- Email: [email protected]
Purinergic 2X7 receptor activation regulates WNT signaling in human mandibular-derived osteoblasts
Archives of Oral Biology 81 (2017) 167–174
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Purinergic 2X7 receptor activation regulates WNT signaling in human mandibular-derived osteoblasts
MARK
Pimrumpai Rochanakit Sindhavajivaa,b, Panunn Sastravahac, Mansuang Arksornnukitd, ⁎ Prasit Pavasantb,e, a
Graduate Program in Prosthodontics, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand c Department of Surgery, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand d Department of Prosthodontics, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand e Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand b
A R T I C L E I N F O
A B S T R A C T
Keywords: Adenosine triphosphate P2X7 receptor Human osteoblasts Bone mineralization WNT signaling pathway
Objective: Purinergic 2X7 receptor (P2X7R) activation modulates in vitro mineralization by primary rat and human osteoblasts. However, the detailed mechanism of how P2X7R activation affects primary human osteoblasts remains unclear. The aim of this study was to investigate the effect of P2X7R activation on human mandibular-derived osteoblast (hMOB) differentiation. Design: Primary human osteoblasts were obtained from non-pathologic mandibular bone from healthy patients. The hMOBs were cultured in osteogenic medium with or without 0.5–5 μM 2′(3′)-O-(4-benzoyl) benzoyl-ATP (BzATP), a selective P2X7R agonist. The mRNA expression of osteogenic differentiation markers and WNTsignaling molecules was investigated by quantitative real time polymerase chain reaction. In vitro mineral deposition was determined by Alizarin Red S staining. Transfection of small interfering RNA was performed to confirm the effect of P2X7R activation. WNT/β-catenin signaling was detected by immunofluorescence staining for β-catenin. Results: BzATP inhibited osteogenic medium-induced RUNX2 and OSX mRNA expression in hMOBs. Moreover, BzATP significantly retarded in vitro mineralization. These findings indicated that BzATP/P2X7R activation inhibited hMOB differentiation. Interestingly, reduced WNT3A mRNA expression and blockage of osteogenic medium-induced β-catenin nuclear translocation were also found. These data suggested that WNT signaling might be a target of P2X7R-regulated osteogenic differentiation. Furthermore, when recombinant human WNT3A was added to the BzATP-treated group, it rescued the reduced RUNX2 and OSX expression, and in vitro mineralization. Conclusion: Our results demonstrate that P2X7R activation by BzATP inhibits hMOB differentiation. This inhibitory effect was associated with inhibition of the WNT/β-catenin signaling pathway.
1. Introduction Mechanical stimulation of osteoblasts induces an efflux of adenosine triphosphate (ATP) into the extracellular environment (Romanello, Pani, Bicego, & D'Andrea, 2001; Rumney, Wang, Agrawal, & Gartland, 2012). Extracellular ATP differentially affects osteoblasts and osteoclasts. ATP has been shown to inhibit bone formation by rat osteoblasts by reducing osteogenic mRNA expression and in vitro mineralization (Hoebertz, Mahendran, Burnstock, & Arnett, 2002; Jones, Gray, Boyde, & Burnstock, 1997; Orriss et al., 2006); however, it stimulated
osteoclast resorptive activity (Hoebertz, Meghji, Burnstock, & Arnett, 2001; Morrison, Turin, King, Burnstock, & Arnett, 1998). Extracellular ATP is sensed by cells via the purinergic 2 or P2 receptors (P2R). P2R in the human genome contains 7 P2X and 8 P2Y receptor subtypes (Orriss et al., 2011). Among the P2R subtypes, the P2X7 receptor (P2X7R) plays an important role in osteogenic differentiation (Grol, Panupinthu, Korcok, Sims, & Dixon, 2009). Functional P2X7R was found in situ in murine and human osteoblastic cells (Agrawal et al., 2017; Panupinthu et al., 2008). During proliferation and differentiation, the level of P2X7R protein increased in primary rat
Abbreviations: hMOBs, human mandibular-derived osteoblasts; GM, growth medium; OM, osteogenic medium ⁎ Corresponding author at: Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand. E-mail address: [email protected] (P. Pavasant). http://dx.doi.org/10.1016/j.archoralbio.2017.05.009 Received 31 January 2017; Received in revised form 16 May 2017; Accepted 16 May 2017 0003-9969/ © 2017 Elsevier Ltd. All rights reserved.
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
2. Materials and methods
calvarial osteoblasts (Orriss et al., 2012). The involvement of this ATP receptor in bone formation was shown by activating P2X7R using 2′(3′)O-(4-benzoyl) benzoyl-ATP (BzATP), a selective P2X7R agonist (Zhong, Dunn, Xiang, Bo, & Burnstock, 1998). Under these conditions, the in vitro formation of mineralized nodules decreased (Agrawal et al., 2017; Orriss et al., 2012). P2X7R deficient mice have generated disparate phenotypes. In one study using these mice, a significant reduction was found in femoral total and cortical bone content (Ke et al., 2003). In another study, thicker cortical bone was reported without significant changes in bone mineral density or trabecular bone (Gartland et al., 2003). These contradictory results might be due to the deletion of different regions of the P2X7R gene, i.e. C-terminal amino acid 506–532 deletion versus inserting a LacZ gene at the beginning of P2X7R exon 1 (Grol et al., 2009; Orriss et al., 2011; Sim, Young, Sung, North, & Surprenant, 2004; Solle et al., 2001). Moreover, a P2X7R splice variant was found in some KO mouse tissues (Nicke et al., 2009). However, because P2X7R protein was not detected in either model (Sim et al., 2004), the detailed mechanism of how P2X7R regulates bone hemostasis is still unknown. The effect of P2X7R activity likely results from a cascade of events; one of which may depend on WNT signaling. This pathway is wellknown to be involved in osteoblast differentiation. WNT signaling occurs via both canonical and non-canonical pathways (Tompkins, 2011). Among the WNT canonical signaling proteins, WNT3a protein is expressed by osteoblasts and plays a role in the canonical or WNT/βcatenin signaling pathway (Hu et al., 2005). Generally, WNT3a signaling leads to an increased level of β-catenin in the cytoplasm. β-catenin subsequently translocates to the nucleus, where it binds to T cell factor/ lymphoid enhancer factor and induces the expression of genes involved in osteogenic differentiation. These genes include Runt-related transcription factor 2 (Runx2) and Osterix (Osx), which eventually results in increased bone formation (Minear et al., 2010). The association of P2X7R activation and WNT signaling was investigated in MC3T3-E1 cells (Grol, Brooks, Pereverzev, & Dixon, 2016). This study demonstrated that P2X7R activation by BzATP prolonged and potentiated WNT/β-catenin signaling. Although there are studies focusing on ATP-activated P2X7R in osteoblasts, the possible involvement of the WNT signaling pathway in human osteoblasts has not been explored. Therefore, the aim of the present study was to investigate the influence of P2X7R on the WNT signaling pathway and the osteogenic differentiation of primary human mandibular-derived osteoblasts (hMOBs). The knowledge gained in this study will be beneficial for bone healing and regeneration treatment, especially in alveolar bone.
2.1. Sample collection Human MOBs were obtained as previously described (Khonsuphap, Pavasant, Irwandi, Leethanakul, & Vacharaksa, 2017). The protocol was approved by the Ethics Committee, Faculty of Dentistry, Chulalongkorn University, Thailand. After obtaining informed consent, mandibular alveolar bone was collected from tooth extraction sites of healthy patients aged 25–35 years at the Department of Surgery, Faculty of Dentistry, Chulalongkorn University. Only alveolar bone from extraction sites without infection and inflammation was collected for this study. The alveolar bone was kept in a sterile tube containing growth medium (GM), which was composed of 1000 mg/L glucose Dulbecco’s Modified Eagle’s Medium (Gibco, BRL, Carlsbad, CA) containing 15% (v/v) fetal bovine serum (HyClone, Thermo Scientific, Logan, UT), 2 mM L-glutamine (Gibco), 100 units/ml Penicillin (Gibco), 100 μg/ml Streptomycin (Gibco), and 5 μg/ml Amphotericin B (Gibco). 2.2. Cell culture The alveolar bone samples were washed with phosphate buffered saline and any soft tissue was removed using a surgical blade. The samples were cut into 3 × 3 mm pieces and placed in 35 mm culture dishes (Corning, New York, NY). The explants were cultured in GM and incubated at 37 °C in a 5% CO2 humidified atmosphere. Medium was replaced every 2 days. After reaching 80% confluence, the hMOBs were subcultured at a 1:3 ratio. Cells from passages 3–8 were used in the experiments. Human MOBs obtained from at least 3 different patients were used as biological replication. 2.3. Osteogenic differentiation The hMOBs (7 × 104 cells/well) were cultured in GM in 24-well plates (Corning) overnight. The GM was replaced by osteogenic medium (OM), which was GM supplemented with 50 μg/ml ascorbic acid (Sigma-Aldrich Chemical, St Louis, MO), 100 nM dexamethasone (Sigma-Aldrich Chemical), and 10 mM β-glycerophosphate (SigmaAldrich Chemical). To investigate the effect of ATP and BzATP on osteogenic differentiation, hMOBs were cultured for 4 and 14 d in OM with or without 0.1, 1, or 10 μM ATP (Sigma-Aldrich Chemical) or 0.5, 2.5, or 5 μM BzATP (Tocris Bioscience, United Kingdom). BzATP was used because ATP can activate additional receptors, while BzATP is a P2X7R-specific agonist. OM was replaced every 2 d. The following osteogenic markers
Table 1 Oligonucleotide sequences. Gene
Accession no.
