Pyrene degradation by Chlorella sp. MM3 in liquid medium and soil slurry: Possible role of dihydrolipoamide acetyltransferase in pyrene biodegradation

Algal Research 23 (2017) 223–232

Contents lists available at ScienceDirect

Algal Research journal homepage: www.elsevier.com/locate/algal

Pyrene degradation by Chlorella sp. MM3 in liquid medium and soil slurry: Possible role of dihydrolipoamide acetyltransferase in pyrene biodegradation Suresh R. Subashchandrabose a,c, Panneerselvan Logeshwaran a,c, Kadiyala Venkateswarlu b,1, Ravi Naidu a,c, Mallavarapu Megharaj a,c,⁎ a b c

Global Centre for Environmental Remediation (GCER), Faculty of Science, University of Newcastle, Callaghan, NSW 2308, Australia Department of Microbiology, Sri Krishnadevaraya University, Anantapur 515055, India CRC CARE, Newcastle University LPO, PO Box 18, Callaghan, NSW 2308, Australia

a r t i c l e

i n f o

Article history: Received 19 September 2016 Received in revised form 20 January 2017 Accepted 27 February 2017 Available online xxxx Keywords: Pyrene biodegradation Chlorella sp. MM3 Bioremediation Soil slurry Immobilization Surfactants

a b s t r a c t Microalgae inhabiting the real contaminated sites are capable of degrading organic pollutants. In the present study, the potential of a microalga, Chlorella ssp. MM3, a soil isolate from a former cattle dip site, was assessed in degrading pyrene both in aqueous medium and soil slurry. Strain MM3 can grow on pyrene in culture medium at concentrations as high as 250 μM. When grown in presence of 50 μM pyrene, the cell density increased from 1.1 × 105 cells mL−1 to 16.45 × 105 cells mL−1 within 7 days. With an initial cell density of 3 × 107 cells mL−1, nearly 70% of 50 μM pyrene was degraded after 7 days of incubation. When compared with Triton X-100, Tween 80 was a better non-ionic surfactant for pyrene biodegradation. Nearly 20% increase in degradation of pyrene was observed with the use of 0.005% Tween 80. Differential protein expression in pyrene-grown cells of the microalga resulted in distinct accumulation of dihydrolipoamide acetyltransferase (or dihydrolipoyl transacetylase), one of the three components of pyruvate dehydrogenase complex, indicating a possible role of this enzyme in microalgal degradation of pyrene. The microalgal cells immobilized in calcium alginate completely degraded 50 μM of pyrene within 10 days in nonsterile soil slurry treated with 0.005% Tween 80. Our results clearly indicate that the strain MM3 has a great potential for its use in remediating soils contaminated with pyrene. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Polyaromatic hydrocarbons (PAHs), a class of hazardous toxic chemicals, are released into the environment either naturally or through anthropogenic activities. Due to industrial activities, former manufactured gas plant (MGP) sites are one of the major sources of PAHs in the environment. Between 1820 and 1950, MGPs were the major energy sources for domestic and industrial purposes. Most of these sites have been abandoned following closure of MGP activities, and these sites are currently a major source for PAH contaminants [1]. PAHs are released from major fuel-producing industries like oil and coal due to the incomplete combustion of organic matter [2]. PAHs are also present in the grilled meat and meat products [3], and in the smoke of cigarette [4]. High molecular weight (HMW) PAHs are

⁎ Corresponding author at: Global Centre for Environmental Remediation (GCER), ATC Building, Level 1, Faculty of Science, University of Newcastle, Callaghan, NSW 2308, Australia. E-mail address: [email protected] (M. Megharaj). 1 Formerly.

http://dx.doi.org/10.1016/j.algal.2017.02.010 2211-9264/© 2017 Elsevier B.V. All rights reserved.

considered as the major pollutants of concern because they are carcinogenic, mutagenic, and teratogenic to humans and animals [5–7]. Pyrene with four fused aromatic rings is a model compound for HMW PAHs, and a major component of the total PAHs in the environment [8]. There are several recent reports on the uptake or biodegradation of pyrene by many organisms including bacteria [9], fungi [10], plants [11], and microalgae [12]. Biodegradation studies of pyrene using microalgae were mostly confined to aqueous media [12,13]. But, in reality PAH contamination is more severe in terrestrial environment than in aquatic systems since the atmospheric pyrene also gets settled in soil [14]. It is predicted that a typical soil comprises microalgal density in the range of 103–104 cells g−1 soil [15]. However, there is a misconception that algae being photosynthetic grow only on the soil surface, and thus not suitable for remediation of soils contaminated with PAHs. In fact, microalgae occur far below the level of light penetration [16], although it is estimated that light can penetrate only up to 4–5 mm of soil [17]. It has been shown that majority of PAHs that are deposited on soil are present above 10 cm of soil depth [18]. Adsorption of PAHs into soil particle is a major factor inhibiting PAHs bioavailability and biodegradation [19], and thus alters the toxicity of PAHs to

