Pyrroloquinoline quinone-conferred neuroprotection in rotenone models of Parkinson’s disease

Accepted Manuscript Title: Pyrroloquinoline quinone-conferred neuroprotection in rotenone models of Parkinson’s disease Author: Jiaojiao Qin Meilong Wu Xiaorong Gao Jingjing Zhang Xingyue Dong Jinyan Ji Yuxi Zhang Lin Zhou Qi Zhang Fei Ding PII: DOI: Reference:

S0378-4274(15)30032-1 http://dx.doi.org/doi:10.1016/j.toxlet.2015.08.011 TOXLET 9131

To appear in:

Toxicology Letters

Received date: Revised date: Accepted date:

13-5-2015 22-7-2015 9-8-2015

Please cite this article as: Qin, Jiaojiao, Wu, Meilong, Gao, Xiaorong, Zhang, Jingjing, Dong, Xingyue, Ji, Jinyan, Zhang, Yuxi, Zhou, Lin, Zhang, Qi, Ding, Fei, Pyrroloquinoline quinone-conferred neuroprotection in rotenone models of Parkinson’s disease.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2015.08.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

 

Pyrroloquinoline quinone-conferred neuroprotection in rotenone models of Parkinson’s disease Jiaojiao Qina1, Meilong Wua,b1, Xiaorong Gaoa, Jingjing Zhanga, Xingyue Donga,b, Jinyan Jia,b, Yuxi Zhanga,b, Lin Zhoua,b, Qi Zhanga* [email protected], Fei Dinga* [email protected] a

Jiangsu Key Laboratory of Neuroregeneration, Co-innovation Center of Neuroregeneration,

Nantong University, 19 Qixiu Road, Nantong, JS 226001, PR China b

Medical School, Nantong University, 19 Qixiu Road, Nantong, JS 226001, PR China

*

Corresponding author. Tel/Fax: +86-513-85511585.

1

These authors contributed equally to this work.

 

1

 

Highlights PQQ conferred protection in rotenone-induced PD models both in vitro and in vivo. PQQ increased antioxidant ability and mitochondrial function in PD models. PQQ affected dopamine redistribution in rotenone-induced PD models.

 

2

 

Abstract Pyrroloquinoline quinone (PQQ), a redox cofactor in the mitochondrial respiratory chain, has proven to protect neurons against glutamate-induced damage both in vitro and in vivo. This study was aimed to investigate the possible neuroprotective effects of PQQ in rotenone-induced Parkinson’s disease (PD) model. Pre-treatment with PQQ prevented cultured SH-SY5Y cells from rotenone-induced apoptosis, accompanied by modulation of apoptosis-related proteins (Bcl-2, Bax and Smac), restoration of the mitochondrial membrane potential, inhibition of intracellular reactive oxygen species (ROS) production, suppression of tyrosine residues nitration, and dopamine redistribution. PQQ also exerted protective effects in an in vivo PD model, which was created by rotenone injection into the medial forebrain bundle of rats. Co-injection with PQQ and rotenone improved the apomorphine-evoked rotation, decreased neuronal loss, increased the ROS-scavenging ability, regulated intracellular expressions of mitochondrial complex subunits (Ndufs1-4), tyrosine hydroxylase, and vesicular monoamine transporter 2. Taken together, our results collectively suggest that PQQ confers neuroprotection in rotenone-induced PD model probably through complex and multifaceted mechanisms, at least involving oxidative stress, mitochondrial integrity, and dopamine functions.

Keywords: Pyrroloquinoline Quinone (PQQ); rotenone; neuroprotection; reactive oxygen species (ROS); Parkinson’s disease (PD); dopamine

 

3

 

