic pH and optimally cleaved the substrate at 4.5–5.0 pH values. However, it lost complete activity at neutral pH due to distortion in structural conformation [31]. Kim and Kim reported that lowest pH optimum of thermostable dextranases from Thermotoga lettingae is 4.3 [34], whereas optimum pH of a dextranase produced by a Bacillus species was reported around 6.8 [6]. 3.4.2. Effect of ionic strength of buffer on enzyme activity Variation in the molarity of citrate phosphate buffer revealed that the maximum catalytic activity by KIBGE-IB25 dextranase was found at 0.1 M (Fig. 3B). According to Ugwu and Apte [35] buffers cast substantial effects on the tertiary and quaternary structures of proteins. Usually dextranases prefer acidic pH for optimal activity and operational stability and it was reported that maximum enzyme activity was found in acetate buffer (0.02 M) and citrate buffer (0.1 M) for dextranases from Thermotoga lettingae and Paenibacillus species, respectively [34,36]. For optimal activity of several dextranolytic species like Hypocrea lixii, Lipomyces starkeyi and Streptomyces anulatus, sodium acetate buffer 0.02 M (pH 5.5), 0.05 M (pH 5.5) and 0.05 M (pH 0–5.4) were used, respectively [37,38]. 3.4.3. Optimal reaction time for enzyme catalysis When enzyme was reacted with substrate for different time intervals, highest enzyme activity was achieved at 15 min at 35 ◦ C using dextran T50 (Fig. 3C). It was reported that dextranases from different Penicillium strains required 10 min reaction time for optimum enzyme activity at 40–50 ◦ C [30,40,41]. On the contrary, a research study on dextranase from Streptomyces anulatus reported 60 min reaction time for maximum enzyme activity at 20 ◦ C using clinical grade dextran (40 kDa) as a substrate. Dextranase being produced by a variety of species, exhibits diversified reaction properties and it has been reported that dextranase performs substrate cleavage in 10 min to 24 h at 20–30 ◦ C [14,38]. 3.4.4. Effect of incubation temperature on enzyme activity Thermal inactivation of proteins specially the enzymes is one of the major physical factors adversely affecting the enzyme activity in industrial processes. Effect of various temperatures on dextranase activity was investigated and it was found that dextranase from KIBGE-IB25 exhibited optimum enzyme activity at 35 ◦ C (Fig. 3D). Most of the studies on dextranases have reported a broad temperature range from 25 to 75 ◦ C for enzyme activity [42–45]. Streptococcus ratti exhibited approximately 50% of maximal activity at 30 ◦ C whereas a drastic lost in activity was seen above 45 ◦ C [44]. A cold active dextranase from Streptomyces anulatus has demonstrated 40% activity at 4 ◦ C, whereas another organism of same
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
247
Fig. 3. Analysis of kinetic parameters of dextranase from Bacillus licheniformis KIBGE-IB25. (A) Optimum pH selection (glycine–HCl buffer pH 2.0–4.0; citrate phosphate buffer pH 4.0–6.0; sodium phosphate buffer pH 6.0–8.0 at 0.1 M concentrations). (B) Optimum ionic strength of buffer (0.5% dextran T50 in citrate phosphate buffer at 35 ◦ C, 15 min). (C) Optimum reaction time (0.5% dextran T50 in 0.1 M citrate phosphate buffer at 35 ◦ C). (D) Optimum temperature for enzyme reaction (0.5% dextran T50 in 0.1 M citrate phosphate buffer pH 4.5, 35 ◦ C, 15 min).
specie retained 50% of its optimal activity in a range between 30 and 75 ◦ C [38,46]. 3.4.5. Substrate selection, Km and Vmax of the reaction When various molecular weight dextrans were subjected to hydrolysis by dextranase, it was found that the enzyme showed maximum degradation of dextran T50 as compared to other high molecular weight dextrans (Fig. 4). Effect of substrate concentration on rate of the reaction was evaluated by varying substrate concentration from 1.0 to 15.0 mg/ml using Dextran T50. Michaelis constant (Km ) and maximum velocity (Vmax ) were calculated from
Fig. 4. Substrate preference of dextranase from Bacillus licheniformis KIBGE-IB25 (0.1 M citrate phosphate buffer pH 4.5, 35 ◦ C, 15 min).
Lineweaver–Burk plot and it was found that Km and Vmax values were 0.374 mg/ml and 182 mol/min, respectively. It was reported earlier that using different molecular weight dextrans, 1 mg of dextranase exhibited Km value of 2.64 mg/ml and Vmax of 436 mol/min [39]. Whereas, when different molecular weight dextrans were used, dextranase from Paecilomyces lilacinus did not exhibit considerable variation in Km and Vmax values [47]. Comparing the dextranase produced by Bacillus licheniformis KIBGE-IB25 with a higher dextranase producing strain of P. lilacinum (UV and chemically mutated strain); KIBGE-IB25 dextranase had 15.5% more affinity towards its substrate [29]. 3.4.6. End product analysis End products generated by enzymatic action of dextranase were analyzed using thin layer chromatography with the modification of two methods [24,25]. As a result of enzymatic degradation dextran was cleaved into lower molecular weight fractions including maltooligosaccharides (malto-heptotriose, hexotriose, pentotriose) and maltotriose (Fig. 5). Absence of glucose residues suggested that the mode of action of KIBGE-IB25 dextranase is endolytic. Numerous oligosaccharides exhibits different biological functions and among them isomaltooligosaccharides which are produced by the endolytic action of dextranases is of highly commercial interest as a prebiotic [48]. Various research studies on Aspergillus, Fusarium, Chaetomium and Penicillium species have reported that higher amount of isomaltooligosaccharides, isomalto-triose-tetrose-pentose-hexose and comparatively low amount of glucose is generated by the action of endodextranases [49–52]. Among the bacterial species; Paenibacillus illinoisensis produced isomaltooligosaccharides, isomaltotriose and glucose
248
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248 [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]
Fig. 5. Thin layer chromatogram of end products produced after dextranase reaction (0.5% dextran T50 in 0.1 M citrate phosphate buffer at 35 ◦ C). Standard solutions of 2.0% w/v in distilled water. S: dextran T50; G: glucose; IM: isomaltose; IM3: isomaltotriose; IM5: isomaltopentose; IM7: isomaltoheptose; ES: enzyme solution; EP: reaction end products.