224

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

microorganisms [20]. This limitation, however, can be overcome by enhancing the bioavailability of PAHs to the microalgal cells. In this context, the present study explored the possibilities of enhancing pyrene biodegradation efficiency of a soil microalga, Chlorella sp. MM3, involving immobilization of cells in presence of a surfactant that increases the bioavailability of a pollutant. The potential of this algal strain in biodegradation of pyrene was also tested in soil slurry-phase. 2. Materials and methods 2.1. Isolation and identification of microalga Chlorella sp. MM3, used in this study, was a soil isolate obtained earlier from a former cattle dip site in Australia [21]. Axenic culture of the strain MM3 was developed following its subculture in Bold's basal medium (BBM), and was maintained both on solid and in liquid BBM at 24 ± 2 °C in a culture room under continuous illumination with cool fluorescent lights by providing a photosynthetic photon flux density (PPFD) of 200 μmol photons m−2 s−1. Liquid culture was periodically checked for contamination, if any, by microscopic examination and by streaking onto agar BBM. The molecular identification of the microalga was carried out as described earlier [22]. In short, an aliquot (100 mL) of a week-old algal culture was harvested by centrifugation, and the pellet was washed twice with sterile distilled water. DNA was extracted using MoBio soil DNA extraction kit as per the manufacturer's protocol. Microalgal 18S rRNA gene sequence was amplified using the primers, 5′–GTCAGAGGTGAAATTCTTGGATTTA–3′ and 5′–AAGGGCAGGGACGT AATCAACG–3′. The amplicon was purified using MoBio Ultraclean ™ PCR purification kit for sequencing at Flinders DNA sequencing facility in Adelaide. Preliminary sequence analysis was carried out using Megablast program implemented in Geneious Basic 5.4. Phylogenetic software, MEGA version 5, was used for molecular and evolutionary analysis [23]. 2.2. Growth of microalga on pyrene Growth experiments were conducted in sterile glass vials (22 mL) fitted with Teflon-lined screw caps. Five millilitres of sterile BBM containing 105 cells mL−1 were dispensed into each test vial. Pyrene dissolved in dimethyl formamide (DMF) was added to the vials at a final concentration of 50, 100 and 250 μM. Aliquots of medium containing algal cell without pyrene, but with DMF, served as controls. Each experiment was carried out in duplicate and repeated twice, and averages of four results were used for statistical analysis. Growth was monitored in terms of cell number by counting the cells at desired intervals using hemocytometer. Ten microlitre samples were taken for the hemocytometric growth measurement. Pyrene uptake by algal cells was observed using a fluorescent microscope (Olympus BX41). Logarithmically-growing cells were inoculated into BBM containing 50 μM pyrene placed in 22 mL sterile glass vials. After 3 h, 10 μL of culture was withdrawn for microscopy. 2.3. Protein analysis Pyrene-induced differential protein expression was monitored by comparing the protein profile of the strain MM3 grown with or without pyrene. Microalgal cells from exponentially-growing culture were exposed to 50 μM pyrene for three days. Cells grown without or with pyrene were harvested and washed once with sterile ultrapure water. The cell pellets were washed thrice with cold acetone to remove chlorophyll. Finally, the cells were suspended in 50 mM Tris-HCl containing protease inhibitor cock tail (Sigma), sonicated in Branson ultrasonicator, and the lysate was centrifuged at 4 °C for 5 min at 10000 ×g. Aliquots of the supernatant were loaded into Biorad Miniprotean gel unit containing 12% SDS-PAGE gel. After running at 100 V for 6 h, the gel

was stained with Coomossie Brilliant Blue. Bands of differentiallyexpressed proteins were cut and analyzed using liquid chromatography, electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) for protein identification at the Adelaide Proteomics Centre. 2.4. Pyrene biodegradation studies Ten-millilitre aliquots of medium contained in 50 mL glass vials was supplemented with pyrene, and inoculated with logarithmicallygrowing microalgal culture. Three separate experiments were conducted to study the effect of (i) different concentrations of pyrene (ranging from 5 to 250 μM), (ii) cell densities of the microalga (varying from 3 × 104 to 3 × 108 cells mL−1), and (iii) surfactants (Tween 80 and Tritron X-100, each at 0.001, 0.002 and 0.005%, v/v) on pyrene biodegradation by the strain MM3. The inoculum used for studying the impact of surfactant addition and pyrene concentration on its biodegradation was 3 × 107 cells mL− 1, while the concentration of pyrene supplemented to the algal medium to determine the influence of initial cell density or the surfactant was 50 μM. The experiments were carried out at a constant room temperature of 25 ± 2 °C under continuous cool fluorescent light (PPFD of 200 μmol photons m− 2 s− 1) in an orbital shaker at 100 rpm. 2.5. Preparation of immobilized cells The algal cells were immobilized in alginate beads as described previously [24] in order to test the efficiency in pyrene biodegradation. In brief, microalgal cell pellet obtained from a logarithmically-growing culture was washed twice with 0.85% NaCl, and mixed with sterile colloidal sodium alginate to obtain a final concentration of 3%. Using 50 mL sterile syringe, microalga–sodium alginate mix was added drop by drop into 2% CaCl2 solution. Care was taken to obtain uniform bead size (4 mm dia) and consistent cell density in the beads. The beads were transferred to sterile half-strength BBM containing 1/10th of phosphate, and stored for 12 h. Low phosphate was preferred since higher concentration of phosphate ions chelate alginate and leads to disruption and dissolution of the beads. The control beads were also prepared in the same way without adding microalgal inoculum. Randomly, 10 beads were used to dissolve in 0.2 M sodium citrate for enumerating the number of cells per bead using a hemocytometer. The number of algal cells per bead, on an average, was 3 × 106. The ability of immobilized algal cells in degrading pyrene was tested in BBM by supplementing 5 to 250 μM pyrene. All these experiments were carried out at the same conditions as indicated in the pyrene biodegradation studies. 2.6. Degradation of pyrene in soil slurry The pristine soil used for the slurry experiment was obtained from Adelaide hills forest comprising Eucalyptus leucoxylon (blue gum) with an understory of Acacia pycnantha (golden wattle). The soil sample was air-dried for a week, sieved through a 2-mm mesh, and stored at 4 °C. The measured physico-chemical characteristics of the soil include: pH, 7.39; sand, 84.04%; silt, 7.98%; clay, 7.98%; cation-exchange capacity, 8.52 Cmol kg−1; organic carbon, 2.39%; and total nitrogen, 0.12%. For use in slurry-phase degradation study, portions of 250 g soil placed in 2 L glass container were spiked with 50 μM pyrene dissolved in acetone. After thorough mixing in an end-over-end shaker for 24 h, the carrier solvent was evaporated under fume-hood for 3 days. The spiked soil was then stored in dark at room temperature for two weeks until further use. For abiotic control, the soil was sterilized using 1% formaldehyde Trevors [25], and spiked with pyrene. Soil slurry was prepared by mixing 10-g portions of pyrene-spiked sterile or nonsterile soil with 20 mL of sterile BBM in 100 mL sterile glass vials. Experiments were carried out with sterile and nonsterile soil slurries inoculated with free or immobilized cells of the microalgal strain. The impact of Tween 80 on biodegradation of pyrene in soil