Primer sequence
Size (bp)
COL I
NM000088.3
128
BSP
NM004967.3
RUNX2
NM001024630.3
OSX
NM001300837.1
WNT3A
NM033131.3
WNT5A
NM003392.4
P2X7R
NR033955.1
18S
NR003286.2
Forward: 5' GTGCTAAAGGTGCCAATGGT 3' Reverse: 5' ACCAGGTTCACCGCTGTTAC 3' Forward: 5' ATGGCCTGTGCTTTCTCAATG 3' Reverse: 5' AGGATAAAAGTAGGCATGCTTG 3' Forward: 5' ATGATGACACTGCCACCTCTGA 3' Reverse: 5' GGCTGGATAGTGCATTCGTG 3' Forward: 5' GCCAGAAGCTGTGAAACCTC 3' Reverse: 5' GCTGCAAGCTCTGCATAACC3' Forward: 5' CTGTTGGGCCACAGTATTCC 3' Reverse: 5' GGGCATGATCTCCACGTAGT 3' Forward: 5' TCAGGCACCATTAAACCAGA 3' Reverse: 5' AATTCACAGAGGTGTTGCAGC 3' Forward: 5' AAGCTGTACCAGCGGAAAGA 3' Reverse: 5' GCTCTTGGCCTTCTGTTTTG 3' Forward: 5' GGCGTCCCCCAACTTCTTA 3' Reverse: 5' GGGCATCACAGACCTGTTATT 3'
168
125 167 161 113 159 202 76
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
(LipofectamineTM2000 Reagent, Invitrogen, Carlsbad, CA) for 24 h prior to the experiment. Cells treated with 4 μl of control siRNA (siC) (1:250; Santa Cruz Biotechnology) and 6 μl of transfection reagent were used as control.
were assessed: COLIA1, BSP, RUNX2, and OSX (the primer sequences are shown in Table 1). An alkaline phosphatase (ALP) activity assay was performed. In vitro mineralization was investigated using Alizarin Red S staining. To determine the role of WNT/β-catenin signaling, 50 or 100 ng/ml rhWNT3A (R & D Systems, Minneapolis, MA) and 100 ng/ml rhDICKOFF 1 (rhDKK1) (R & D Systems), a WNT/β-catenin antagonist, were used. The osteogenic gene expression patterns were investigated after 4 d of culture.
2.9. Immunofluorescence staining for β-catenin
Cells were cultured in OM for 14 d, fixed in −20 °C methanol, and stained with 1% Alizarin Red S solution (Sigma-Aldrich Chemical). The amount of calcium deposition was quantified by eluting the staining with 10% cetylpyridinium chloride monohydrate (Sigma-Aldrich Chemical) in 10 mM sodium phosphate (Sigma-Aldrich Chemical). The absorbance was measured at 570 nm using a microplate reader (ELx800, Biotek, Winooski, VT).
Human MOBs were cultured in GM or OM with or without 5 μM BzATP or 100 ng/ml rhDKK1 for 4 d. The cells were fixed with cold methanol and incubated with 10% (v/v) horse serum in PBS for 1 h to prevent nonspecific antibody binding. The cells were incubated with the primary antibody, Rabbit anti-human β-catenin polygonal antibody (EMD Millipore, Temecula, CA) at a 1:500 dilution for 3 h at 37 °C followed by a 1:500 dilution of biotinylated-secondary antibody (Abcam, Cambridge, MA) for 45 min. β-Catenin detection was perform using streptavidin-FITC (Sigma). Cell nuclei were stained with DAPI. The fluorescence was evaluated by fluorescence microscope (Axio Oserver.Z1, Zeiss, Jena, Germany). As a negative control, the primary antibody was omitted from the staining method.
2.5. Alkaline phosphatase activity assay
2.10. Statistical analysis
Human MOBs were lysed in a pH 8 lysis buffer. The cell lysates were incubated at 37 °C in a solution containing 2 mg/ml p-nitrophenol phosphate (Life Technologies Corp, Frederick, MD), 0.1 M 2-amino2methyl-1-propanol (Life Technologies Corp) and 2 mM MgCl2 (Life Technologies Corp). After 15 min, 50 mM NaOH (Emsure, Merck, Darmstadt, Germany) was added to stop the reaction. The presence of p-nitrophenol was measured at an absorbance of 410 nM using a microplate reader (ELx800, Biotek) Total cellular protein was determined by a BCA assay (Thermo Scientific Rockford, IL, USA). The enzyme activity was expressed per total cellular protein.
The experiments were performed in triplicate, with the data represented as mean ± standard deviation (SD). The data were analyzed by one-way analysis of variance using statistical software (SPSS Version 22, Chicago, IL). Scheffé’s test was used for post hoc analysis.
2.4. In vitro mineralization assay
3. Results 3.1. hMOB characterization Human MOBs expressed COL I, BSP, RUNX2, and OSX mRNA and ALP activity in GM, which significantly increased when the hMOBs were cultured in OM (Fig. 1A). Alizarin Red S staining showed that hMOBs formed mineralized nodules after 14 days in OM. These data indicate that the cultured cells demonstrate osteoblast characteristics.
2.6. MTT assay To investigate cell viability and proliferation, an MTT assay was performed at 1, 3, and 7 d. The hMOB proliferation/viability was analyzed using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) (USB Corp., Cleveland, OH). The formazan crystals were dissolved, and quantified using an absorbance microplate reader at 540 nm (ELx800, Biotek).
3.2. WNT/β-catenin regulated hMOB RUNX2 and OSX mRNA expression To investigate the role of WNT signaling in hMOB differentiation, the expression pattern of WNT signaling-related genes was determined (Fig. 1B). The results showed significantly increased WNT3A expression by cells cultured in OM compared with GM at 1 d and 4 d. Under these conditions, WNT5A expression significantly decreased. These results suggest the involvement of WNT3A and WNT/β-catenin signaling in hMOB differentiation. To clarify the role of WNT/β-catenin, rhDKK1, a WNT/β-catenin antagonist was used. The results showed a significant reduction in RUNX2 and OSX expression in the rhDKK1-treated group at 4 d (Fig. 1C). These data demonstrate that WNT/β-catenin signaling is involved in hMOB differentiation by regulating RUNX2 and OSX expression.
2.7. RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) Human MOBs (3 × 105 cells) were cultured in 6-well plate. Total RNA was extracted using 1 ml of RiboEx™ lysis reagent (Geneall Biotechnology Co., Ltd, Seoul, Korea) according to the manufacturer’s instructions. One μg of mRNA from each sample was reverse transcribed to cDNA using Improm-II™ (Promega, Madison, WI). Subsequently, qRT-PCR was performed using a miniOpticon RealTime PCR Detection System (Bio-Rad, Singapore) with a FastStart Essential DNA Green Master kit (Roche Diagnostics, Indianapolis, IN). The oligonucleotide sequences used in this study were shown in Table 1. The PCR protocol was: denaturation at 94 °C for 10 s, annealing at 60 °C for 10 s, and extension at 72 °C for 10 s for 45 cycles. Gene expression was normalized to the 18S ribosome expression and further normalized to the control of each experiment. Bio-Rad CFC Manager3.1 (Bio-Rad) was used to determine relative gene expression.
3.3. BzATP had no effect on cell proliferation, but decreased in vitro mineralization To determine the influence of P2X7R activation on hMOB differentiation, cells were cultured with BzATP, a selective P2X7R agonist (Fig. 2). MTT analysis showed that none of the BzATP concentrations used affected hMOB proliferation or viability as assessed at 1, 3, and 7 d (Fig. 2A). Next, we analyzed the effect of BzATP on in vitro mineralization by assessing the level of Alizarin Red S staining. The results showed that BzATP inhibited in vitro mineralization in a dose-dependent manner. This result corresponded with the inhibitory effect of ATP in ATP-
2.8. Small interfering RNA (siRNA) transfection Human MOBs were cultured in antibiotic-free growth medium until 70–80% confluent. The cells were treated with a solution of 4 μl of P2X7R siRNA (siP2X7R) oligonucleotide (1:250; Santa Cruz Biotechnology, Santa Cruz, CA) and 6 μl of transfection reagent 169
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 1. Human MOB characteristics. Cells were cultured in growth medium (GM) or osteogenic medium (OM). (A) Osteogenic marker genes were determined by qRT-PCR and ALP activity was evaluated at 4 d. Alizarin Red S staining was performed to investigate in vitro mineralization at 14 d. (B) The mRNA expression of WNT-signaling molecules was determined by qRT-PCR at 1 and 4 d. Although WNT3A expression significantly increased, WNT5A expression significantly decreased. (C) The rhDKK1 significantly inhibited RUNX2 and OSX expression. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus GM, # = p < 0.05 versus OM.