1. Introduction Parkinson’s disease (PD) is a chronic and progressive neurodegenerative disorder characterized by dopaminergic degeneration in the substantia nigra pars compacta (SNc) and subsequent reduction in dopamine levels in the striatum. Despite considerable advances in the treatment of PD, the pathogenesis-targeted therapies are still lacking (Jankovic and Poewe, 2012). The pathogenic mechanisms contributing to neurodegeneration in PD are complex and multifaceted, but mitochondrial dysfunction and oxidative stress are considered to be central to the pathogenesis of PD (Sanders and Timothy Greenamyre, 2013). Inhibition of mitochondrial complex I has long been one of the leading hypotheses to explain SNc dopamine neuron death in PD (Abou-Sleiman et al., 2006). Many environmental risk factors are implicated in PD, including some commercial pesticides that inhibit complex I of the electron transport chain (ETC) (Cannon and Greenamyre, 2013). Rotenone, one of these pesticides, is usually used to reproduce the pathological features of PD in animal models because rotenone acts specifically at the ETC complex I, and concurrently produces oxidative damage in the cell (Panov et al., 2005; Sherer et al., 2003). Pyrroloquinoline quinone (PQQ) was initially found in bacteria as a redox cofactor (Hauge, 1964; Salisbury et al., 1979), and was later identified as an essential nutrient for plants, animals and humans (Cline and Tsien, 1991; Felton and Anthony, 2005; Kasahara and Kato, 2003; Rucker et al., 2009; Rucker et al., 2005; Stites et al., 2000). PQQ has a strong ability to scavenge reactive oxygen species (ROS) and attenuate oxidative stress in mitochondria (Misra et al., 2004; Misra et al., 2012), and thereby induces protective effects against oxidative stress-induced cell damage in heart, liver, and brain (Hobara et al., 1988; Ohwada et al., 2008; Tao et al., 2007; Zhu et al., 2004). In particular, PQQ has been shown to protect human neuroblastoma SH-SY5Y cells against 6-hydroxydopamine-induced cell death and DNA fragmentation (Hara et al., 2007). We previously demonstrate that PQQ prevents glutamate-induced neurotoxicity both in vitro and in vivo (Zhang et al., 2013; 2012; 2011). These findings highlight the neuroprotective potential of PQQ. The brain is highly susceptible to oxidative damage because of the high levels of polyunsaturated fatty acids and relatively low antioxidant activity (Mariani et al., 2005). Oxidative

 

4

 

stress plays an important role in the pathogenesis of PD although the underlying mechanisms are not fully understood. Unfortunately, most of the commonly used antioxidants have had a limited success in the treatment of PD, possibly because ROS generation from the ETC complex I, II and III is modulated in an insult-specific manner and the ETC sites are differentially accessible to those common antioxidants (Liu and Schubert, 2009). Our recent study has shown that ROS produced by complex I and III inhibitors could be attenuated by PQQ, suggesting these two ROS-generating sites might be accessible to PQQ (Zhang et al., 2014). In this study, we aimed to test whether and how PQQ conferred neuroprotection in rotenone models of PD both in vitro and in vivo. Our results showed that pretreatment with PQQ protected cultured SH-SY5Y cells against rotenone injury by scavenging ROS, maintaining mitochondrial function and regulating dopamine redistribution. We also found that injection with PQQ prevented rats from rotenone-induced neuronal degeneration.

2. Materials and Methods 2.1. Chemicals and reagents PQQ, rotenone, trypsin, Hoechst 33342, 2’,7’-dichlorofluorescin diacetate (DCFH-DA), monoclonal mouse anti-Bcl-2 antibody, monoclonal mouse anti-Bax antibody, monoclonal mouse anti-Smac antibody, monoclonal mouse anti-tyrosine hydroxylase (TH) antibody, and monoclonal mouse anti-β-actin antibody were purchased from Sigma (St. Louis, MO). Monoclonal mouse anti-dopamine antibody was purchased from Abcam (Cambridge, MA). Monoclonal mouse anti-nitrotyrosine antibody and polyclonal rabbit anti-vesicular monoamine transporter 2 (VMAT2) antibody were purchased from Millipore (Bedford. MA). Neurobasal medium, Dulbecco's modified eagle's medium (DMEM), B27 supplement and fetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY). IRDye 800-conjugated goat anti-mouse IgG and IRDye 800-conjugated donkey anti-rabbit IgG were purchased from Rockland (Gilbertsville, PA). Tissue lysis buffer, protease inhibitor cocktail and BCA-based protein quantification kit were obtained from Biocolor (Shanghai, China). Cell Counting Kit-8 (CCK-8) and Fluo-3/AM were obtained from Dojindo (Kumamoto, Japan). Annexin V was from PharMingen (San Diego, CA). Trizol reagent was from Invitrogen (Carlsbad, CA). MitoTracker Green FM was purchased from

 

5

 

Life technologies (Carlsbad, CA). Tetramethylrhodamine methyl ester (TMRM) and Fast EvaGreen qPCR Master Mix were purchased from Biotium (Hayward, CA, USA). Omniscript Reverse Transcription (RT) kit was from Qiagen (Valencia, CA). The assay kits for superoxide dismutase (SOD), glutathione (GSH) and malondialdehyde (MDA) were obtained from Jiancheng Institute of Biotechnology (Nanjing, Jiangsu, China).