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

slurry was also determined. Ten beads containing 3 × 106 cells bead−1 or 3 × 107 free cells mL−1 soil slurry were used for inoculation, and the vials were incubated under cool fluorescent light (PPFD of 200 μmol photons m−2 s− 1) at 25 ± 2 °C in an orbital shaker at 100 rpm. Pyrene-spiked soil slurries treated with 0.005% Tween 80 without microalgal cells (free or immobilized) served as controls. To check growth inhibition in the test system, and to validate the stability and efficiency of free or immobilized microalgal culture, a control soil slurry system was used without exposure to pyrene. 2.7. Pyrene analysis The residual pyrene in duplicates of culture medium or soil after its uptake by the algal cells was extracted with ethyl acetate and quantified by HPLC. As PAHs like pyrene tend to adhere to the surface of glass, the entire contents in the glass vials were extracted for accurate measurement of the biodegradation. Equal volume of ethyl acetate was added to the culture medium (10 mL) or soil slurry (30 mL), vortexed vigorously for a minute, and the organic residues were extracted by ultrasonication in a water bath for 15 min at 200 W power output and frequency of 40 kHz. To avoid overheating, sonication was carried out in 3 cycles of 5 min each. One millilitre of the extract was transferred to the Agilent HPLC vials and 10 μL was injected for analysis. A mixture of methanol and water (55:45, v/v) was used as a mobile phase for 5 min, followed by a linear gradient to 100% methanol over 20 min in HPLC (Agilent Technologies 1200) equipped with Zorbax eclipse column XDB-C18 (4.6 × 150 mm and particle size of 3.5 μm). Pyrene was detected using diode array detector with 0.5 nM as the limit of detection at a wavelength of 230 nm. With the use of p-terphenyl (Sigma) as an internal standard, the observed per cent recoveries of pyrene were 95 and 90 from culture medium and soil samples, respectively. 2.8. Statistical analysis The averages and standard deviations of the experimental values were determined using Microsoft Excel 2010, while other statistical analyses were carried out using Minitab version 16. For statistical significance, the data were analyzed using t-test or ANOVA with Tukey's multiple comparison tests. 3. Results 3.1. Identity of microalga The 18S rRNA gene sequence of the strain MM3, analyzed using Geneious Basic 5.4 software, showed b 97% similarity with the other Chlorella sequences in the GenBank database. The strain was, therefore, given the unique designation of MM3, and the sequence was submitted to the GenBank with an accession number, JX126811. Phylogenetic

Fig. 1. Neighbor joining phylogenetic tree showing the relationship between Chlorella sp. MM3 with other related species of the genus Chlorella.

225

relationship between the strain MM3 and other species of Chlorella was analyzed using MEGA version 5. As seen in Fig. 1, the percentage of replicate trees in which the associated taxa clustered together in 1000 replicates as per the bootstrap test is shown next to the branches. It is clearly evident from the phylogenetic tree that strain Chlorella sp. MM3 is very close to C. variabilis and C. vulgaris. 3.2. Growth of strain MM3 on pyrene In preliminary studies, it was found that the effective concentration for 50% inhibition (EC50) in microalgal growth for pyrene was about 300 μM. Hence, the concentrations used for growth studies were less than the observed EC50 value. There was a very limited growth, in terms of viable cell count, when pyrene was added to the medium at 250 μM; however, substantial increase in the cell number was observed with 50 and 100 μM pyrene (Fig. 2). Tukey's post hoc analysis for growth showed a significant difference between untreated control and pyrene treatments. Since no inhibition in growth was observed with 50 μM pyrene, this concentration was chosen for further degradation studies. 3.3. Pyrene uptake, protein expression and biodegradation It was observed earlier that an incubation time as short as 5 min is sufficient to visualize the pyrene uptake by microalgae in aqueous medium using fluorescence microscopy. Accumulation of pyrene molecule in lipid bodies of the microalga is clearly visible (Fig. 3), indicating that pyrene is not metabolized by the exogenous enzymes. When the microalgal strain was grown without pyrene an unidentified metabolite (4.5 min run time) was observed (Fig. S1A), while in the abiotic control only pyrene peak (14 min) was visible (Fig. S1B). However, growth of the strain MM3 in presence of 50 μM pyrene for five days resulted in substantial degradation of the PAH with consequent formation of two unknown metabolites as evidenced by the appearance of distinct peaks with 3.0 and 6.5 min of run time in HPLC analysis (Fig. S1C). Our study thus clearly suggests that the strain MM3 grows well and rapidly degrades pyrene. Pyrene uptake and its degradation by the strain might require the expression of specific enzymes. One-dimensional SDS-PAGE analysis of the cell extract obtained from the strain MM3 incubated with pyrene revealed differential expression of several protein molecules (Fig. 4). An additional protein band that appeared in the lane loaded with the extract obtained from pyrene-grown culture was further analyzed for its identity by mass spectrometry. This protein matches very closely with dihydrolipoamide acetyltransferase (gi | 302837029), also called E2, of Volvox carteri f. nagariensis with the predicted molecular weight of 47.7 kDa and pI value of 9.3. Since pyrene is a toxic pollutant, high density of microalgal cells was required for their growth and degradation of pyrene. The data presented in Fig. 5 indicate that higher cell density is required for rapid degradation of pyrene. Thus, N 70% degradation of pyrene occurred with initial inoculum of 108 and 107 cells mL−1. Initial densities of 106 and 105 cells mL− 1 resulted in about 40% degradation, while 104 cells mL− 1 effected a lower (b30%) pyrene degradation. Therefore, a cell density of 107 cells mL−1 was chosen for further biodegradation experiments in both aqueous and soil slurry phases since absolutely there was no significant difference in pyrene degradation with 107 and 108 cells mL−1. The impact of initial pyrene concentration on its degradation during 7-day incubation period was assessed by growing the strain MM3 at varied concentrations of pyrene ranging from 5 to 250 μM. It is apparent from the data in Fig. 6 that concentrations of pyrene b 50 μM were degraded rapidly, while higher concentrations (N100 μM) required more time for its degradation. The microalga could degrade 5 and 25 μM concentrations of pyrene completely within a week. Likewise, addition of 50 μM pyrene resulted in about 65% degradation within a week whereas the corresponding per cent values of pyrene degradation were 25 and 11 for 100 and 250 μM, respectively.