residues from the cleavage of dextran T500 [6,53], whereas Streptococcus sp. [54], Flavobacterium sp. [55] and Streptomyces anulatus [38] predominantly generate isomaltotriose as end products. Use of dextransucrase and fusion enzymes having catalytic properties of both; dextransucrase and dextranase have also been reported for the production of maltooligosaccharides [56–59]. 4. Conclusion Bacillus licheniformis KIBGE-IB25 strain producing high amounts of endodextranase was cultured and the enzyme was purified to near-homogeneity. The enzyme had a molecular weight of 158 kDa and the pH optima was around 4.5. The relative amino acid composition and N-terminal amino acid sequence showed that the enzyme is novel. Owing to the nonpathogenic nature of the producer strain, the enzyme is suitable for various commercial applications. Conflict of interest
[19] [20] [21] [22] [23] [24] [25]
[26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47]
The authors declare that no conflict of interest exists. [48]
Acknowledgement This research was funded and supported by The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Pakistan. References [1] E. Khalikova, P. Susi, T. Korpela, Microbiol. Mol. Biol. Rev. 69 (2005) 306–325. [2] P.J. Baker Jr., in: R.L. Whistler, J.N. Bemiller (Eds.), Industrial Gums: Polysaccharides and their Derivatives, Academic Press, New York, 1959, pp. 531–563. [3] G.J. Walker, in: D.J. Manners (Ed.), International Review of Biochemistry, University Park Press, Baltimore, MD, 1978. [4] R.G. Crittenden, M.J. Plaune, Trends Food Sci. Technol. 7 (1996) 353–361. [5] K.C. Mountzouris, S.G. Gilmour, R.A. Rastall, J. Food Sci. 675 (2001) 1767–1771.
[49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60]
E. Khalikova, P. Susi, N. Usanov, T. Korpela, J. Chromatogr. B 796 (2003) 315–326. A. Jeanes, ACS Symp. Ser. 45 (1977) 284–298. G. Eggleston, A. Monge, B. Montes, D. Steward, Int. Sugar J. 108 (2006) 528–537. E.R. Jiménez, Biotechnol. Appl. 22 (2005) 20–27. G. Eggleston, A. Monge, B. Montes, D. Steward, Int. Sugar J. 109 (2007) 757–764. N. Hiraoka, J. Fukumoto, D. Tsuru, J. Biochem. 71 (1972) 57–64. D.K. Das, S.K. Dutta, Int. J. Biochem. Cell Biol. 28 (1996) 107–113. C.V.A. Wynter, M. Chang, J. De Jersey, B. Patel, P.A. Inkerman, S. Hamilton, Enzyme Microb. Technol. 20 (1997) 242–247. E. Shimizu, T. Unno, M. Ohba, G. Okada, Biosci. Biotechnol. Biochem. 62 (1998) 117–122. R.R. Zohra, A. Aman, R.R. Zohra, A. Ansari, M. Ghani, S.A. Qader, Carbohydr. Polym. 92 (2013) 2149–2153. A. Ansari, A. Aman, N.N. Siddiqui, S. Iqbal, S.A. Qader, Pak. J. Pharm. Sci. 25 (2012) 195–201. N. Nelson, J. Biol. Chem. 153 (1944) 375–380. O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1951) 265–275. U.K. Laemmli, Nature 227 (1970) 680–685. S.M. Holt, H. Al-Sheikh, K.J. Shin, Lett. Appl. Microbiol. 32 (2001) 185–189. D. Kothari, A. Tyagi, S. Patel, A. Goyal, Biotech 1 (2011) 199–205. P. Matsudaira, J. Biol. Chem. 262 (1987) 10035–10038. H. Lineweaver, D. Burk, J. Am. Chem. Soc. 56 (1934) 658–666. R.K. Gill, J.A. Kaur, J. Ind. Microbiol. Biotechnol. 31 (2004) 540–543. M.S. Kim, J.T. Park, Y.W. Kim, H.S. Lee, R. Nyawira, H.S. Shin, C.S. Park, S.H. Yoo, Y.R. Kim, T.W. Moon, K.H. Park, Appl. Environ. Microbiol. 70 (2004) 3933–3940. K. Tamura, J. Dudley, M. Nei, S. Kumar, Mol. Biol. Evol. 24 (2007) 1596–1599. J. Fukumoto, H. Tsuji, D. Tsuru, J. Biochem. 69 (1971) 1113–1121. L. Linder, M.L. Sund, Caries Res. 15 (1981) 436–444. M.A. Shams, A.A. Kheyr, M.D. Farshbaf, Sci. Iran 9 (2002) 39–46. S.H. Millson, I.H. Evans, Antonie Van Leeuwenhoek 92 (2007) 399–404. A. Beldarraín, N. Acosta, L. Betancourt, L.J. González, T. Pons, Biotechnol. Appl. Biochem. 38 (2003) 211–221. L.H. Betancourt, R. García, J. González, R. Montesino, O. Quintero, T. Takao, Y. Shimonishi, J.A. Cremata, FEMS Yeast Res. 1 (2001) 151–160. A.M. Larsson, R. Andersson, J. Stahlberg, L. Kenne, T.A. Jones, Structure 11 (2003) 1111–1121. Y.M. Kim, D. Kim, Appl. Microbiol. Biotechnol. 85 (2010) 581–587. S.O. Ugwu, S.P. Apte, Pharm. Technol. 28 (2004) 86–113. P.M. Finnegan, S.M. Brumbley, M.G. O’Shea, K.M.H. Nevalainen, P.L. Bergquist, Curr. Microbiol. 49 (2004) 327–333. D.W. Koenig, D.F. Day, Appl. Environ. Microbiol. 55 (1989) 2079–2081. A.R.D. Mahmoud, A.W. Helmy, Aust. J. Basic Appl. Sci. 3 (2009) 3808–3817. D.T. Wu, H.B. Zhang, L.J. Huang, X.Q. Hu, Process Biochem. 46 (2011) 1942–1950. M.A. Abdel-Naby, A.M.S. Ismail, A.M. Abdel-Fattah, A.F. Abdel-Fattah, Process Biochem. 34 (1999) 391–398. M.S.A. Abdel-Aziz, F.N. Talkhan, J.C. Janson, J. Appl. Sci. Res. 3 (2007) 1509–1516. W.N. Arnold, T.B.P. Nguyen, L.C. Mann, Arch. Microbiol. 170 (1998) 91–98. F. Hoster, R. Daniel, G. Gottschalk, J. Gen. Appl. Microbiol. 47 (2001) 187–192. T. Igarashi, H. Morisaki, N. Goto, Microbiol. Immunol. 48 (2004) 155–162. F.A. Erhardt, H.J. Jördening, J. Biotech. 131 (2007) 440–447. S.R. Decker, W.S. Adney, T.B. Vinzant, M.E. Himmel, US Patent 6509184 B1 (2003). A. Galvez-Mariscal, A. Lopez-Munguia, Appl. Microbiol. Biotechnol. 