in hMOBs treated with BzATP, the level of nuclear β-catenin was strongly decreased (Fig. 3). BzATP appeared to prevent the translocation induced by OM. A similar effect was seen with rhDKK1 treatment. Under these conditions, the translocation of β-catenin to the nucleus was also prevented. These results demonstrate that BzATP inhibits WNT/β-catenin signaling pathway activation.
treated groups (Fig. 2A, Supplementary Fig. S1). Because all BzATP concentrations used in this experiment inhibited in vitro mineralization and none affected cell proliferation, the highest concentration, 5 μM BzATP, was selected for use in further experiments. 3.4. BzATP decreased WNT3A, RUNX2 and OSX mRNA expression
3.6. Exogenous rhWNT3A rescued the reduction in RUNX2 and OSX expression induced by BzATP
Osteoblasts were cultured in OM containing BzATP for 4 d and the mRNA expression level of WNT3A, WNT5A, RUNX2, and OSX was assessed. BzATP significantly decreased the expression of each of these genes, with the exception of WNT5A (Fig. 2B). To further assess the role of P2X7R activation in reducing the expression of WNT3A, WNT5A, RUNX2, and OSX, siP2X7R was used to block P2X7R synthesis (Fig. 2C). The results showed that siP2X7R reduced the level of P2X7R mRNA by 70%. Although BzATP significantly increased WNT3A, RUNX2, and OSX expression in cells transfected with siP2X7R, there was no significant change in WNT5A expression.
We then analyzed the role of WNT3A on the effect of BzATP on hMOBs. The hMOBs were cultured in OM and then incubated with BzATP with or without exogenous rhWNT3A. The results showed that rhWNT3A strongly stimulated RUNX2 and OSX expression (Fig. 4A). The decreased expression of RUNX2 and OSX induced by BzATP was entirely counteracted by rhWNT3A (Fig. 4A). In line with the increased expression of the osteogenesis related genes, an increased in vitro mineralization in the BzATP-rhWNT3A-treated groups was observed (Fig. 4B, Supplementary Fig. S2).
3.5. BzATP prevented β-catenin nuclear translocation 4. Discussion The WNT/β-catenin signaling pathway is activated by WNT3A. Under these conditions, β-catenin translocates from the cytoplasm to the nucleus. To investigate whether this also occurs in our osteoblasts when cultured in OM, the intracellular location of β-catenin was evaluated by immunocytochemistry. Immune-localization showed that
In this study, we demonstrated that P2X7R activation using BzATP inhibited hMOB differentiation. These results showed, for the first time, that P2X7R activation in hMOBs inhibited WNT/β-catenin signaling, resulting in reduced RUNX2 and OSX expression, essential genes in 170
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 2. BzATP signaling regulated hMOB differentiation. (A) The hMOBs were cultured in OM and cultured with 0.1, 1, or 10 μM ATP, or 0.5, 2.5, or 5 μM BzATP. Cells cultured in OM without ATP and BzATP served as control. To test cell viability, an MTT assay was performed at 1, 3, and 7 d. BzATP had no effect on hMOB viability. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM. In vitro mineralized nodules were stained with Alizarin Red S at 14 d. ATP and BzATP inhibited in vitro mineralization in a dose-dependent manner. (B) Effect of BzATP on WNT3A, WNT5A, RUNX2, and OSX mRNA expression. The hMOBs were cultured in OM with or without 5 μM BzATP. The mRNA expression was assessed by qRT-PCR at 4 d. WNT3A, RUNX2, and OSX expression in the BzATP-treated group significantly decreased. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM. (C) P2X7R synthesis was blocked using siP2X7R. The siP2X7R reduced the level of P2X7R by 70%. Although BzATP significantly increased WNT3A, RUNX2, and OSX expression in the siP2X7R-treated cells, there was no significant change in WNT5A expression. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus siC in OM.
inhibition of mineralization by BzATP may also occur via increased PPi. The effects of BzATP and phosphate generating enzymes cannot be excluded. However, the regulation of phosphate metabolism is complex. The participation of other genes, e.g. progressive ankylosis protein homolog (ANKH), and sodium-dependent Pi symporter 1 (PIT1), could also influence the extracellular phosphate/pyrophosphate ratio, leading to changes in the final molecular and cell response (Orriss, Arnett, & Russell, 2016). Therefore, the interaction of BzATP-P2X7 and BzATP-phosphate generating enzyme pathway in hMOBs requires further investigation. Using P2X7R siRNA, we determined that the reduced WNT3A, RUNX2, and OSX expression resulted from P2X7R signaling. Interestingly, under these conditions, BzATP increased WNT3A, RUNX2, and OSX expression. This finding suggests, in addition to P2X7R, the existence of an alternative signaling pathway induced by BzATP. BzATP has been reported to partially activate P2X1 (P2X1R) and P2Y1 receptor (P2Y1R) (Zhong et al., 1998); however, these receptors differentially affected osteoblast differentiation (Orriss et al., 2011; Orriss et al., 2012). Moreover, our results indicated that P2X1R and P2Y1R mRNA expression significantly increased in cells transfected with siP2X7R (Supplementary Fig. S3). Therefore, we hypothesize that when P2X7R expression is reduced, BzATP can alternatively activate P2X1R or P2Y1R, resulting in increased osteogenic gene expression. Interestingly, P2X7R activation was recently found to have a stimulating, rather than an inhibiting, effect on in vitro mineralization
osteoblast differentiation. BzATP was shown to down-regulate expression of WNT3A. WNT signaling plays an important role in osteoblast differentiation (Tompkins, 2011). We found an upregulation of WNT3A expression in hMOBs cultured in OM. This increased expression coincided with increased RUNX2 and OSX expression. Because DKK1, a canonical WNT-signaling inhibitor, inhibited the increase in RUNX2 and OSX expression, our findings strongly suggest the role of WNT3A in the upregulation of these two genes. Immunohistochemistry confirmed that BzATP inhibited β-catenin nuclear translocation, an important canonical WNT signaling pathway mechanism. Our results suggest that P2X7R activation inhibits hMOB differentiation by down-regulating the canonical WNT signaling pathway. The inhibitory effect of ATP and P2X7R activation on mineralization by hMOBs we observed agrees with the results obtained from primary rat and human osteoblasts (Agrawal et al., 2017; Hoebertz et al., 2002; Orriss et al., 2012). ATP at 10 and 100 μM was shown to inhibit the number of mineralized nodules by primary rat calvarial osteoblasts (Hoebertz et al., 2002). Furthermore, BzATP significantly decreased ALP activity in primary rat calvarial osteoblasts at 14 d (Orriss et al., 2012) and reduced nodule formation by primary human trabecular osteoblasts (Agrawal et al., 2017). A previous report demonstrated that ATP and BzATP can be hydrolyzed by ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1), resulting in increased extracellular pyrophosphate (PPi), a potent apatite formation inhibitor (Orriss et al., 2012). Therefore, the
171
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 3. OM-induced β-catenin-nuclear translocation was inhibited by BzATP and rhDKK1. Human MOBs were cultured in GM or OM and incubated with or without 5 μM BzATP or 100 ng/ml rhDKK1 for 4 d. Immunofluorescent staining for β-catenin showed that OM induced β-catenin translocation (indicated by arrows) into the nucleus (stained by DAPI). The addition of BzATP and rhDKK1 inhibited β-catenin nuclear translocation.
osteoblasts. Therefore, we propose a model of the effect of P2X7R activation on hMOB differentiation (Fig. 4C). In osteogenic medium, expression of WNT3A increases, which leads to β-catenin nuclear translocation. Subsequently, RUNX2 and OSX transcription is induced. When P2X7R is activated, β-catenin nuclear translocation and RUNX2 and OSX upregulation will be inhibited, thus inhibiting hMOB differentiation. In conclusion, our findings show that P2X7R activation inhibits human osteoblast differentiation. This inhibitory effect appears to depend on the WNT/β-catenin signaling pathway. These results suggest the influence of P2X7R signaling in regulating bone formation, especially in alveolar bone. Further study into the intracellular signaling resulting from P2X7R activation will provide valuable knowledge for alveolar bone regeneration.