226

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

Fig. 2. Growth of Chlorella sp. MM3 in presence of different concentrations of pyrene. Error bars represent standard deviation (n = 4).

3.4. Effect of cell immobilization and surfactants on pyrene biodegradation Four concentrations of pyrene were chosen for studying the effect of cell immobilization on pyrene degradation by the microalga. Biodegradation of pyrene by immobilized cells was higher at concentrations of

Fig. 3. Uptake of pyrene by Chlorella sp. MM3. Cells were grown in the (A) absence, and (B) presence of pyrene. Arrows indicate the accumulation of pyrene in cells.

25, 50 and 100 μM (Fig. 7) when compared with that of free cells (Fig. 6). But, pyrene degradation at 250 μM concentration was found almost same in both immobilized and free cells of the microalga. The lowest concentration of 5 μM was not included in cell immobilization experiment. Tukey's posthoc analysis shows that there was no significant difference in degradation efficiency among immobilized and nonimmobilized (free) cells. Preliminary studies showed that both Tween 80 and Triton X-100 were not toxic to the alga even at the concentration of 0.5%. For the surfactant-enhanced degradation studies, three concentrations of surfactants were chosen based on the critical micelle concentration (CMC), viz., a single concentration each of lower, equal and higher than the CMC. The CMCs for Triton X-100 and Tween 80 were 0.2 mM

Fig. 4. Differential expression of proteins in Chlorella sp. MM3 upon exposure to pyrene. Extracts were obtained from cells grown in the absence (Lane 1) or presence of 50 μM pyrene (Lane 2). DLAT = Dihydrolipoamide acetyltransferase.

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

227

Fig. 5. Effect of cell density on 50 μM pyrene degradation by Chlorella sp. MM3. Error bars represent standard deviation (n = 4).

and 0.012 mM, respectively (Sigma). Both the surfactants, Tween 80 and Triton X-100, enhanced the pyrene degradation efficiency in the microalga. However, Tween 80 was superior to Triton X-100. There was a significant difference between the control (no surfactant) and 0.002 and 0.005% concentrations of Tween 80 at the end of seven days (Fig. 8A). Not such significant difference was observed between the control and Triton X-100 after 7 days of incubation although a significant difference at day 3 and 5 was evident at higher concentration of Triton X-100 (Fig. 8B). Based on this result, Tween 80 was chosen for further degradation experiments with soil slurry. 3.5. Biodegradation of pyrene in soil slurry The ability of the microalga to remediate pyrene-contaminated soil was tested following soil slurry-based approach. The effect of cell immobilization and surfactant addition on enhanced degradation of pyrene in soil slurry was also evaluated. In order to distinguish the role of indigenous microorganisms in degradation of pyrene, microalgal cells were inoculated into both sterile and nonsterile soil slurries. Uninoculated sterile slurry (abiotic control) treated with Tween 80 degraded b7% pyrene, while biotic control (nonsterile soil slurry) with Tween 80 treatment exhibited about 15% degradation of added pyrene (Fig. 9A). Under sterile conditions almost 98% of pyrene was degraded in soil slurry by the end of 10-day incubation period. As with nonsterile soil slurry, pyrene degradation was enhanced by immobilization of algal cells together with addition of the surfactant (Fig. 9B). Initially (at day 5),

there was a significant difference in the removal of pyrene among the different treatments. Thus, immobilization of algal cells in presence or absence of Tween 80 resulted in rapid degradation of pyrene after 5 days. However, at the end of 10 days there was no significant difference in biodegradation among all the treatments. Moreover, in control soil slurry system with no pyrene, free and immobilized cells of the microalga showed similar growth pattern as observed with pyreneexposed cells, and there was no toxicity of soil slurry towards the microalga (data not shown). Indeed, the extent of pyrene degradation by free cells even in the absence of Tween 80 in sterile soil slurry was similar to that observed with all other treatments by the end of 14 days. In contrast, under nonsterile conditions, addition of both immobilized cells and surfactant (Tween 80) to soil slurry resulted in nearly complete degradation of pyrene within 10 days when compared with the extent of degradation mediated by free cells in similar treatments (Fig. 9C). However, surfactant addition to nonsterile soil slurry caused an improvement in pyrene degradation by free cells. By the end of 14 days, pyrene content in nonsterile slurry reached almost below detection level in all the treatments except in case of free cells. Thus, in the absence of Tween 80 free cells of the microalga removed only 78% of pyrene added to nonsterile slurry, and N 15% pyrene remained in these treatments even after 21 days of incubation. Although, pyrene degradation by Chlorella sp. MM3 was comparatively lower in soil slurries (Fig. 9) when compared to that in aqueous medium (Fig. 6), the biodegradation efficiency was greatly enhanced by the surfactant addition and immobilization.