36 (1991) 327–331. K. Swennen, C.M. Courtin, J.A. Delcour, Crit. Rev. Food Sci. Nutr. 46 (2006) 459–471. D. Tsuru, N. Hiraoka, J. Fukumoto, J. Biochem. 71 (1972) 653–660. M. Sugiura, A. Ito, Chem. Pharm. Bull. (Tokyo) 22 (1974) 1593–1599. L.G. Simonson, A.E. Liberta, A. Richardson, Appl. Microbiol. 30 (1975) 855–861. A. Hattori, K. Ishibashi, S. Minato, Agric. Biol. Chem. 25 (1981) 2409–2416. E.F. Khalikova, N.G. Usanov, Appl. Biochem. Microbiol. 38 (2002) 89–93. A. Pulkownik, G.J. Walker, Carbohydr. Res. 54 (1977) 237–251. M. Kobayashi, S. Takagi, M. Shiota, Y. Mitsuishi, K. Matsuda, Agric. Biol. Chem. 47 (1983) 2585–2593. J.F. Robyt, T.F. Walseth, Carbohydr. Res. 61 (1978) 433–445. D. Kim, D.F. Day, Enzyme Microb. Technol. 16 (1994) 844–848. A.K. Goulas, D.A. Fisher, G.K. Grimble, A.S. Grandison, R.A. Rastall, Enzyme Microb. Technol. 35 (2004) 327–338. A.K. Goulas, J.M. Cooper, A.S. Grandison, R.A. Rastall, Biotechnol. Bioeng. 88 (2004) 778–787. H.K. Kang, S.H. Kim, J.Y. Park, X.J. Jin, D.K. Oh, S.S. Kang, D. Kim, Yeast 22 (2005) 1239–1248.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Purification, characterization and end product analysis of dextran degrading endodextranase from Bacillus licheniformis KIBGE-IB25 Rashida Rahmat Zohra a , Afsheen Aman a , Asma Ansari a , Muhammad Samee Haider b , Shah Ali Ul Qader a,∗ a b
The Karachi Institute of Biotechnology & Genetic Engineering (KIBGE), University of Karachi, Karachi 75270, Pakistan Food & Marine Resource Research Centre, Pakistan Council of Scientific & Industrial Research (PCSIR) Laboratories Complex, Karachi 75280, Pakistan
a r t i c l e
i n f o
Article history: Received 17 January 2015 Received in revised form 31 March 2015 Accepted 1 April 2015 Available online 13 April 2015 Keywords: Bacillus licheniformis Dextranase Enzyme purification Enzyme kinetics 6-alpha-d-glucan 6-glucanohydrolase
a b s t r a c t Degradation of high molecular weight dextran for obtaining low molecular weight dextran is based on the hydrolysis using chemical and enzymatic methods. Current research study focused on production, purification and characterization of dextranase from a newly isolated strain of Bacillus licheniformis KIBGE-IB25. Dextranase was purified up to 36 folds with specific activity of 1405 U/mg and molecular weight of 158 kDa. It was found that enzyme performs optimum cleavage of dextran (5000 Da, 0.5%) at 35 ◦ C in 15 min at pH 4.5 with a Km and Vmax of 0.374 mg/ml and 182 mol/min, respectively. Relative amino acid composition analysis of purified enzyme suggested the presence of higher number of hydrophobic, acidic and glycosylation promoting amino acids. The N-terminal sequence of dextranase KIBGE-IB25 was AYTVTLYLQG. It exhibited distinct amino acid sequence yet shared some inherent characteristics with glycosyl hydrolases (GH) family 49 and also testified the presence of O-glycosylation at N-terminal end. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Dextran is a complex, branched exopolysaccharide (homopolymer of d-glucose) produced by variety of organisms [1]. It is hydrolyzed in to different low molecular weight fractions of immense industrial importance by chemical and enzymatic methods [1–3]. Dextranase [E.C. 3.2.1.11] is a group of enzymes catalyzing the hydrolysis of ␣-1 → 6 glycosidic bond in dextran; generating glucose, isomaltose, isomaltotriose and various other linear or branched oligosaccharides. Among the hydrolytic products, isomaltooligosaccharides have prebiotic effect in humans and reduce the cariogenic effect of sucrose in oral cavity [4–6]. Commercial usage of dextran and its derivatives was initiated in 1944 in Sweden and since then these have been used worldwide in pharmaceutics, food, cosmetics, oral care and research products [1,7]. Apart from several optimistic industrial application of dextran, it also acts as a contaminant in sugar processing industry [8]. Various physical methods have been reported to remove contaminating dextran but these attempts increase the production cost and affect the economic feasibility of the project [9]. The most applicable method in
the sugar processing industry is the depolymerization of dextran using dextranase which decreases the viscosity of the solution and hence recovery of sugar is restored [1,10]. Dextranase are produced by a number of microorganisms which have different substrate utilization capability. Dextranases have been isolated from different origins using ammonium sulfate [11–13] and organic solvents [6,14] for partial purification and then a variety of chromatographic techniques have been employed for their final purification to homogeneity. Keeping in view the utility of dextranases, current study is focused on purification and characterization of kinetic parameters, relative amino acid composition and N-terminal sequencing of a dextranolytic enzyme from Bacillus licheniformis KIBGE-IB25. Elucidation of these parameters will not only lead to better understanding of its structure and physico-chemical properties but it will also help in improving the commercial utility of the enzyme in various industrial processes.