(Rodrigues-Ribeiro, Alvarenga, Calio, Paredes-Gamero, & Ferreira, 2015) and WNT/β-catenin signaling (Grol et al., 2016). BzATP significantly increased ALP activity at 7 d in a preosteoblastic MC3T3-E1 cell line cultured in OM, and these results were attenuated by AZ11645373, a P2X7R antagonist. (Rodrigues-Ribeiro et al., 2015). The combination of Wnt3a and BzATP elicited more sustained β-catenin nuclear localization and transcriptional activity than those induced by Wnt3a alone (Grol et al., 2016). An important difference between those studies and ours is the use of cells from different species and origin. In previous studies, a mouse cell line was used, while we analyzed primary human osteoblasts. Furthermore, MC3T3-E1 cells are derived from the calvaria, while hMOBs were explanted from the mandible. Given these important differences, man versus mouse and primary cells versus a cell line, we assume that the response of these cells is likely to be different. Our results are in contrast to previous findings. Gartland et al. and Panupinthu et al. showed that P2X7R activation in osteoblasts generated pore formation and plasma membrane blebbing, resulting in apoptosis (Gartland, Hipskind, Gallagher, & Bowler, 2001; Panupinthu et al., 2007). However, an important difference between their studies and the present study is the concentration of BzATP used. We cultured the cells with 0.5–5 μM BzATP, whereas the studies mentioned above used 300–1000 μM BzATP; concentrations up to 200 times higher than those used in our study. We assume that these high concentrations of BzATP negatively affect the cells and induce apoptosis. Several studies have demonstrated the effects of P2X7R activation on osteoblast differentiation (Kariya et al., 2015; Orriss et al., 2012; Panupinthu et al., 2008; Rodrigues-Ribeiro et al., 2015). The present study demonstrated that BzATP reduced osteogenic marker gene expression and P2X7R knockdown abolished these effects. These results confirm the participation of the BzATP-P2X7R pathway in osteoblast differentiation. In addition, our data are the first to show a relationship between P2X7R activation and canonical WNT-signaling in human
Conflict of interest The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article. Ethical approval The protocol was approved by the Ethics Committee, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand. Acknowledgements This study was supported by the 2012 Research Chair Grant from the National Science and Technology Development Agency (NSTDA). We would like to thank Prof. Vincent Everts and Dr. Kevin Tompkins for their advice and language editing. 172
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 4. The BzATP-inhibited RUNX2 and OSX expression was rescued by rhWNT3A. Human MOBs were cultured in OM and then incubated with 5 μM BzATP with or without exogenous 50 or 100 ng/ml rhWNT3A for 4 d. (A) The rhWNT3A strongly stimulated RUNX2 and OSX expression in the BzATP-treated group. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM, # = p < 0.05 versus OM with BzATP. (B) At 14 d, rhWNT3A increased in vitro mineralization in the BzATP-treated group. (C) Schematic of our proposed mechanism. When hMOBs are in an osteogenic condition, WNT3A expression increases, leading to β-catenin nuclear translocation. Subsequently, RUNX2 and OSX transcription is induced. When P2X7R is activated by BzATP a specific P2X7R agonist, this process is inhibited, reducing hMOB differentiation. Ke, H. Z., Qi, H., Weidema, A. F., Zhang, Q., Panupinthu, N., Crawford, D. T., et al. (2003). Deletion of the P2X7 nucleotide receptor reveals its regulatory roles in bone formation and resorption. Molecular Endocrinology, 17(7), 1356–1367. Khonsuphap, P., Pavasant, P., Irwandi, R. A., Leethanakul, C., & Vacharaksa, A. (2017). Epithelial cells secrete interferon-gamma which suppresses expression of receptor activator of nuclear factor kappa-B ligand in human mandibular osteoblast-like cells. Journal of Periodontology, 88(3), e65–e74. Minear, S., Leucht, P., Jiang, J., Liu, B., Zeng, A., Fuerer, C., et al. (2010). Wnt proteins promote bone regeneration. Science Translational Medicine, 2, 29 [29ra30]. Morrison, M. S., Turin, L., King, B. F., Burnstock, G., & Arnett, T. R. (1998). ATP is a potent stimulator of the activation and formation of rodent osteoclasts. Journal of Physiology, 511(Pt. 2), 495–500. Nicke, A., Kuan, Y. H., Masin, M., Rettinger, J., Marquez-Klaka, B., Bender, O., et al. (2009). A functional P2X7 splice variant with an alternative transmembrane domain 1 escapes gene inactivation in P2X7 knock-out mice. Journal of Biological Chemistry, 284(38), 25813–25822. Orriss, I. R., Knight, G. E., Ranasinghe, S., Burnstock, G., & Arnett, T. R. (2006). Osteoblast responses to nucleotides increase during differentiation. Bone, 39(2), 300–309. Orriss, I., Syberg, S., Wang, N., Robaye, B., Gartland, A., Jorgensen, N., et al. (2011). Bone phenotypes of P2 receptor knockout mice. Frontiers in Bioscience (Scholar Edition), 3, 1038–1046. Orriss, I. R., Key, M. L., Brandao-Burch, A., Patel, J. J., Burnstock, G., & Arnett, T. R. (2012). The regulation of osteoblast function and bone mineralisation by extracellular nucleotides: The role of p2x receptors. Bone, 51(3), 389–400. Orriss, I. R., Arnett, T. R., & Russell, R. G. (2016). Pyrophosphate: A key inhibitor of mineralisation. Current Opinion in Pharmacology, 28, 57–68. Panupinthu, N., Zhao, L., Possmayer, F., Ke, H. Z., Sims, S. M., & Dixon, S. J. (2007). P2X7 nucleotide receptors mediate blebbing in osteoblasts through a pathway involving lysophosphatidic acid. Journal of Biological Chemistry, 282(5), 3403–3412. Panupinthu, N., Rogers, J. T., Zhao, L., Solano-Flores, L. P., Possmayer, F., Sims, S. M., et al. (2008). P2X7 receptors on osteoblasts couple to production of lysophosphatidic acid: A signaling axis promoting osteogenesis. Journal of Cell Biology, 181(5), 859–871. Rodrigues-Ribeiro, R., Alvarenga, E. C., Calio, M. L., Paredes-Gamero, E. J., & Ferreira, A. T. (2015). Dual role of P2 receptors during osteoblast differentiation. Cell Biochemistry and Biophysics, 71(2), 1225–1233. Romanello, M., Pani, B., Bicego, M., & D'Andrea, P. (2001). Mechanically induced ATP release from human osteoblastic cells. Biochemical and Biophysical Research
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.archoralbio.2017.05. 009. References Agrawal, A., Henriksen, Z., Syberg, S., Petersen, S., Aslan, D., Solgaard, M., et al. (2017). P2X7Rs are involved in cell death: Growth and cellular signaling in primary human osteoblasts. Bone, 95, 91–101. Gartland, A., Hipskind, R. A., Gallagher, J. A., & Bowler, W. B. (2001). Expression of a P2X7 receptor by a subpopulation of human osteoblasts. Journal of Bone and Mineral Research, 16(5), 846–856. Gartland, A., Buckley, K. A., Hipskind, R. A., Perry, M. J., Tobias, J. H., Buell, G., et al. (2003). Multinucleated osteoclast formation in vivo and in vitro by P2X7 receptordeficient mice? Critical Reviews in Eukaryotic Gene Expression, 13(2–4), 243–253. Grol, M. W., Panupinthu, N., Korcok, J., Sims, S. M., & Dixon, S. J. (2009). Expression, signaling, and function of P2X7 receptors in bone. Purinergic Signalling, 5(2), 205–221. Grol, M. W., Brooks, P. J., Pereverzev, A., & Dixon, S. J. (2016). P2X7 nucleotide receptor signaling potentiates the Wnt/beta-catenin pathway in cells of the osteoblast lineage. Purinergic Signalling, 12(3), 509–520. Hoebertz, A., Meghji, S., Burnstock, G., & Arnett, T. R. (2001). Extracellular ADP is a powerful osteolytic agent: Evidence for signaling through the P2Y(1) receptor on bone cells. FASEB Journal, 15(7), 1139–1148. Hoebertz, A., Mahendran, S., Burnstock, G., & Arnett, T. R. (2002). ATP and UTP at low concentrations strongly inhibit bone formation by osteoblasts: A novel role for the P2Y2 receptor in bone remodeling. Journal of Cellular Biochemistry, 86(3), 413–419. Hu, H., Hilton, M. J., Tu, X., Yu, K., Ornitz, D. M., & Long, F. (2005). Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development, 132(1), 49–60. Jones, S. J., Gray, C., Boyde, A., & Burnstock, G. (1997). Purinergic transmitters inhibit bone formation by cultured osteoblasts. Bone, 21(5), 393–399. Kariya, T., Tanabe, N., Shionome, C., Manaka, S., Kawato, T., Zhao, N., et al. (2015). Tension force-induced ATP promotes osteogenesis through P2X7 receptor in osteoblasts. Journal of Cellular Biochemistry, 116(1), 12–21.
173
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Altered cytokine production in mice lacking P2X(7) receptors. Journal of Biological Chemistry, 276(1), 125–132. Tompkins, K. A. (2011). Wnt proteins in mineralized tissue development and homeostasis. Connective Tissue Research, 52(6), 448–458. Zhong, Y., Dunn, P. M., Xiang, Z., Bo, X., & Burnstock, G. (1998). Pharmacological and molecular characterization of P2X receptors in rat pelvic ganglion neurons. British Journal of Pharmacology, 125(4), 771–781.
Communications, 289(5), 1275–1281. Rumney, R. M., Wang, N., Agrawal, A., & Gartland, A. (2012). Purinergic signalling in bone. Frontiers in Endocrinology (Lausanne), 3, 116. Sim, J. A., Young, M. T., Sung, H. Y., North, R. A., & Surprenant, A. (2004). Reanalysis of P2X7 receptor expression in rodent brain. Journal of Neuroscience, 24(28), 6307–6314. Solle, M., Labasi, J., Perregaux, D. G., Stam, E., Petrushova, N., Koller, B. H., et al. (2001).