Fig. 6. Effect of different concentrations of pyrene on its degradation by Chlorella sp. MM3. Error bars represent standard deviation (n = 4).

228

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

Fig. 7. Effect of different concentrations of pyrene on its degradation by immobilized cells of Chlorella sp. MM3. Error bars represent standard deviation (n = 4).

Fig. 8. Degradation of 50 μM pyrene in presence of (A) Tween 80, and (B) Triton X-100. Error bars represent standard deviation (n = 4). *Significant difference among the treatments for a sampling time (P ≤ 0.5).

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

229

Fig. 9. Degradation of 50 μM pyrene in soil slurry (A) under control conditions (abiotic and biotic controls with no algal inoculum) after 14 days, (B) by immobilized or free cells under sterile conditions, and (C) by immobilized or free cells under nonsterile conditions. SS = Sterile slurry, NSS = Nonsterile slurry, T 80 = Tween 80, BB = Blank beads. Error bars represent standard deviation (n = 4). *Significant difference among the treatments for a sampling time (P ≤ 0.5).

4. Discussion 4.1. Algal uptake of pyrene and response to pyrene-induced stress Among microalgae, species of Chlorella are widely used for bioremediation of sites contaminated with pollutants [26,27]. In the present study, Chlorella sp. MM3 (Fig. 1) showed tremendous potential for pyrene bioremediation, which is also evident from its growth on pyrene

(Fig. 2). DMF was used as the carrier solvent in very small volume for preparing pyrene stock solution since it is less toxic to microalgae when compared to other solvents [22]. Species of Chlorella do not utilize organic compounds as carbon sources, but degrade them during the process of detoxification. Moreover, under photoautotrophic conditions, DMF would not be a preferred carbon source for microalgae. Photodegradation of PAHs by photosynthetic microorganisms like microalgae has been very well established, and the source of light

230

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

particularly plays a crucial role in yielding photodegradation products [28]. In fact, the fluorescent light used in the present study might have little impact on photodegradation of pyrene as evidenced from only 5% degradation in an abiotic control maintained in the form of sterile slurry (Fig. 9A). Carcinogenic PAHs like BaP, but not non-carcinogenic pyrene, produce phototoxic metabolites upon their exposure to light, thus increasing the algal toxicity [28]. Moreover, in the absence of phototoxic metabolites from pyrene, microalgae degrade pyrene easier than other carcinogenic PAHs. Microalgae degrade PAHs using dioxygenase enzyme system as in case of bacteria [27,28], while monooxygenase enzyme system is responsible for degradation of PAHs in eukaryotes including fungi and mammals [28]. The efficiency of Chlorella sp. MM3 in degrading pyrene (50 μM pyrene within 21 days in soil slurry system) is similar to that observed in some bacterial isolates such as Mycobacterium spp. (0.5 mg pyrene mL−1 within 8 days) [29] and Rhodococcus sp. (0.08 mg pyrene mL− 1 day− 1) [30]. Being slow growers, fungi like yeasts and Rhodotorula sp. in PAHs-contaminated sites combine both monooxygenases and lignocellulases to exhibit rapid degradation of PAHs which is on par with that observed in bacterial isolates [31]. To our knowledge, this is the first study wherein a microalga was used in biodegradation of pyrene in soil slurry-based system. PAHs can fluoresce on exposure to UV light, and this feature has been exploited for monitoring the uptake of PAHs by live cells [27]. Although fluorescence of pyrene is less intense when compared to BaP, this feature can still be used to study the microalgal uptake of PAHs. An earlier study reported the potential of fluorescence microscopy techniques in monitoring the uptake of BaP in Chlorella sp. [27]. In the present investigation, fluorescence microscopy was used to observe the uptake of pyrene by the microalgal cells (Fig. 3). Increase in cell density of the strain MM3 resulted in rapid degradation of pyrene (Fig. 5). It has been shown earlier that cell densities b104 cells mL−1 of Selenastrum capricornutum were insufficient for PAHs biodegradation [32]. Also, Lei et al. [33] observed an increase in degradation of PAHs with increasing cell densities of different green microalgae such as Chlorella vulgaris, Scenedesmus platydiscus, Scenedesmus quadricauda, and S. capricornutum. The biochemical changes induced by organic pollutants in microalgae are widely used for accessing the toxicity of the contaminants [26]. Pyrene was reported to be toxic and induces stress responsive antioxidant reactions in several microalgae [34]. Although PAHsinduced antioxidant profiling was done in microalgae, the present study provides some useful information on the differential protein expression of the alga on exposure to pyrene. Indeed, antioxidants do not always serve as the stress indicators. The role of dihydrolipoamide acetyltransferase (DLAT) or dihydrolipoyl transacetylase in pyreneinduced stress is noteworthy as this enzyme plays an important role in microalgal energetics. DLAT is the second of the three components of a multicomponent enzyme system, called the mitochondrial pyruvate dehydrogenase complex, that catalyzes oxidative decarboxylation of pyruvate [35]. This core enzyme is involved in transferring acetyl group from pyruvate, formed during glycolytic pathway, to coenzyme A (CoA) to yield acetyl-CoA for its subsequent in the citric acid cycle. Thus, the key role of DLAT in cellular respiration for the production of NADH emphasizes its importance in energy derivation within the cell. Most likely, the pyrene-induced stress in microalgal cells of the present strain is alleviated by overexpressing DLAT in order to meet the consequent demand for generating more cell energy under toxicant's influence. Similarly, a fresh water green alga, Micractinium pusillum, under nitrogen starvation conditions accumulated 100-fold of dihydrolipoamide dehydrogenase, which is the third component of the same pyruvate dehydrogenase complex, that regenerates the lipoamide during pyruvate decarboxylation [36]. Apparently, our present observation of DLAT accumulation as a consequence of pyreneinduced stress in algal cells clearly implicates this enzyme in biodegradation of pyrene by Chlorella sp. MM3. However, complete proteome