2. Materials and methods 2.1. Bacterial culture
∗ Corresponding author. Tel.: +92 3212160109. E-mail address: ali [email protected] (S.A.U. Qader). http://dx.doi.org/10.1016/j.ijbiomac.2015.04.007 0141-8130/© 2015 Elsevier B.V. All rights reserved.
Bacterial culture used for dextranase production was isolated from decayed sugar cane chunks obtained from the field. Strain
244
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
was tentatively characterized as Bacillus licheniformis KIBGE-IB25 by studying the biochemical and morphological characters [15]. Phylogeny of the bacterium was confirmed by 16S rDNA analysis following the protocol described earlier [16]. Quantified genomic DNA was amplified by PCR using universal primers (forward primer: GAGTTTGATCCTGGCTCA; reverse primer: AGAAAGGAGGTGATCCAGCC) and the amplified product (1.5 kb) obtained was purified by using PCR purification kit (Bioneer, USA) and nucleotide sequencing was performed. For enhanced extracellular dextranase production, strain was improved by random mutagenesis using UV rays producing seven times higher dextranase as compared to wild. Stock culture was stored at −20 ◦ C in nutrient broth containing 15% glycerol whereas working culture was maintained over nutrient agar slant at 4 ◦ C. 2.2. Dextranase production Bacterium was cultured in medium reported earlier, containing (g/L) dextran T50 (5000 Da) 10.0, yeast extract 1.0, peptone 10.0, K2 HPO4 1.0, MgSO4 ·7H2 O 0.2 and NaCl 3.0; at pH 6.0 [15]. Cell free fluid (CFF) was obtained by centrifugation of cultured fluid at 40,000 × g for 30 min at 4 ◦ C and kept at −20 ◦ C until processed for enzyme purification. Enzyme activity was measured by reported method [17] and one unit of dextranase is defined as the amount of enzyme required to catalyze the formation of 1.0 mol of maltotriose at standard assay conditions (35 ◦ C, 0.1 M citrate phosphate buffer, pH 4.5, 15 min). Total protein of sample was calculated by the method of using bovine serum albumin as standard [18]. 2.3. Dextranase purification 2.3.1. Precipitation and desalting of crude dextranase Dextranase was precipitated from cell free fluid using ammonium sulfate. Precipitant was added gradually in cell free fluid; allowing it to dissolve completely and kept on magnetic stirrer for 15–20 min. After complete dissolution of precipitant, it was refrigerated overnight. Precipitated protein was removed from the mixture by centrifugation at 35,000 × g for 10 min and dissolved in 0.1 M citrate phosphate buffer (pH 6.0). For gradient precipitation, precipitant was repeatedly added to the supernatant in the increment batches of 10% each time until it reached 80% saturation. Precipitates were collected after each precipitation and enzyme activity and total protein content was estimated using standard assay procedures. Partially purified dextranase was desalted using PD-10 prepacked desalting column (GE healthcare, UK) containing Sephadex G-25. Column was equilibrated by washing it extensively with 0.1 M citrate phosphate buffer at pH 6.0 and 2.5 ml sample was loaded and centrifuged at 700 × g at 4 ◦ C for 5 min. Eluent was checked for enzyme activity and total protein content and stored at −20 ◦ C for further purification. 2.3.2. Ultrafiltration of partially purified dextranase Millipore ultra-filtration unit Centricon Ultracel YM-10 (cut off 10 kDa) was used for ultra-filtration of dextranase sample. Sample (2.5 ml) was loaded each time and centrifuged at 3000 × g at 4 ◦ C until sample was concentrated to a desired volume. 2.3.3. Gel permeation chromatography Dextranase sample (1.0 ml) obtained after ultrafiltration was loaded on Sepharose CL6B (GE Healthcare Bio-Sciences AB, Sweden) column (1.5 × 55 cm) integrated with gel permeation chromatography system (Econo pump EP-1, Bio-Rad, USA). Before loading the sample, gel was equilibrated with 0.1 M citrate phosphate buffer (pH 6.0). Sample was eluted with flow rate of 1.0 ml/min and
fractions of 2.0 ml were collected using automated fraction collector (2110 Fraction collector, Bio-Rad, USA). Fractions containing enzyme activity were pooled and concentrated using Centricon Ultracel YM-10 (Millipore) 10 kDa filter membrane. 2.4. Dextranase characterization 2.4.1. Molecular weight estimation Concentrated enzyme fraction obtained after purification was assessed for enzyme purity and molecular weight using 10% polyacrylamide gel electrophoresis (PAGE) [19]. Glycoprotein staining of purified dextranase was performed using periodic acid Schiff’s staining method [20,21]. 2.4.2. Relative amino acid composition analysis and N-terminal sequencing Relative amino acid content of purified dextranase was processed on Amino Acid Analyzer (Shimadzu LC -10A/C - R7A, USA). For the sequencing of N-terminal portion of dextranase, the sample was loaded on PAGE and blotted to polyvinylidene difluoride membrane (PVDF) using semi-dry electro blotter (Owl Separation systems) [22] and sequencing was performed by Alta Biosciences, University of Birmingham, UK. 2.5. Kinetic parameters analysis 2.5.1. Effect of pH and temperature on enzyme activity Dextran T50 (0.5%) was dissolved in different buffering solutions (0.1 M) including glycine–HCl (pH: 2.0–4.0), citrate phosphate (pH: 4.0–6.0), sodium phosphate (pH: 6.0–8.0). Enzyme activity was performed using standard assay procedure. To determine optimum temperature for enzyme catalysis, enzyme–substrate reaction mixture (0.5% dextran T50, 0.1 M citrate phosphate buffer pH 4.5, 15 min) was carried out at different temperatures between 25 and 75 ◦ C. 2.5.2. Effect of ionic strength of buffer on enzyme activity After selection of suitable buffer, molarity of citrate phosphate buffer was varied from 0.025 to 0.25 M keeping pH constant at 4.5. Substrate (0.5%) for enzyme activity was dissolved in each buffer solution separately and subjected to estimation of enzyme activity according to standard assay procedure. 2.5.3. Optimal reaction time for enzyme catalysis For investigation of optimum time required for enzyme–substrate reaction, reaction mixture was kept at standard assay conditions for up to 1 h and enzyme activity was calculated after a regular interval of 15 min. Optimum time for reaction was estimated based on amount of reducing sugar liberated in that specific time duration. 2.5.4. Substrate selection, Km , Vmax of the reaction Optimal substrate and its concentration for enzyme catalysis was investigated by using different molecular weight dextrans (dextran T50: 5000 Da; dextran T100: 10,000 Da; dextran T700: 70,000 Da) in a range of 0.001–0.01 mg/ml. Dextran T50 was selected and dissolved in 0.1 M citrate phosphate buffer (pH 4.5) at varying percentages to calculate initial velocity of reaction. The Michaelis–Menten constant (Km ) and maximum velocity of reaction Vmax were determined by Lineweaver–Burk plot [23]. 2.5.5. End product analysis Reaction end products were analyzed by a modified thin layer chromatography method [24,25]. Enzyme–substrate reaction mixture was prepared in a ratio of 1:2 and subjected to hydrolysis for
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
Fig. 1. Phylogenetic tree of Bacillus licheniformis KIBGE-IB25.