174
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Purinergic 2X7 receptor activation regulates WNT signaling in human mandibular-derived osteoblasts
MARK
Pimrumpai Rochanakit Sindhavajivaa,b, Panunn Sastravahac, Mansuang Arksornnukitd, ⁎ Prasit Pavasantb,e, a
Graduate Program in Prosthodontics, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand c Department of Surgery, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand d Department of Prosthodontics, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand e Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand b
A R T I C L E I N F O
A B S T R A C T
Keywords: Adenosine triphosphate P2X7 receptor Human osteoblasts Bone mineralization WNT signaling pathway
Objective: Purinergic 2X7 receptor (P2X7R) activation modulates in vitro mineralization by primary rat and human osteoblasts. However, the detailed mechanism of how P2X7R activation affects primary human osteoblasts remains unclear. The aim of this study was to investigate the effect of P2X7R activation on human mandibular-derived osteoblast (hMOB) differentiation. Design: Primary human osteoblasts were obtained from non-pathologic mandibular bone from healthy patients. The hMOBs were cultured in osteogenic medium with or without 0.5–5 μM 2′(3′)-O-(4-benzoyl) benzoyl-ATP (BzATP), a selective P2X7R agonist. The mRNA expression of osteogenic differentiation markers and WNTsignaling molecules was investigated by quantitative real time polymerase chain reaction. In vitro mineral deposition was determined by Alizarin Red S staining. Transfection of small interfering RNA was performed to confirm the effect of P2X7R activation. WNT/β-catenin signaling was detected by immunofluorescence staining for β-catenin. Results: BzATP inhibited osteogenic medium-induced RUNX2 and OSX mRNA expression in hMOBs. Moreover, BzATP significantly retarded in vitro mineralization. These findings indicated that BzATP/P2X7R activation inhibited hMOB differentiation. Interestingly, reduced WNT3A mRNA expression and blockage of osteogenic medium-induced β-catenin nuclear translocation were also found. These data suggested that WNT signaling might be a target of P2X7R-regulated osteogenic differentiation. Furthermore, when recombinant human WNT3A was added to the BzATP-treated group, it rescued the reduced RUNX2 and OSX expression, and in vitro mineralization. Conclusion: Our results demonstrate that P2X7R activation by BzATP inhibits hMOB differentiation. This inhibitory effect was associated with inhibition of the WNT/β-catenin signaling pathway.
1. Introduction Mechanical stimulation of osteoblasts induces an efflux of adenosine triphosphate (ATP) into the extracellular environment (Romanello, Pani, Bicego, & D'Andrea, 2001; Rumney, Wang, Agrawal, & Gartland, 2012). Extracellular ATP differentially affects osteoblasts and osteoclasts. ATP has been shown to inhibit bone formation by rat osteoblasts by reducing osteogenic mRNA expression and in vitro mineralization (Hoebertz, Mahendran, Burnstock, & Arnett, 2002; Jones, Gray, Boyde, & Burnstock, 1997; Orriss et al., 2006); however, it stimulated
osteoclast resorptive activity (Hoebertz, Meghji, Burnstock, & Arnett, 2001; Morrison, Turin, King, Burnstock, & Arnett, 1998). Extracellular ATP is sensed by cells via the purinergic 2 or P2 receptors (P2R). P2R in the human genome contains 7 P2X and 8 P2Y receptor subtypes (Orriss et al., 2011). Among the P2R subtypes, the P2X7 receptor (P2X7R) plays an important role in osteogenic differentiation (Grol, Panupinthu, Korcok, Sims, & Dixon, 2009). Functional P2X7R was found in situ in murine and human osteoblastic cells (Agrawal et al., 2017; Panupinthu et al., 2008). During proliferation and differentiation, the level of P2X7R protein increased in primary rat
Abbreviations: hMOBs, human mandibular-derived osteoblasts; GM, growth medium; OM, osteogenic medium ⁎ Corresponding author at: Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand. E-mail address: [email protected] (P. Pavasant). http://dx.doi.org/10.1016/j.archoralbio.2017.05.009 Received 31 January 2017; Received in revised form 16 May 2017; Accepted 16 May 2017 0003-9969/ © 2017 Elsevier Ltd. All rights reserved.
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
2. Materials and methods
calvarial osteoblasts (Orriss et al., 2012). The involvement of this ATP receptor in bone formation was shown by activating P2X7R using 2′(3′)O-(4-benzoyl) benzoyl-ATP (BzATP), a selective P2X7R agonist (Zhong, Dunn, Xiang, Bo, & Burnstock, 1998). Under these conditions, the in vitro formation of mineralized nodules decreased (Agrawal et al., 2017; Orriss et al., 2012). P2X7R deficient mice have generated disparate phenotypes. In one study using these mice, a significant reduction was found in femoral total and cortical bone content (Ke et al., 2003). In another study, thicker cortical bone was reported without significant changes in bone mineral density or trabecular bone (Gartland et al., 2003). These contradictory results might be due to the deletion of different regions of the P2X7R gene, i.e. C-terminal amino acid 506–532 deletion versus inserting a LacZ gene at the beginning of P2X7R exon 1 (Grol et al., 2009; Orriss et al., 2011; Sim, Young, Sung, North, & Surprenant, 2004; Solle et al., 2001). Moreover, a P2X7R splice variant was found in some KO mouse tissues (Nicke et al., 2009). However, because P2X7R protein was not detected in either model (Sim et al., 2004), the detailed mechanism of how P2X7R regulates bone hemostasis is still unknown. The effect of P2X7R activity likely results from a cascade of events; one of which may depend on WNT signaling. This pathway is wellknown to be involved in osteoblast differentiation. WNT signaling occurs via both canonical and non-canonical pathways (Tompkins, 2011). Among the WNT canonical signaling proteins, WNT3a protein is expressed by osteoblasts and plays a role in the canonical or WNT/βcatenin signaling pathway (Hu et al., 2005). Generally, WNT3a signaling leads to an increased level of β-catenin in the cytoplasm. β-catenin subsequently translocates to the nucleus, where it binds to T cell factor/ lymphoid enhancer factor and induces the expression of genes involved in osteogenic differentiation. These genes include Runt-related transcription factor 2 (Runx2) and Osterix (Osx), which eventually results in increased bone formation (Minear et al., 2010). The association of P2X7R activation and WNT signaling was investigated in MC3T3-E1 cells (Grol, Brooks, Pereverzev, & Dixon, 2016). This study demonstrated that P2X7R activation by BzATP prolonged and potentiated WNT/β-catenin signaling. Although there are studies focusing on ATP-activated P2X7R in osteoblasts, the possible involvement of the WNT signaling pathway in human osteoblasts has not been explored. Therefore, the aim of the present study was to investigate the influence of P2X7R on the WNT signaling pathway and the osteogenic differentiation of primary human mandibular-derived osteoblasts (hMOBs). The knowledge gained in this study will be beneficial for bone healing and regeneration treatment, especially in alveolar bone.
2.1. Sample collection Human MOBs were obtained as previously described (Khonsuphap, Pavasant, Irwandi, Leethanakul, & Vacharaksa, 2017). The protocol was approved by the Ethics Committee, Faculty of Dentistry, Chulalongkorn University, Thailand. After obtaining informed consent, mandibular alveolar bone was collected from tooth extraction sites of healthy patients aged 25–35 years at the Department of Surgery, Faculty of Dentistry, Chulalongkorn University. Only alveolar bone from extraction sites without infection and inflammation was collected for this study. The alveolar bone was kept in a sterile tube containing growth medium (GM), which was composed of 1000 mg/L glucose Dulbecco’s Modified Eagle’s Medium (Gibco, BRL, Carlsbad, CA) containing 15% (v/v) fetal bovine serum (HyClone, Thermo Scientific, Logan, UT), 2 mM L-glutamine (Gibco), 100 units/ml Penicillin (Gibco), 100 μg/ml Streptomycin (Gibco), and 5 μg/ml Amphotericin B (Gibco). 2.2. Cell culture The alveolar bone samples were washed with phosphate buffered saline and any soft tissue was removed using a surgical blade. The samples were cut into 3 × 3 mm pieces and placed in 35 mm culture dishes (Corning, New York, NY). The explants were cultured in GM and incubated at 37 °C in a 5% CO2 humidified atmosphere. Medium was replaced every 2 days. After reaching 80% confluence, the hMOBs were subcultured at a 1:3 ratio. Cells from passages 3–8 were used in the experiments. Human MOBs obtained from at least 3 different patients were used as biological replication. 2.3. Osteogenic differentiation The hMOBs (7 × 104 cells/well) were cultured in GM in 24-well plates (Corning) overnight. The GM was replaced by osteogenic medium (OM), which was GM supplemented with 50 μg/ml ascorbic acid (Sigma-Aldrich Chemical, St Louis, MO), 100 nM dexamethasone (Sigma-Aldrich Chemical), and 10 mM β-glycerophosphate (SigmaAldrich Chemical). To investigate the effect of ATP and BzATP on osteogenic differentiation, hMOBs were cultured for 4 and 14 d in OM with or without 0.1, 1, or 10 μM ATP (Sigma-Aldrich Chemical) or 0.5, 2.5, or 5 μM BzATP (Tocris Bioscience, United Kingdom). BzATP was used because ATP can activate additional receptors, while BzATP is a P2X7R-specific agonist. OM was replaced every 2 d. The following osteogenic markers
Table 1 Oligonucleotide sequences. Gene
Accession no.