2.2. Cell culture and treatment Human SH-SY5Y neuroblastoma cells and C6 glioma cells were cultured in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere of 95% air and 5% CO2. PQQ at different concentrations (0.1-100 μM) was added to the culture medium for 24 h incubation, and then rotenone (100 μM) was added to the medium for additional 24 h incubation. The cells not exposed to rotenone were used as control. To detect a long-term protective effects of PQQ, lower concentration of rotenone (10 μM) was added to the medium for an additional 72 h incubation and then cell viability was measured.

2.3. Cell viability measurement Following cell treatment, cell viability was assessed by CCK-8 method. Briefly, tetrazolium salt-8 (WST-8) solution was added to cultured SH-SY5Y cells or C6 cells in 96-well plate (10 μl/each well), followed by incubation at 37°C for 2 h. The absorbance (optical density, OD) was

measured by spectrophotometry at 450 nm with an ELx-800 microplate reader (Bio-Tek Inc., Winooski, VT).

2.4. Hoechst 33342 staining The SH-SY5Y cells were fixed in 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS, pH 7.2) at room temperature for 20 min, and then stained with 5 μg/ml Hoechst 33342 dye for 10 min, followed by observation under a DMR fluorescence microscope (Leica Microsystems, Wetzlar, Germany) with fluorescence excitation at 340 nm and emission at 510 nm. The cells with fragmented or condensed DNA were counted as apoptotic cells, and the ratio of apoptotic cells to total cells was calculated.

 

6

 

2.5. Annexin V/PI Staining and Flow Cytometry (FCM) analysis The SH-SY5Y cells were harvested and resuspended in 1 × binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2) at a concentration of 1 × 106 cell/ml. In a 100 μl aliquot of the cell suspension, 5 μl of FITC-conjugated annexin V and 5 μl of 50 μg/ml propidium iodide (PI) were added. After 15 min incubation in the dark at room temperature, cells were analyzed for annexin V binding within 1 h by using Fluorescence Activated Cell Sorting (FACS) Caliber Systems (BD Bioscience, San Jose, CA).

2.6. ROS detection The SH-SY5Y cells were harvested and incubated with DCFH-DA at a final concentration of 20 μM at 37°C for 30 min in the dark, and then gently rinsed with PBS for 3 times. ROS levels were measured as the fluorescence of oxidation product of DCFH-DA, dichlorofluorescin (DCF) by FCM with excitation and emission wavelengths of 485 and 528 nm, respectively. A minimum of 10,000 individual events was recorded. The fluorescence intensity was expressed as the relative value to the control.

2.7. Mitochondrial membrane potential (MMP) The fluorescent dye TMRM is a mitochondrial specific probe used to determine the change of MMP in intact cells. For indirect measurement of MMP, TMRM was added to the cultured SH-SY5Y cells to make a final concentration of 20 nM. After culture at 37°C for 20 min, the cells were fixed with 4% paraformaldehyde, and washed with PBS, followed by visualization under a fluorescent microscope (Leica Microsystems, Wetzlar, Germany). The signal of TMRM was excited by 530 nm laser light and emission was captured at 590 nm. Each field of cells was photographed and detected by an ELx-800 microplate reader for calculation of the relative fluorescence intensity.

2.8. Measurement of mitochondrial mass Mitochondrial mass of cultured SH-SY5Y cells was determined by MitoTracker Green fluorescence staining. The SH-SY5Y cells were cultured in 96-well plate, rinsed with 0.1 M PBS and incubated with 100 nM MitoTracker Green for 30 min at 37°C. After wash with PBS, the  

7

 

fluorescence was detected by an ELx-800 microplate reader with excitation and emission wavelengths at 490 and 516 nm, respectively.

2.9. Intracellular Calcium (Ca2+) measurement The concentration of intracellular Ca2+ was measured with Fluo-3/AM as described previously (Park et al., 2014). After exposure to rotenone for 24 h, the cells were washed with PBS and harvested by centrifugation, after which the cells were loaded with 5 μM Fluo-3/AM at 37°C for 30 min. The cells were washed three times with PBS and resuspended in PBS and the fluorescence intensity was analyzed by FACS at excitation wavelength 488 nm and emission wavelength 525 nm. The maximal Fluo-3/AM fluorescence was determined by adding 0.1 %Triton X-100, and the minimal fluorescence was determined by quenching addition of 5 mM EGTA.