15 min at standard assay conditions. Reaction mixture was spotted on Silica gel plates (Sigma) using glass capillary tube. Maltose, maltotriose, maltopentose, maltoheptose and dextran T50 were spotted as standards (2.0% w/v in distilled water). Plate was placed in a TLC chamber containing n-butanol:acetic acid:water in a ratio of 5:3:1 (v/v/v) at room temperature. As the solvent front reached the top edge of plate, it was removed from chamber and air dried. Plate was sprayed with 20% H2 SO4 , dried and kept at 110 ◦ C for 10 min. 3. Results and discussion 3.1. 16S rDNA analysis Bacterial strain tentatively characterized as Bacillus licheniformis KIBGE-IB25 was confirmed by 16S rDNA analysis. Nucleotide sequence of 16S rDNA was compared with other related Bacillus species sequences using BLAST (http://blast.ncbi.nlm.nih.gov/ Blast.cgi). After multiple alignment it was found that the sequence is novel and showed similarity to Bacillus licheniformis. Sequence was deposited in GenBank database and received accession number KC465402. Phylogenetic and molecular evolutionary analysis was conducted using MEGA version 4 software [26] (Fig. 1). 3.2. Dextranase purification 3.2.1. Precipitation and desalting From gradient precipitation, 30% ammonium sulfate showed maximum enzyme precipitation from cell free fluid resulting in specific activity of 34.0 U/mg. However, enzyme was reversibly denatured during salt precipitation. It was reported that 80% ammonium sulfate resulted in 90% yield of a thermostable dextranase from thermophilic bacterium [13]. Sephadex G-25 pre-packed column was used to desalt the enzymatic fraction obtained after precipitation which resulted in 2 folds purification and increased specific activity of enzyme. 3.2.2. Ultrafiltration Prior loading the sample on gel permeation column, it was ultrafiltrated using Centricon Ultracel YM-10 (Millipore) 10 kDa filter membrane to remove any low molecular weight interfering proteins. Enzyme activity and total protein was estimated according to standard assay procedure and it was found that enzyme retained 100% of its activity in retenate and purified up to 4 folds. 3.2.3. Size exclusion chromatography The final step purification was approximately 36 folds (Table 1). Purified dextranase was analyzed using PAGE (Fig. 2). Ion exchange chromatography using DEAE-Sepharose was employed which successfully resulted in 733 fold purification [6]. Previously, Sephacryl
245
Fig. 2. Purified dextranase from Bacillus licheniformis KIBGE-IB25 on PAGE. Lane 1: BSA marker (Sigma); lane 2: Coomassie stained dextranase; lane 3: Schiff’s stained dextranase for glycoprotein analysis.
S-300 was successfully employed for the purification of a thermostable dextranase resulting in 25 purification fold [13]. Other chromatographic methods have also been attempted resulting in purification factor ranging from 4 to 925 folds [27,28]. 3.3. Characterization of dextranase 3.3.1. Molecular weight estimation Native PAGE analysis of purified dextranase from Bacillus licheniformis KIBGE-IB25 showed a single polypeptide band of 158 kDa (Fig. 2). In situ dextranolytic activity was studied using various concentrations of blue dextran which was incorporated during the polymerization of the gel. However, none of the trials led to appearance of hydrolytic zone although the protein fraction before loading was assessed for enzyme activity using Nelson Somogyi’s assay [17] and found to have catalytic activity. This could be attributed to pH shift during electrophoresis which might have distorted the structural conformation hence rendering inactive enzyme [29]. Dextranases are known to be glycosylated during post translational modification [30], therefore native PAGE gel was stained specifically for detection of glycosylation. Magenta bands of purified dextranase were seen against light pink background, confirming the dextranase to be a glycoprotein. Penicillium minioluteum dextranase is the most extensively studied dextranase which contain 10–12% carbohydrate as N-terminal glycosylation [31]. It was noted that three potential sites for glycosylation and differences in oligosaccharides secreted along with native and recombinant dextranase when P. minioluteum dextranase was expressed in Pichia pastoris [32]. Larsson et al. studied the structure of P. minioluteum and reported glycosylation at N5, N537 and N540 [33]. 3.3.2. Relative amino acid composition analysis Relative percentage of each amino acid present in KIBGE-IB25 dextranase is shown in Table 2. It largely consists of residues with hydrophobic side chains like methionine (15.6%), leucine (19.1%), isoleucine (3.6%) and others alike. Among the charged residues, it consists of 5.13% negatively charged amino acids and only 2.5% positively charged amino acids which indicated that the protein may have low isoelectric point. It also contains approximately 3% of serine and threonine residues which might be providing site for O-glycosylation of dextranase during the post translational modification [30]. Among all residues, tyrosine and glycine showed highest relative percentage to be precise 21.8 and 21.8%, respectively. 3.3.3. N-terminal amino acid sequencing Sequence analysis of N-terminus of KIBGE-IB25 dextranase revealed unique pattern and showed no significant homology
246
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
Table 1 Purification chart of dextranase from Bacillus licheniformis KIBGE-IB25. Steps
Total enzyme activity (U)
Total protein (mg)
Specific activity (U/mg)
Purification (fold)
Yield (%)
Crude enzyme Salt precipitation Desalting Ultrafiltration Gel permeation chromatography
2.36 × 105 5.670 × 103 1.1754 × 104 1.170 × 104 5.620 × 103
6000 168 175 75 4
39 34 67 156 1405
1 1 2 4 36
100 3 5 5 2
Table 2 Relative amino acid composition of purified dextranase from Bacillus licheniformis KIBGE-IB25. Amino acid
Molar ratio (%)
Amino acid
Molar ratio (%)
Alanine Arginine Aspartic acid Asparagine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine
4.64 0.76 1.15 – 2.84 3.98 – 21.84 0.49 3.65
Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine
9.17 1.22 15.0 – 9.54 1.28 1.71 – 21.82 0.92
“–” represents amino acids which could not be detected due to acid hydrolysis or conversion to some other form during the analytical procedure.