Primer sequence
Size (bp)
COL I
NM000088.3
128
BSP
NM004967.3
RUNX2
NM001024630.3
OSX
NM001300837.1
WNT3A
NM033131.3
WNT5A
NM003392.4
P2X7R
NR033955.1
18S
NR003286.2
Forward: 5' GTGCTAAAGGTGCCAATGGT 3' Reverse: 5' ACCAGGTTCACCGCTGTTAC 3' Forward: 5' ATGGCCTGTGCTTTCTCAATG 3' Reverse: 5' AGGATAAAAGTAGGCATGCTTG 3' Forward: 5' ATGATGACACTGCCACCTCTGA 3' Reverse: 5' GGCTGGATAGTGCATTCGTG 3' Forward: 5' GCCAGAAGCTGTGAAACCTC 3' Reverse: 5' GCTGCAAGCTCTGCATAACC3' Forward: 5' CTGTTGGGCCACAGTATTCC 3' Reverse: 5' GGGCATGATCTCCACGTAGT 3' Forward: 5' TCAGGCACCATTAAACCAGA 3' Reverse: 5' AATTCACAGAGGTGTTGCAGC 3' Forward: 5' AAGCTGTACCAGCGGAAAGA 3' Reverse: 5' GCTCTTGGCCTTCTGTTTTG 3' Forward: 5' GGCGTCCCCCAACTTCTTA 3' Reverse: 5' GGGCATCACAGACCTGTTATT 3'
168
125 167 161 113 159 202 76
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
(LipofectamineTM2000 Reagent, Invitrogen, Carlsbad, CA) for 24 h prior to the experiment. Cells treated with 4 μl of control siRNA (siC) (1:250; Santa Cruz Biotechnology) and 6 μl of transfection reagent were used as control.
were assessed: COLIA1, BSP, RUNX2, and OSX (the primer sequences are shown in Table 1). An alkaline phosphatase (ALP) activity assay was performed. In vitro mineralization was investigated using Alizarin Red S staining. To determine the role of WNT/β-catenin signaling, 50 or 100 ng/ml rhWNT3A (R & D Systems, Minneapolis, MA) and 100 ng/ml rhDICKOFF 1 (rhDKK1) (R & D Systems), a WNT/β-catenin antagonist, were used. The osteogenic gene expression patterns were investigated after 4 d of culture.
2.9. Immunofluorescence staining for β-catenin
Cells were cultured in OM for 14 d, fixed in −20 °C methanol, and stained with 1% Alizarin Red S solution (Sigma-Aldrich Chemical). The amount of calcium deposition was quantified by eluting the staining with 10% cetylpyridinium chloride monohydrate (Sigma-Aldrich Chemical) in 10 mM sodium phosphate (Sigma-Aldrich Chemical). The absorbance was measured at 570 nm using a microplate reader (ELx800, Biotek, Winooski, VT).
Human MOBs were cultured in GM or OM with or without 5 μM BzATP or 100 ng/ml rhDKK1 for 4 d. The cells were fixed with cold methanol and incubated with 10% (v/v) horse serum in PBS for 1 h to prevent nonspecific antibody binding. The cells were incubated with the primary antibody, Rabbit anti-human β-catenin polygonal antibody (EMD Millipore, Temecula, CA) at a 1:500 dilution for 3 h at 37 °C followed by a 1:500 dilution of biotinylated-secondary antibody (Abcam, Cambridge, MA) for 45 min. β-Catenin detection was perform using streptavidin-FITC (Sigma). Cell nuclei were stained with DAPI. The fluorescence was evaluated by fluorescence microscope (Axio Oserver.Z1, Zeiss, Jena, Germany). As a negative control, the primary antibody was omitted from the staining method.
2.5. Alkaline phosphatase activity assay
2.10. Statistical analysis
Human MOBs were lysed in a pH 8 lysis buffer. The cell lysates were incubated at 37 °C in a solution containing 2 mg/ml p-nitrophenol phosphate (Life Technologies Corp, Frederick, MD), 0.1 M 2-amino2methyl-1-propanol (Life Technologies Corp) and 2 mM MgCl2 (Life Technologies Corp). After 15 min, 50 mM NaOH (Emsure, Merck, Darmstadt, Germany) was added to stop the reaction. The presence of p-nitrophenol was measured at an absorbance of 410 nM using a microplate reader (ELx800, Biotek) Total cellular protein was determined by a BCA assay (Thermo Scientific Rockford, IL, USA). The enzyme activity was expressed per total cellular protein.
The experiments were performed in triplicate, with the data represented as mean ± standard deviation (SD). The data were analyzed by one-way analysis of variance using statistical software (SPSS Version 22, Chicago, IL). Scheffé’s test was used for post hoc analysis.
2.4. In vitro mineralization assay
3. Results 3.1. hMOB characterization Human MOBs expressed COL I, BSP, RUNX2, and OSX mRNA and ALP activity in GM, which significantly increased when the hMOBs were cultured in OM (Fig. 1A). Alizarin Red S staining showed that hMOBs formed mineralized nodules after 14 days in OM. These data indicate that the cultured cells demonstrate osteoblast characteristics.
2.6. MTT assay To investigate cell viability and proliferation, an MTT assay was performed at 1, 3, and 7 d. The hMOB proliferation/viability was analyzed using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) (USB Corp., Cleveland, OH). The formazan crystals were dissolved, and quantified using an absorbance microplate reader at 540 nm (ELx800, Biotek).
3.2. WNT/β-catenin regulated hMOB RUNX2 and OSX mRNA expression To investigate the role of WNT signaling in hMOB differentiation, the expression pattern of WNT signaling-related genes was determined (Fig. 1B). The results showed significantly increased WNT3A expression by cells cultured in OM compared with GM at 1 d and 4 d. Under these conditions, WNT5A expression significantly decreased. These results suggest the involvement of WNT3A and WNT/β-catenin signaling in hMOB differentiation. To clarify the role of WNT/β-catenin, rhDKK1, a WNT/β-catenin antagonist was used. The results showed a significant reduction in RUNX2 and OSX expression in the rhDKK1-treated group at 4 d (Fig. 1C). These data demonstrate that WNT/β-catenin signaling is involved in hMOB differentiation by regulating RUNX2 and OSX expression.
2.7. RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) Human MOBs (3 × 105 cells) were cultured in 6-well plate. Total RNA was extracted using 1 ml of RiboEx™ lysis reagent (Geneall Biotechnology Co., Ltd, Seoul, Korea) according to the manufacturer’s instructions. One μg of mRNA from each sample was reverse transcribed to cDNA using Improm-II™ (Promega, Madison, WI). Subsequently, qRT-PCR was performed using a miniOpticon RealTime PCR Detection System (Bio-Rad, Singapore) with a FastStart Essential DNA Green Master kit (Roche Diagnostics, Indianapolis, IN). The oligonucleotide sequences used in this study were shown in Table 1. The PCR protocol was: denaturation at 94 °C for 10 s, annealing at 60 °C for 10 s, and extension at 72 °C for 10 s for 45 cycles. Gene expression was normalized to the 18S ribosome expression and further normalized to the control of each experiment. Bio-Rad CFC Manager3.1 (Bio-Rad) was used to determine relative gene expression.
3.3. BzATP had no effect on cell proliferation, but decreased in vitro mineralization To determine the influence of P2X7R activation on hMOB differentiation, cells were cultured with BzATP, a selective P2X7R agonist (Fig. 2). MTT analysis showed that none of the BzATP concentrations used affected hMOB proliferation or viability as assessed at 1, 3, and 7 d (Fig. 2A). Next, we analyzed the effect of BzATP on in vitro mineralization by assessing the level of Alizarin Red S staining. The results showed that BzATP inhibited in vitro mineralization in a dose-dependent manner. This result corresponded with the inhibitory effect of ATP in ATP-
2.8. Small interfering RNA (siRNA) transfection Human MOBs were cultured in antibiotic-free growth medium until 70–80% confluent. The cells were treated with a solution of 4 μl of P2X7R siRNA (siP2X7R) oligonucleotide (1:250; Santa Cruz Biotechnology, Santa Cruz, CA) and 6 μl of transfection reagent 169
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 1. Human MOB characteristics. Cells were cultured in growth medium (GM) or osteogenic medium (OM). (A) Osteogenic marker genes were determined by qRT-PCR and ALP activity was evaluated at 4 d. Alizarin Red S staining was performed to investigate in vitro mineralization at 14 d. (B) The mRNA expression of WNT-signaling molecules was determined by qRT-PCR at 1 and 4 d. Although WNT3A expression significantly increased, WNT5A expression significantly decreased. (C) The rhDKK1 significantly inhibited RUNX2 and OSX expression. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus GM, # = p < 0.05 versus OM.
in hMOBs treated with BzATP, the level of nuclear β-catenin was strongly decreased (Fig. 3). BzATP appeared to prevent the translocation induced by OM. A similar effect was seen with rhDKK1 treatment. Under these conditions, the translocation of β-catenin to the nucleus was also prevented. These results demonstrate that BzATP inhibits WNT/β-catenin signaling pathway activation.
treated groups (Fig. 2A, Supplementary Fig. S1). Because all BzATP concentrations used in this experiment inhibited in vitro mineralization and none affected cell proliferation, the highest concentration, 5 μM BzATP, was selected for use in further experiments. 3.4. BzATP decreased WNT3A, RUNX2 and OSX mRNA expression
3.6. Exogenous rhWNT3A rescued the reduction in RUNX2 and OSX expression induced by BzATP
Osteoblasts were cultured in OM containing BzATP for 4 d and the mRNA expression level of WNT3A, WNT5A, RUNX2, and OSX was assessed. BzATP significantly decreased the expression of each of these genes, with the exception of WNT5A (Fig. 2B). To further assess the role of P2X7R activation in reducing the expression of WNT3A, WNT5A, RUNX2, and OSX, siP2X7R was used to block P2X7R synthesis (Fig. 2C). The results showed that siP2X7R reduced the level of P2X7R mRNA by 70%. Although BzATP significantly increased WNT3A, RUNX2, and OSX expression in cells transfected with siP2X7R, there was no significant change in WNT5A expression.