analysis will provide more insight into the metabolism and non-target effects of pyrene towards microalgae. 4.2. Pyrene biodegradation and phycoremediation in soil slurry Microalgal biodegradation of pyrene resulted in formation of two major metabolites whose identity was not established. Similarly, metabolites such as monohydroxypyrene and dihydroxylated pyrene were identified during biodegradation of pyrene by microalgae in a few studies [13,32]. When compared with a wide array of cell immobilization techniques, gel entrapment based on alginate matrix is more advantageous and convenient for biodegradation studies because alginate is nontoxic, highly permeable and transparent for light penetration [37]. Also, immobilization offers repeated use of the cells for successive biodegradation of hydrocarbon mixtures [38]. Sodium alginate immobilized cells of Selenastrum capricornutum are able to remove significantly higher concentration of PAHs including pyrene by facilitating rapid absorption, transfer and further break down of toxicants inside the live immobilized cells [39]. Though the microalga used in their study was not isolated from PAHs-contaminated site, higher degradation rate was reported for PAHs at concentrations in the range of 1.0–0.1 mg L−1. In fact, microalgae were used for screening the toxicity of surfactants [40]. Several lipophilic non-ionic surfactants are reported to enhance growth of microalgae [41], while some non-ionic surfactants are degraded by certain microalgae [42]. Surfactants play a vital role in the solubilisation of PAHs in soil and water systems [43]. For the desorption of pyrene in soil-water systems, Tween 80 is more efficient than Triton X-100 [43]. The higher desorption efficiency was reflected in the enhanced biodegradation of PAHs by Tween 80 when compared to Triton X-100 [44]. When used in the bioslurry-based system non-ionic surfactant assists in desorption of sorbed PAHs in soil to aqueous medium. This mechanism ultimately results in the enhanced biodegradation of PAHs by the microorganisms [45]. Earlier it was shown that non-ionic surfactants, at concentrations of 10 and 100 μg g−1 soil, enhanced biodegradation of phenanthrene by indigenous microorganisms, while concentrations b 1.0 μg g− 1 soil had no effect on PAH degradation in soil slurry [46]. In the present study, Chlorella sp. MM3 effected significantly rapid degradation when Tween 80 was added at concentration as low as 5 μg g− 1 soil. Although surfactants were successfully used for the remediation of sites contaminated with several organic chemicals [47], the impact of surfactants on phycoremediation of PAHs-contaminated soil in a slurry-phase has not been fully explored. In this context, the present study lays the foundation for the surfactant-mediated phycoremediation of organic contaminants in soil slurry. Indigenous soil microorganisms played a moderate role in pyrene biodegradation as evident from the loss of pyrene from nonsterile soil slurry (biotic control) in spite of the fact that the soil was collected from a site not contaminated with any PAHs. Growth of free cells of the microalga in nonsterile soil slurry, measured in terms of chlorophyll estimation (results not shown), was significantly lesser when compared to that under sterile conditions, possibly due to negative interaction (antagonism) by the indigenous microorganisms like protozoans. Immobilization in alginate beads may have protected the microalgal cells from this competition. Thus, it is clearly evident from the present results that cell immobilization and surfactant addition in soil slurry greatly enhanced pyrene degradation by the microalga. Though a large number of investigations reported the efficiency of soil slurry-based biodegradation of PAHs, most of these studies were carried out with bacteria. In fact, hydrophobic compounds like pyrene usually have two stages of release from soil to aqueous phase, an initial rapid release followed by very slow release [20]. This slow release has the impact on biodegradation, which ultimately results in slowing down the degradation process. It is evident from this study that the pyrene degradation was higher in culture medium than in soil slurry.