with N-terminal region of other known dextranases (Table 3). The N-terminal sequence of dextranase obtained from Bacillus licheniformis KIBGE-IB25 though exhibits a unique sequence, however there are certain inherent characteristics which it shares with family 49 glycolsyl hydrolases (GH49). First and foremost is the presence of alanine as the first N-terminal amino acid which is a common character of family GH 49 enzymes. In comparison to an endodextranase of a Bacillus spices, 1st and 3rd amino acid namely alanine and threonine are at identical positions [6]. However, in the current study this alanine–valine pair was not observed. It is possible that during the UV-mutagenesis, the end terminal portion may have mutated. However, this could only be confirmed by dextranase gene sequencing. Comparison of mutated and wild strain N-terminal region was not possible as dextranase production from wild strain was insufficient to lead to complete purification of the enzyme. From relative amino acid composition analysis it was suggested that the dextranase from KIBGE-IB25 could be O-glycosylated due to higher content of serine, threonine and tyrosine. Purified dextranase was subjected to periodic Schiff’s staining method and the technique was found to validate the presence of glycosylation (Fig. 2). It has now been confirmed that dextranase is O-glycosylated as it contains two threonine and two tyrosine residues at 2nd, 3rd, 5th and 7th positions among the 10 amino acid sequence of N-terminal region.
Table 3 N-terminal amino acid sequence of dextranase from Bacillus licheniformis KIBGEIB25. Organism
N-terminal amino acid sequence
Reference
Bacillus licheniformis KIBGE-IB25 Bacillus species Lipomyces starkeyi (NCYC 1436) dex1 Lipomyces starkeyi (NCYC 1436) dex2 Lipomyces starkeyi
AYTVTLYLQG
Current study
ASTGL AVNDNDEISSSQQ/P
[6] [30]
AVVLPID/GIVS/-V
[30]
AAVLPRDNRTV
[60]
3.4. Kinetic parameters analysis 3.4.1. Effect of pH on enzyme activity Dextranase from Bacillus licheniformis KIBGE-IB25 exhibited comparatively higher activity in a pH range of 4.0–5.0 and upon further experimentation, citrate phosphate buffer (pH 4.5) was found to be the most suitable buffering solution (Fig. 3A). It was reported that Penicillium minioluteum dextranase expressed in Pichia pastoris showed conformational stability in acidic pH and optimally cleaved the substrate at 4.5–5.0 pH values. However, it lost complete activity at neutral pH due to distortion in structural conformation [31]. Kim and Kim reported that lowest pH optimum of thermostable dextranases from Thermotoga lettingae is 4.3 [34], whereas optimum pH of a dextranase produced by a Bacillus species was reported around 6.8 [6]. 3.4.2. Effect of ionic strength of buffer on enzyme activity Variation in the molarity of citrate phosphate buffer revealed that the maximum catalytic activity by KIBGE-IB25 dextranase was found at 0.1 M (Fig. 3B). According to Ugwu and Apte [35] buffers cast substantial effects on the tertiary and quaternary structures of proteins. Usually dextranases prefer acidic pH for optimal activity and operational stability and it was reported that maximum enzyme activity was found in acetate buffer (0.02 M) and citrate buffer (0.1 M) for dextranases from Thermotoga lettingae and Paenibacillus species, respectively [34,36]. For optimal activity of several dextranolytic species like Hypocrea lixii, Lipomyces starkeyi and Streptomyces anulatus, sodium acetate buffer 0.02 M (pH 5.5), 0.05 M (pH 5.5) and 0.05 M (pH 0–5.4) were used, respectively [37,38]. 3.4.3. Optimal reaction time for enzyme catalysis When enzyme was reacted with substrate for different time intervals, highest enzyme activity was achieved at 15 min at 35 ◦ C using dextran T50 (Fig. 3C). It was reported that dextranases from different Penicillium strains required 10 min reaction time for optimum enzyme activity at 40–50 ◦ C [30,40,41]. On the contrary, a research study on dextranase from Streptomyces anulatus reported 60 min reaction time for maximum enzyme activity at 20 ◦ C using clinical grade dextran (40 kDa) as a substrate. Dextranase being produced by a variety of species, exhibits diversified reaction properties and it has been reported that dextranase performs substrate cleavage in 10 min to 24 h at 20–30 ◦ C [14,38]. 3.4.4. Effect of incubation temperature on enzyme activity Thermal inactivation of proteins specially the enzymes is one of the major physical factors adversely affecting the enzyme activity in industrial processes. Effect of various temperatures on dextranase activity was investigated and it was found that dextranase from KIBGE-IB25 exhibited optimum enzyme activity at 35 ◦ C (Fig. 3D). Most of the studies on dextranases have reported a broad temperature range from 25 to 75 ◦ C for enzyme activity [42–45]. Streptococcus ratti exhibited approximately 50% of maximal activity at 30 ◦ C whereas a drastic lost in activity was seen above 45 ◦ C [44]. A cold active dextranase from Streptomyces anulatus has demonstrated 40% activity at 4 ◦ C, whereas another organism of same
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248
247
Fig. 3. Analysis of kinetic parameters of dextranase from Bacillus licheniformis KIBGE-IB25. (A) Optimum pH selection (glycine–HCl buffer pH 2.0–4.0; citrate phosphate buffer pH 4.0–6.0; sodium phosphate buffer pH 6.0–8.0 at 0.1 M concentrations). (B) Optimum ionic strength of buffer (0.5% dextran T50 in citrate phosphate buffer at 35 ◦ C, 15 min). (C) Optimum reaction time (0.5% dextran T50 in 0.1 M citrate phosphate buffer at 35 ◦ C). (D) Optimum temperature for enzyme reaction (0.5% dextran T50 in 0.1 M citrate phosphate buffer pH 4.5, 35 ◦ C, 15 min).