We then analyzed the role of WNT3A on the effect of BzATP on hMOBs. The hMOBs were cultured in OM and then incubated with BzATP with or without exogenous rhWNT3A. The results showed that rhWNT3A strongly stimulated RUNX2 and OSX expression (Fig. 4A). The decreased expression of RUNX2 and OSX induced by BzATP was entirely counteracted by rhWNT3A (Fig. 4A). In line with the increased expression of the osteogenesis related genes, an increased in vitro mineralization in the BzATP-rhWNT3A-treated groups was observed (Fig. 4B, Supplementary Fig. S2).
3.5. BzATP prevented β-catenin nuclear translocation 4. Discussion The WNT/β-catenin signaling pathway is activated by WNT3A. Under these conditions, β-catenin translocates from the cytoplasm to the nucleus. To investigate whether this also occurs in our osteoblasts when cultured in OM, the intracellular location of β-catenin was evaluated by immunocytochemistry. Immune-localization showed that
In this study, we demonstrated that P2X7R activation using BzATP inhibited hMOB differentiation. These results showed, for the first time, that P2X7R activation in hMOBs inhibited WNT/β-catenin signaling, resulting in reduced RUNX2 and OSX expression, essential genes in 170
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 2. BzATP signaling regulated hMOB differentiation. (A) The hMOBs were cultured in OM and cultured with 0.1, 1, or 10 μM ATP, or 0.5, 2.5, or 5 μM BzATP. Cells cultured in OM without ATP and BzATP served as control. To test cell viability, an MTT assay was performed at 1, 3, and 7 d. BzATP had no effect on hMOB viability. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM. In vitro mineralized nodules were stained with Alizarin Red S at 14 d. ATP and BzATP inhibited in vitro mineralization in a dose-dependent manner. (B) Effect of BzATP on WNT3A, WNT5A, RUNX2, and OSX mRNA expression. The hMOBs were cultured in OM with or without 5 μM BzATP. The mRNA expression was assessed by qRT-PCR at 4 d. WNT3A, RUNX2, and OSX expression in the BzATP-treated group significantly decreased. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM. (C) P2X7R synthesis was blocked using siP2X7R. The siP2X7R reduced the level of P2X7R by 70%. Although BzATP significantly increased WNT3A, RUNX2, and OSX expression in the siP2X7R-treated cells, there was no significant change in WNT5A expression. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus siC in OM.
inhibition of mineralization by BzATP may also occur via increased PPi. The effects of BzATP and phosphate generating enzymes cannot be excluded. However, the regulation of phosphate metabolism is complex. The participation of other genes, e.g. progressive ankylosis protein homolog (ANKH), and sodium-dependent Pi symporter 1 (PIT1), could also influence the extracellular phosphate/pyrophosphate ratio, leading to changes in the final molecular and cell response (Orriss, Arnett, & Russell, 2016). Therefore, the interaction of BzATP-P2X7 and BzATP-phosphate generating enzyme pathway in hMOBs requires further investigation. Using P2X7R siRNA, we determined that the reduced WNT3A, RUNX2, and OSX expression resulted from P2X7R signaling. Interestingly, under these conditions, BzATP increased WNT3A, RUNX2, and OSX expression. This finding suggests, in addition to P2X7R, the existence of an alternative signaling pathway induced by BzATP. BzATP has been reported to partially activate P2X1 (P2X1R) and P2Y1 receptor (P2Y1R) (Zhong et al., 1998); however, these receptors differentially affected osteoblast differentiation (Orriss et al., 2011; Orriss et al., 2012). Moreover, our results indicated that P2X1R and P2Y1R mRNA expression significantly increased in cells transfected with siP2X7R (Supplementary Fig. S3). Therefore, we hypothesize that when P2X7R expression is reduced, BzATP can alternatively activate P2X1R or P2Y1R, resulting in increased osteogenic gene expression. Interestingly, P2X7R activation was recently found to have a stimulating, rather than an inhibiting, effect on in vitro mineralization
osteoblast differentiation. BzATP was shown to down-regulate expression of WNT3A. WNT signaling plays an important role in osteoblast differentiation (Tompkins, 2011). We found an upregulation of WNT3A expression in hMOBs cultured in OM. This increased expression coincided with increased RUNX2 and OSX expression. Because DKK1, a canonical WNT-signaling inhibitor, inhibited the increase in RUNX2 and OSX expression, our findings strongly suggest the role of WNT3A in the upregulation of these two genes. Immunohistochemistry confirmed that BzATP inhibited β-catenin nuclear translocation, an important canonical WNT signaling pathway mechanism. Our results suggest that P2X7R activation inhibits hMOB differentiation by down-regulating the canonical WNT signaling pathway. The inhibitory effect of ATP and P2X7R activation on mineralization by hMOBs we observed agrees with the results obtained from primary rat and human osteoblasts (Agrawal et al., 2017; Hoebertz et al., 2002; Orriss et al., 2012). ATP at 10 and 100 μM was shown to inhibit the number of mineralized nodules by primary rat calvarial osteoblasts (Hoebertz et al., 2002). Furthermore, BzATP significantly decreased ALP activity in primary rat calvarial osteoblasts at 14 d (Orriss et al., 2012) and reduced nodule formation by primary human trabecular osteoblasts (Agrawal et al., 2017). A previous report demonstrated that ATP and BzATP can be hydrolyzed by ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1), resulting in increased extracellular pyrophosphate (PPi), a potent apatite formation inhibitor (Orriss et al., 2012). Therefore, the
171
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 3. OM-induced β-catenin-nuclear translocation was inhibited by BzATP and rhDKK1. Human MOBs were cultured in GM or OM and incubated with or without 5 μM BzATP or 100 ng/ml rhDKK1 for 4 d. Immunofluorescent staining for β-catenin showed that OM induced β-catenin translocation (indicated by arrows) into the nucleus (stained by DAPI). The addition of BzATP and rhDKK1 inhibited β-catenin nuclear translocation.
osteoblasts. Therefore, we propose a model of the effect of P2X7R activation on hMOB differentiation (Fig. 4C). In osteogenic medium, expression of WNT3A increases, which leads to β-catenin nuclear translocation. Subsequently, RUNX2 and OSX transcription is induced. When P2X7R is activated, β-catenin nuclear translocation and RUNX2 and OSX upregulation will be inhibited, thus inhibiting hMOB differentiation. In conclusion, our findings show that P2X7R activation inhibits human osteoblast differentiation. This inhibitory effect appears to depend on the WNT/β-catenin signaling pathway. These results suggest the influence of P2X7R signaling in regulating bone formation, especially in alveolar bone. Further study into the intracellular signaling resulting from P2X7R activation will provide valuable knowledge for alveolar bone regeneration.