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232

Immobilized microalgae were widely used for biodegradation of organic pollutants in the aqueous system [38,39]. However, studies on the use of immobilized microalgae in the degradation of organic pollutants in soil slurry are lacking. In the present study, no visible damage was evident to the beads which ensured the stability of alginate beads containing immobilized microalgal cells in the slurry system. The observed leakage of cells from the matrix into the slurry was probably due to the presence of phosphate present in the beads; however, this did not affect the biodegradation efficiency of the microalga. Similarly, Suzuki et al. [38] reported leakage of cells during hydrocarbon degradation by Prototheca zopfii in high phosphate medium. Our results suggest that a combination of low concentration of surfactant and immobilization of microalga provided optimal conditions for the removal of high molecular weight PAH, pyrene in soil slurry. 5. Conclusions Pyrene degradation by a soil microalga, Chlorella sp. MM3, resulted in accumulation of two major metabolites in culture medium. Pyreneinduced stress in microalgal cells resulted in overexpression of dihydrolipoamide acetyltransferase, a core enzyme of pyruvate dehydrogenase complex, that catalyzes the decarboxylation of pyruvate to form acetyl-CoA and NADH during cell respiration, indicating the possible role of this enzyme in pyrene biodegradation. Optimum cell density of algal strain for pyrene degradation was 107 cells mL−1. Tween 80 was a superior surfactant over Triton X-100 in enhancing pyrene biodegradation. Microalgal degradation of pyrene in soil slurry was greatly enhanced by the combination of Tween 80 and cell immobilization in alginate beads. This study clearly suggests that alginate immobilized cells of Chlorella sp. MM3 in presence of low concentrations of Tween 80 have great potential in remediating soils contaminated with pyrene. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.algal.2017.02.010. Conflict of interest The authors declare that they have no conflict of interest. Contributions All authors contributed to the design of the experiment, drafting and revision of the article and approved the submitted article. SS and PL conducted the experiments. M. Megharaj is the corresponding author. Acknowledgements KV is grateful to the Government of Australia (Department of Education, Employment and Workplace Relations) for the Endeavour Executive Award. References [1] P. Thavamani, M. Megharaj, G.S.R. Krishnamurti, R. McFarland, R. Naidu, Finger printing of mixed contaminants from former manufactured gas plant (MGP) site soils: implications to bioremediation, Environ. Int. 37 (2011) 184–189. [2] K. Liu, W. Han, W.-P. Pan, J.T. Riley, Polycyclic aromatic hydrocarbon (PAH) emissions from a coal-fired pilot FBC system, J. Hazard. Mater. 84 (2001) 175–188. [3] B.K. Larsson, G.P. Sahlberg, A.T. Eriksson, L.A. Busk, Polycyclic aromatic hydrocarbons in grilled food, J. Agric. Food Chem. 31 (1983) 867–873. [4] R. Goldman, L. Enewold, E. Pellizzari, J.B. Beach, E.D. Bowman, S.S. Krishnan, P.G. Shields, Smoking increases carcinogenic polycyclic aromatic hydrocarbons in human lung tissue, Cancer Res. 61 (2001) 6367–6371. [5] G. Grimmer, H. Brune, R. Deutsch-Wenzel, G. Dettbarn, J. Misfeld, Contribution of polycyclic aromatic hydrocarbons to the carcinogenic impact of gasoline engine exhaust condensate evaluated by implantation into the lungs of rats, J. Natl. Cancer Inst. 72 (1984) 733–739. [6] J.L. Durant, A.L. Lafleur, W.F. Busby Jr., L.L. Donhoffner, B.W. Penman, C.L. Crespi, Mutagenicity of C24H14 PAH in human cells expressing CYP1A1, Mutat. Res. 446 (1999) 1–14.