specie retained 50% of its optimal activity in a range between 30 and 75 ◦ C [38,46]. 3.4.5. Substrate selection, Km and Vmax of the reaction When various molecular weight dextrans were subjected to hydrolysis by dextranase, it was found that the enzyme showed maximum degradation of dextran T50 as compared to other high molecular weight dextrans (Fig. 4). Effect of substrate concentration on rate of the reaction was evaluated by varying substrate concentration from 1.0 to 15.0 mg/ml using Dextran T50. Michaelis constant (Km ) and maximum velocity (Vmax ) were calculated from
Fig. 4. Substrate preference of dextranase from Bacillus licheniformis KIBGE-IB25 (0.1 M citrate phosphate buffer pH 4.5, 35 ◦ C, 15 min).
Lineweaver–Burk plot and it was found that Km and Vmax values were 0.374 mg/ml and 182 mol/min, respectively. It was reported earlier that using different molecular weight dextrans, 1 mg of dextranase exhibited Km value of 2.64 mg/ml and Vmax of 436 mol/min [39]. Whereas, when different molecular weight dextrans were used, dextranase from Paecilomyces lilacinus did not exhibit considerable variation in Km and Vmax values [47]. Comparing the dextranase produced by Bacillus licheniformis KIBGE-IB25 with a higher dextranase producing strain of P. lilacinum (UV and chemically mutated strain); KIBGE-IB25 dextranase had 15.5% more affinity towards its substrate [29]. 3.4.6. End product analysis End products generated by enzymatic action of dextranase were analyzed using thin layer chromatography with the modification of two methods [24,25]. As a result of enzymatic degradation dextran was cleaved into lower molecular weight fractions including maltooligosaccharides (malto-heptotriose, hexotriose, pentotriose) and maltotriose (Fig. 5). Absence of glucose residues suggested that the mode of action of KIBGE-IB25 dextranase is endolytic. Numerous oligosaccharides exhibits different biological functions and among them isomaltooligosaccharides which are produced by the endolytic action of dextranases is of highly commercial interest as a prebiotic [48]. Various research studies on Aspergillus, Fusarium, Chaetomium and Penicillium species have reported that higher amount of isomaltooligosaccharides, isomalto-triose-tetrose-pentose-hexose and comparatively low amount of glucose is generated by the action of endodextranases [49–52]. Among the bacterial species; Paenibacillus illinoisensis produced isomaltooligosaccharides, isomaltotriose and glucose
248
R.R. Zohra et al. / International Journal of Biological Macromolecules 78 (2015) 243–248 [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]
Fig. 5. Thin layer chromatogram of end products produced after dextranase reaction (0.5% dextran T50 in 0.1 M citrate phosphate buffer at 35 ◦ C). Standard solutions of 2.0% w/v in distilled water. S: dextran T50; G: glucose; IM: isomaltose; IM3: isomaltotriose; IM5: isomaltopentose; IM7: isomaltoheptose; ES: enzyme solution; EP: reaction end products.
residues from the cleavage of dextran T500 [6,53], whereas Streptococcus sp. [54], Flavobacterium sp. [55] and Streptomyces anulatus [38] predominantly generate isomaltotriose as end products. Use of dextransucrase and fusion enzymes having catalytic properties of both; dextransucrase and dextranase have also been reported for the production of maltooligosaccharides [56–59]. 4. Conclusion Bacillus licheniformis KIBGE-IB25 strain producing high amounts of endodextranase was cultured and the enzyme was purified to near-homogeneity. The enzyme had a molecular weight of 158 kDa and the pH optima was around 4.5. The relative amino acid composition and N-terminal amino acid sequence showed that the enzyme is novel. Owing to the nonpathogenic nature of the producer strain, the enzyme is suitable for various commercial applications. Conflict of interest
[19] [20] [21] [22] [23] [24] [25]
[26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47]
The authors declare that no conflict of interest exists. [48]
Acknowledgement This research was funded and supported by The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Pakistan. References [1] E. Khalikova, P. Susi, T. Korpela, Microbiol. Mol. Biol. Rev. 69 (2005) 306–325. [2] P.J. Baker Jr., in: R.L. Whistler, J.N. Bemiller (Eds.), Industrial Gums: Polysaccharides and their Derivatives, Academic Press, New York, 1959, pp. 531–563. [3] G.J. Walker, in: D.J. Manners (Ed.), International Review of Biochemistry, University Park Press, Baltimore, MD, 1978. [4] R.G. Crittenden, M.J. Plaune, Trends Food Sci. Technol. 7 (1996) 353–361. [5] K.C. Mountzouris, S.G. Gilmour, R.A. Rastall, J. Food Sci. 675 (2001) 1767–1771.