(Rodrigues-Ribeiro, Alvarenga, Calio, Paredes-Gamero, & Ferreira, 2015) and WNT/β-catenin signaling (Grol et al., 2016). BzATP significantly increased ALP activity at 7 d in a preosteoblastic MC3T3-E1 cell line cultured in OM, and these results were attenuated by AZ11645373, a P2X7R antagonist. (Rodrigues-Ribeiro et al., 2015). The combination of Wnt3a and BzATP elicited more sustained β-catenin nuclear localization and transcriptional activity than those induced by Wnt3a alone (Grol et al., 2016). An important difference between those studies and ours is the use of cells from different species and origin. In previous studies, a mouse cell line was used, while we analyzed primary human osteoblasts. Furthermore, MC3T3-E1 cells are derived from the calvaria, while hMOBs were explanted from the mandible. Given these important differences, man versus mouse and primary cells versus a cell line, we assume that the response of these cells is likely to be different. Our results are in contrast to previous findings. Gartland et al. and Panupinthu et al. showed that P2X7R activation in osteoblasts generated pore formation and plasma membrane blebbing, resulting in apoptosis (Gartland, Hipskind, Gallagher, & Bowler, 2001; Panupinthu et al., 2007). However, an important difference between their studies and the present study is the concentration of BzATP used. We cultured the cells with 0.5–5 μM BzATP, whereas the studies mentioned above used 300–1000 μM BzATP; concentrations up to 200 times higher than those used in our study. We assume that these high concentrations of BzATP negatively affect the cells and induce apoptosis. Several studies have demonstrated the effects of P2X7R activation on osteoblast differentiation (Kariya et al., 2015; Orriss et al., 2012; Panupinthu et al., 2008; Rodrigues-Ribeiro et al., 2015). The present study demonstrated that BzATP reduced osteogenic marker gene expression and P2X7R knockdown abolished these effects. These results confirm the participation of the BzATP-P2X7R pathway in osteoblast differentiation. In addition, our data are the first to show a relationship between P2X7R activation and canonical WNT-signaling in human
Conflict of interest The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article. Ethical approval The protocol was approved by the Ethics Committee, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand. Acknowledgements This study was supported by the 2012 Research Chair Grant from the National Science and Technology Development Agency (NSTDA). We would like to thank Prof. Vincent Everts and Dr. Kevin Tompkins for their advice and language editing. 172
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Fig. 4. The BzATP-inhibited RUNX2 and OSX expression was rescued by rhWNT3A. Human MOBs were cultured in OM and then incubated with 5 μM BzATP with or without exogenous 50 or 100 ng/ml rhWNT3A for 4 d. (A) The rhWNT3A strongly stimulated RUNX2 and OSX expression in the BzATP-treated group. Data are shown as mean ± SD, n = 3, * = p < 0.05 versus OM, # = p < 0.05 versus OM with BzATP. (B) At 14 d, rhWNT3A increased in vitro mineralization in the BzATP-treated group. (C) Schematic of our proposed mechanism. When hMOBs are in an osteogenic condition, WNT3A expression increases, leading to β-catenin nuclear translocation. Subsequently, RUNX2 and OSX transcription is induced. When P2X7R is activated by BzATP a specific P2X7R agonist, this process is inhibited, reducing hMOB differentiation. Ke, H. Z., Qi, H., Weidema, A. F., Zhang, Q., Panupinthu, N., Crawford, D. T., et al. (2003). Deletion of the P2X7 nucleotide receptor reveals its regulatory roles in bone formation and resorption. Molecular Endocrinology, 17(7), 1356–1367. Khonsuphap, P., Pavasant, P., Irwandi, R. A., Leethanakul, C., & Vacharaksa, A. (2017). Epithelial cells secrete interferon-gamma which suppresses expression of receptor activator of nuclear factor kappa-B ligand in human mandibular osteoblast-like cells. Journal of Periodontology, 88(3), e65–e74. Minear, S., Leucht, P., Jiang, J., Liu, B., Zeng, A., Fuerer, C., et al. (2010). Wnt proteins promote bone regeneration. Science Translational Medicine, 2, 29 [29ra30]. Morrison, M. S., Turin, L., King, B. F., Burnstock, G., & Arnett, T. R. (1998). ATP is a potent stimulator of the activation and formation of rodent osteoclasts. Journal of Physiology, 511(Pt. 2), 495–500. Nicke, A., Kuan, Y. H., Masin, M., Rettinger, J., Marquez-Klaka, B., Bender, O., et al. (2009). A functional P2X7 splice variant with an alternative transmembrane domain 1 escapes gene inactivation in P2X7 knock-out mice. Journal of Biological Chemistry, 284(38), 25813–25822. Orriss, I. R., Knight, G. E., Ranasinghe, S., Burnstock, G., & Arnett, T. R. (2006). Osteoblast responses to nucleotides increase during differentiation. Bone, 39(2), 300–309. Orriss, I., Syberg, S., Wang, N., Robaye, B., Gartland, A., Jorgensen, N., et al. (2011). Bone phenotypes of P2 receptor knockout mice. Frontiers in Bioscience (Scholar Edition), 3, 1038–1046. Orriss, I. R., Key, M. L., Brandao-Burch, A., Patel, J. J., Burnstock, G., & Arnett, T. R. (2012). The regulation of osteoblast function and bone mineralisation by extracellular nucleotides: The role of p2x receptors. Bone, 51(3), 389–400. Orriss, I. R., Arnett, T. R., & Russell, R. G. (2016). Pyrophosphate: A key inhibitor of mineralisation. Current Opinion in Pharmacology, 28, 57–68. Panupinthu, N., Zhao, L., Possmayer, F., Ke, H. Z., Sims, S. M., & Dixon, S. J. (2007). P2X7 nucleotide receptors mediate blebbing in osteoblasts through a pathway involving lysophosphatidic acid. Journal of Biological Chemistry, 282(5), 3403–3412. Panupinthu, N., Rogers, J. T., Zhao, L., Solano-Flores, L. P., Possmayer, F., Sims, S. M., et al. (2008). P2X7 receptors on osteoblasts couple to production of lysophosphatidic acid: A signaling axis promoting osteogenesis. Journal of Cell Biology, 181(5), 859–871. Rodrigues-Ribeiro, R., Alvarenga, E. C., Calio, M. L., Paredes-Gamero, E. J., & Ferreira, A. T. (2015). Dual role of P2 receptors during osteoblast differentiation. Cell Biochemistry and Biophysics, 71(2), 1225–1233. Romanello, M., Pani, B., Bicego, M., & D'Andrea, P. (2001). Mechanically induced ATP release from human osteoblastic cells. Biochemical and Biophysical Research
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.archoralbio.2017.05. 009. References Agrawal, A., Henriksen, Z., Syberg, S., Petersen, S., Aslan, D., Solgaard, M., et al. (2017). P2X7Rs are involved in cell death: Growth and cellular signaling in primary human osteoblasts. Bone, 95, 91–101. Gartland, A., Hipskind, R. A., Gallagher, J. A., & Bowler, W. B. (2001). Expression of a P2X7 receptor by a subpopulation of human osteoblasts. Journal of Bone and Mineral Research, 16(5), 846–856. Gartland, A., Buckley, K. A., Hipskind, R. A., Perry, M. J., Tobias, J. H., Buell, G., et al. (2003). Multinucleated osteoclast formation in vivo and in vitro by P2X7 receptordeficient mice? Critical Reviews in Eukaryotic Gene Expression, 13(2–4), 243–253. Grol, M. W., Panupinthu, N., Korcok, J., Sims, S. M., & Dixon, S. J. (2009). Expression, signaling, and function of P2X7 receptors in bone. Purinergic Signalling, 5(2), 205–221. Grol, M. W., Brooks, P. J., Pereverzev, A., & Dixon, S. J. (2016). P2X7 nucleotide receptor signaling potentiates the Wnt/beta-catenin pathway in cells of the osteoblast lineage. Purinergic Signalling, 12(3), 509–520. Hoebertz, A., Meghji, S., Burnstock, G., & Arnett, T. R. (2001). Extracellular ADP is a powerful osteolytic agent: Evidence for signaling through the P2Y(1) receptor on bone cells. FASEB Journal, 15(7), 1139–1148. Hoebertz, A., Mahendran, S., Burnstock, G., & Arnett, T. R. (2002). ATP and UTP at low concentrations strongly inhibit bone formation by osteoblasts: A novel role for the P2Y2 receptor in bone remodeling. Journal of Cellular Biochemistry, 86(3), 413–419. Hu, H., Hilton, M. J., Tu, X., Yu, K., Ornitz, D. M., & Long, F. (2005). Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development, 132(1), 49–60. Jones, S. J., Gray, C., Boyde, A., & Burnstock, G. (1997). Purinergic transmitters inhibit bone formation by cultured osteoblasts. Bone, 21(5), 393–399. Kariya, T., Tanabe, N., Shionome, C., Manaka, S., Kawato, T., Zhao, N., et al. (2015). Tension force-induced ATP promotes osteogenesis through P2X7 receptor in osteoblasts. Journal of Cellular Biochemistry, 116(1), 12–21.
173
Archives of Oral Biology 81 (2017) 167–174
P.R. Sindhavajiva et al.
Altered cytokine production in mice lacking P2X(7) receptors. Journal of Biological Chemistry, 276(1), 125–132. Tompkins, K. A. (2011). Wnt proteins in mineralized tissue development and homeostasis. Connective Tissue Research, 52(6), 448–458. Zhong, Y., Dunn, P. M., Xiang, Z., Bo, X., & Burnstock, G. (1998). Pharmacological and molecular characterization of P2X receptors in rat pelvic ganglion neurons. British Journal of Pharmacology, 125(4), 771–781.
Communications, 289(5), 1275–1281. Rumney, R. M., Wang, N., Agrawal, A., & Gartland, A. (2012). Purinergic signalling in bone. Frontiers in Endocrinology (Lausanne), 3, 116. Sim, J. A., Young, M. T., Sung, H. Y., North, R. A., & Surprenant, A. (2004). Reanalysis of P2X7 receptor expression in rodent brain. Journal of Neuroscience, 24(28), 6307–6314. Solle, M., Labasi, J., Perregaux, D. G., Stam, E., Petrushova, N., Koller, B. H., et al. (2001).
174