231

[7] J. Anwer, N.K. Mehrotra, Teratogenic effects of benzo[a]pyrene in developing chick embryo, Toxicol. Lett. 40 (1988) 195–201. [8] R. Irwin, M. Mouwerik, S. Stevens, M. Seese, W. Basham, Environmental contaminants encyclopedia PAHs entry, National Parks Service Report, Water Resources Division, 1997. [9] R.A. Kanaly, S. Harayama, Biodegradation of high-molecular-weight polycyclic aromatic hydrocarbons by bacteria, J. Bacteriol. 182 (2000) 2059–2067. [10] G. Capotorti, P. Digianvincenzo, P. Cesti, A. Bernardi, G. Guglielmetti, Pyrene and benzo(a)pyrene metabolism by an Aspergillus terreus strain isolated from a polycylic aromatic hydrocarbons polluted soil, Biodegradation 15 (2004) 79–85. [11] H.-H. Liste, M. Alexander, Plant-promoted pyrene degradation in soil, Chemosphere 40 (2000) 7–10. [12] A.P. Lei, Y.S. Wong, N.F.Y. Tam, Removal of pyrene by different microalgal species, Water Sci. Technol. 46 (2002) 195–201. [13] L. Ke, L. Luo, P. Wang, T. Luan, N.F.-Y. Tam, Effects of metals on biosorption and biodegradation of mixed polycyclic aromatic hydrocarbons by a freshwater green alga Selenastrum capricornutum, Bioresour. Technol. 101 (2010) 6950–6961. [14] S.R. Wild, K.C. Jones, Polynuclear aromatic hydrocarbons in the United Kingdom environment: a preliminary source inventory and budget, Environ. Pollut. 88 (1995) 91–108. [15] B. Metting, The systematics and ecology of soil algae, Bot. Rev. 47 (1981) 195–312. [16] L. Hoffmann, Algae of terrestrial habitats, Bot. Rev. 55 (1989) 77–105. [17] M. Tester, C. Morris, The penetration of light through soil, Plant Cell Environ. 10 (1987) 281–286. [18] I.T. Cousins, B. Gevao, K.C. Jones, Measuring and modelling the vertical distribution of semi-volatile organic compounds in soils. I: PCB and PAH soil core data, Chemosphere 39 (1999) 2507–2518. [19] W.D. Weissenfels, H.-J. Klewer, J. Langhoff, Adsorption of polycyclic aromatic hydrocarbons (PAHs) by soil particles: influence on biodegradability and biotoxicity, Appl. Microbiol. Biotechnol. 36 (1992) 689–696. [20] U. Ghosh, J.W. Talley, R.G. Luthy, Particle-scale investigation of PAH desorption kinetics and thermodynamics from sediment, Environ. Sci. Technol. 35 (2001) 3468–3475. [21] B.B. Edvantoro, R. Naidu, M. Megharaj, G. Merrington, I. Singleton, Microbial formation of volatile arsenic in cattle dip site soils contaminated with arsenic and DDT, Appl. Soil Ecol. 25 (2004) 207–217. [22] S.R. Subashchandrabose, M. Megharaj, K. Venkateswarlu, R. Naidu, Interaction effects of polycyclic aromatic hydrocarbons and heavy metals on a soil microalga, Chlorococcum sp. MM11, Environ. Sci. Pollut. Res. 22 (2015) 8876–8889. [23] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 2731–2739. [24] C. Sreenivasulu, M. Megharaj, K. Venkateswarlu, R. Naidu, Degradation of pnitrophenol by immobilized cells of Bacillus spp. isolated from soil, Int. Biodeterior. Biodegrad. 68 (2012) 24–27. [25] J.T. Trevors, Sterilization and inhibition of microbial activity in soil, J. Microbiol. Methods 26 (1996) 53–59. [26] S.R. Subashchandrabose, L. Wang, K. Venkateswarlu, R. Naidu, M. Megharaj, Interactive effects of PAHs and heavy metal mixtures on oxidative stress in Chlorella sp. MM3 as determined by artificial neural network and genetic algorithm, Algal Res. 21 (2017) 203–212. [27] S.R. Subashchandrabose, K. Krishnan, E. Gratton, M. Megharaj, R. Naidu, Potential of fluorescence imaging techniques to monitor mutagenic PAH uptake by microalga, Environ. Sci. Technol. 48 (2014) 9152–9160. [28] D. Warshawsky, T. Cody, M. Radike, R. Reilman, B. Schumann, K. LaDow, J. Schneider, Biotransformation of benzo[a]pyrene and other polycyclic aromatic hydrocarbons and heterocyclic analogs by several green algae and other algal species under gold and white light, Chem. Biol. Interact. 97 (1995) 131–148. [29] K. Rehmann, H.P. Noll, C.E.W. Steinberg, A.A. Kettrup, Pyrene degradation by Mycobacterium sp. strain KR2, Chemosphere 36 (1998) 2977–2992. [30] U. Walter, M. Beyer, J. Klein, H.J. Rehm, Degradation of pyrene by Rhodococcus sp. UW1, Appl. Microbiol. Biotechnol. 34 (1991) 671–676. [31] A.K. Haritash, C.P. Kaushik, Biodegradation aspects of polycyclic aromatic hydrocarbons (PAHs): a review, J. Hazard. Mater. 169 (2009) 1–15. [32] S.M.N. Chan, T. Luan, M.H. Wong, N.F.Y. Tam, Removal and biodegradation of polycyclic aromatic hydrocarbons by Selenastrum capricornutum, Environ. Toxicol. Chem. 25 (2006) 1772–1779. [33] A.-P. Lei, Z.-L. Hu, Y.-S. Wong, N.F.-Y. Tam, Removal of fluoranthene and pyrene by different microalgal species, Bioresour. Technol. 98 (2007) 273–280. [34] A. Lei, Z. Hu, Y. Wong, N. Tam, Antioxidant responses of microalgal species to pyrene, J. Appl. Phycol. 18 (2006) 67–78. [35] W. Wei, H. Li, N. Nemeria, F. Jordan, Expression and purification of the dihydrolipoamide acetyltransferase and dihydrolipoamide dehydrogenase subunits of the Escherichia coli pyruvate dehydrogenase multienzyme complex: a mass spectrometric assay for reductive acetylation of dihydrolipoamide acetyltransferase, Protein Expr. Purif. 28 (2003) 140–150. [36] Y. Li, X. Fei, X. Deng, Novel molecular insights into nitrogen starvation-induced triacylglycerols accumulation revealed by differential gene expression analysis in green algae Micractinium pusillum, Biomass Bioenergy 42 (2012) 199–211. [37] I. Moreno-Garrido, Microalgae immobilization: current techniques and uses, Bioresour. Technol. 99 (2008) 3949–3964. [38] T. Suzuki, T. Yamaguchi, M. Ishida, Immobilization of Prototheca zopfü in calciumalginate beads for the degradation of hydrocarbons, Process Biochem. 33 (1998) 541–546. [39] N.F.Y. Tam, M.N. Chan, Y.S. Wong, Removal and biodegradation of polycyclic aromatic hydrocarbons by immobilized microalgal beads, in: V. Popov, H. Itoh, U.

232

[40] [41]

[42] [43]

S.R. Subashchandrabose et al. / Algal Research 23 (2017) 223–232 Mander, C.A. Brebbia (Eds.), Waste Management and the Environment V, WIT Press, Southampton 2010, pp. 391–402. M.A. Lewis, Chronic toxicities of surfactants and detergent builders to algae: a review and risk assessment, Ecotoxicol. Environ. Saf. 20 (1990) 123–140. R. Ernst, C.J. Gonzales, J. Arditti, Biological effects of surfactants: part 6—effects of anionic, non-ionic and amphoteric surfactants on a green alga (Chlamydomonas), Environ. Pollut. A31 (1983) 159–175. E. Davis, E. Gloyna, Anionic and nonionic surfactant sorption and degradation by algae cultures, J. Am. Oil Chem. Soc. 46 (1969) 604–608. K.Y. Cheng, J.W.C. Wong, Effect of synthetic surfactants on the solubilization and distribution of PAHs in water/soil-water systems, Environ. Technol. 27 (2006) 835–844.

[44] L. Fernando Bautista, R. Sanz, M. Carmen Molina, N. González, D. Sánchez, Effect of different non-ionic surfactants on the biodegradation of PAHs by diverse aerobic bacteria, Int. Biodeterior. Biodegrad. 63 (2009) 913–922. [45] I.S. Kim, J.-S. Park, K.-W. Kim, Enhanced biodegradation of polycyclic aromatic hydrocarbons using nonionic surfactants in soil slurry, Appl. Geochem. 16 (2001) 1419–1428. [46] B.N. Aronstein, M. Alexander, Surfactants at low concentrations stimulate biodegradation of sorbed hydrocarbons in samples of aquifer sands and soil slurries, Environ. Toxicol. Chem. 11 (1992) 1227–1233. [47] C.N. Mulligan, R.N. Yong, B.F. Gibbs, Surfactant-enhanced remediation of contaminated soil: a review, Eng. Geol. 60 (2001) 371–380.