[49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60]
E. Khalikova, P. Susi, N. Usanov, T. Korpela, J. Chromatogr. B 796 (2003) 315–326. A. Jeanes, ACS Symp. Ser. 45 (1977) 284–298. G. Eggleston, A. Monge, B. Montes, D. Steward, Int. Sugar J. 108 (2006) 528–537. E.R. Jiménez, Biotechnol. Appl. 22 (2005) 20–27. G. Eggleston, A. Monge, B. Montes, D. Steward, Int. Sugar J. 109 (2007) 757–764. N. Hiraoka, J. Fukumoto, D. Tsuru, J. Biochem. 71 (1972) 57–64. D.K. Das, S.K. Dutta, Int. J. Biochem. Cell Biol. 28 (1996) 107–113. C.V.A. Wynter, M. Chang, J. De Jersey, B. Patel, P.A. Inkerman, S. Hamilton, Enzyme Microb. Technol. 20 (1997) 242–247. E. Shimizu, T. Unno, M. Ohba, G. Okada, Biosci. Biotechnol. Biochem. 62 (1998) 117–122. R.R. Zohra, A. Aman, R.R. Zohra, A. Ansari, M. Ghani, S.A. Qader, Carbohydr. Polym. 92 (2013) 2149–2153. A. Ansari, A. Aman, N.N. Siddiqui, S. Iqbal, S.A. Qader, Pak. J. Pharm. Sci. 25 (2012) 195–201. N. Nelson, J. Biol. Chem. 153 (1944) 375–380. O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1951) 265–275. U.K. Laemmli, Nature 227 (1970) 680–685. S.M. Holt, H. Al-Sheikh, K.J. Shin, Lett. Appl. Microbiol. 32 (2001) 185–189. D. Kothari, A. Tyagi, S. Patel, A. Goyal, Biotech 1 (2011) 199–205. P. Matsudaira, J. Biol. Chem. 262 (1987) 10035–10038. H. Lineweaver, D. Burk, J. Am. Chem. Soc. 56 (1934) 658–666. R.K. Gill, J.A. Kaur, J. Ind. Microbiol. Biotechnol. 31 (2004) 540–543. M.S. Kim, J.T. Park, Y.W. Kim, H.S. Lee, R. Nyawira, H.S. Shin, C.S. Park, S.H. Yoo, Y.R. Kim, T.W. Moon, K.H. Park, Appl. Environ. Microbiol. 70 (2004) 3933–3940. K. Tamura, J. Dudley, M. Nei, S. Kumar, Mol. Biol. Evol. 24 (2007) 1596–1599. J. Fukumoto, H. Tsuji, D. Tsuru, J. Biochem. 69 (1971) 1113–1121. L. Linder, M.L. Sund, Caries Res. 15 (1981) 436–444. M.A. Shams, A.A. Kheyr, M.D. Farshbaf, Sci. Iran 9 (2002) 39–46. S.H. Millson, I.H. Evans, Antonie Van Leeuwenhoek 92 (2007) 399–404. A. Beldarraín, N. Acosta, L. Betancourt, L.J. González, T. Pons, Biotechnol. Appl. Biochem. 38 (2003) 211–221. L.H. Betancourt, R. García, J. González, R. Montesino, O. Quintero, T. Takao, Y. Shimonishi, J.A. Cremata, FEMS Yeast Res. 1 (2001) 151–160. A.M. Larsson, R. Andersson, J. Stahlberg, L. Kenne, T.A. Jones, Structure 11 (2003) 1111–1121. Y.M. Kim, D. Kim, Appl. Microbiol. Biotechnol. 85 (2010) 581–587. S.O. Ugwu, S.P. Apte, Pharm. Technol. 28 (2004) 86–113. P.M. Finnegan, S.M. Brumbley, M.G. O’Shea, K.M.H. Nevalainen, P.L. Bergquist, Curr. Microbiol. 49 (2004) 327–333. D.W. Koenig, D.F. Day, Appl. Environ. Microbiol. 55 (1989) 2079–2081. A.R.D. Mahmoud, A.W. Helmy, Aust. J. Basic Appl. Sci. 3 (2009) 3808–3817. D.T. Wu, H.B. Zhang, L.J. Huang, X.Q. Hu, Process Biochem. 46 (2011) 1942–1950. M.A. Abdel-Naby, A.M.S. Ismail, A.M. Abdel-Fattah, A.F. Abdel-Fattah, Process Biochem. 34 (1999) 391–398. M.S.A. Abdel-Aziz, F.N. Talkhan, J.C. Janson, J. Appl. Sci. Res. 3 (2007) 1509–1516. W.N. Arnold, T.B.P. Nguyen, L.C. Mann, Arch. Microbiol. 170 (1998) 91–98. F. Hoster, R. Daniel, G. Gottschalk, J. Gen. Appl. Microbiol. 47 (2001) 187–192. T. Igarashi, H. Morisaki, N. Goto, Microbiol. Immunol. 48 (2004) 155–162. F.A. Erhardt, H.J. Jördening, J. Biotech. 131 (2007) 440–447. S.R. Decker, W.S. Adney, T.B. Vinzant, M.E. Himmel, US Patent 6509184 B1 (2003). A. Galvez-Mariscal, A. Lopez-Munguia, Appl. Microbiol. Biotechnol. 36 (1991) 327–331. K. Swennen, C.M. Courtin, J.A. Delcour, Crit. Rev. Food Sci. Nutr. 46 (2006) 459–471. D. Tsuru, N. Hiraoka, J. Fukumoto, J. Biochem. 71 (1972) 653–660. M. Sugiura, A. Ito, Chem. Pharm. Bull. (Tokyo) 22 (1974) 1593–1599. L.G. Simonson, A.E. Liberta, A. Richardson, Appl. Microbiol. 30 (1975) 855–861. A. Hattori, K. Ishibashi, S. Minato, Agric. Biol. Chem. 25 (1981) 2409–2416. E.F. Khalikova, N.G. Usanov, Appl. Biochem. Microbiol. 38 (2002) 89–93. A. Pulkownik, G.J. Walker, Carbohydr. Res. 54 (1977) 237–251. M. Kobayashi, S. Takagi, M. Shiota, Y. Mitsuishi, K. Matsuda, Agric. Biol. Chem. 47 (1983) 2585–2593. J.F. Robyt, T.F. Walseth, Carbohydr. Res. 61 (1978) 433–445. D. Kim, D.F. Day, Enzyme Microb. Technol. 16 (1994) 844–848. A.K. Goulas, D.A. Fisher, G.K. Grimble, A.S. Grandison, R.A. Rastall, Enzyme Microb. Technol. 35 (2004) 327–338. A.K. Goulas, J.M. Cooper, A.S. Grandison, R.A. Rastall, Biotechnol. Bioeng. 88 (2004) 778–787. H.K. Kang, S.H. Kim, J.Y. Park, X.J. Jin, D.K. Oh, S.S. Kang, D. Kim, Yeast 22 (2005) 1239–1248.