2.10. Fluorescent Immunostaining Cultured SH-SY5Y cells were fixed with 4% paraformaldehyde, permeabilized with 5% Triton X-100, and incubated in 0.3% goat serum (in PBS) for 30 min at 37°C. Primary antibodies against dopamine (1:200), nitrotyrosine (1:200), and VMAT2 (1:200) were respectively applied and allowed to incubate overnight at 4°C, followed by reaction with donkey anti-rabbit IgG-FITC (1:200, excitation at 488 nm and emission at 520 nm) or goat anti-mouse IgG-TRITC (1:200, excitation at 544 nm and emission at 572 nm) at room temperature for 2 h. The nuclei were stained with Hoechst 33342 (excitation at 340 nm and emission at 510 nm). The images were acquired by microscopy and photographed.

2.11. Animals and surgery All the experimental procedures involving animals were conducted in accordance with institutional animal care guidelines of Nantong University, China, and approved ethically by Jiangsu administration committee of experimental animals, China. Adult male Sprague-Dawley (SD) rats (250~300 g) were obtained from the Experimental Animal Center of Nantong University (Nantong, China). The animals were anesthetized by injection of complex narcotics (10mg/kg xylazine, 95 mg/kg ketamine, 0.7 mg/kg acepromazine),  

8

 

and then placed on a stereotactic frame (Stoelting, IL) to undergo surgery. Briefly, the left skull was revealed and a burr hole was drilled to expose the dura. The rats were implanted with a stainless steel microsyringe in the following region relative to bregma: cortex-anteroposterior (AP) -2.8 mm; mediolateral (ML) -2.0 mm, dorsoventral (DV) -8.2 mm. All animals were divided into 4 groups (n=12 each) to be injected into the left medial forebrain bundle (MFB) of the brain with 1 μl of 12 μg/μL rotenone resolved in 4 μl of vehicle (Rot group), 1 μl of 12 μg/μL rotenone plus 1 μl of 2 mM (low dose) PQQ resolved in 4 μl of vehicle (Rot+PQQ-L group), 1 μl of 12 μg/μL rotenone plus 3 μl of 2 mM (high dose) PQQ (Rot+PQQ-H group), or 4 μl of vehicle (vehicle group, control), respectively. The vehicle was 5% dimethyl sulfoxide-containing saline. All unilateral injections were maintained for a period of 10 min.

2.12. Apomorphine (APO)-induced rotation test APO-induced rotation was measured 4 weeks post surgery. Following subcutaneous injection of 0.05 mg/kg APO, the number and direction of rotations were recorded for 30 min. The data, used for subsequent analyses, are equal to the net full-body (360° rotation) contralateral turns minus the total ipsilateral turns (Borlongan and Sanberg, 1995).

2.13. Quantitative real time RT-PCR (qRT-PCR) After APO-induced rotation tests, total RNA was extracted from the procured midbrain sample of rats with a Trizol reagent, and 100 ng RNA was reverse transcribed into cDNA with an Omniscript RT kit according to manufacturer’s instructions. For mRNA detection, the reaction mixture consisted of 10 μL 2×Fast EvaGreen Master Mix, 2 μL ROX, 0.25 μM each primer (as listed in Table 1) and 1 μL cDNA. The PCR amplifications were performed on the 7300 Real-time PCR system (Applied Biosystems, Foster City, CA). The relative mRNA expression level was calculated using the comparative 2-ΔΔCt method, and normalized by that of β-actin.

2.14. Nissl staining and TH fluorescent staining After APO-induced rotation tests, animals were sacrificed by transcardial perfusion sequentially with saline and 4% paraformaldehyde in 0.1 M PBS, and the midbrain tissues were dissected out both sides ipsilateral and contralateral to the injection site. The fixed brain  

9

 

specimens were washed in water, dehydrated in a graded ethanol series, cleared in xylene, embedded in paraffin, and cut into 5 μm-thick sections. Nissl staining and TH immunostaining (1:200) were applied to the sections before photographs were taken with a microscope.

2.15. Measurement of GSH, SOD and MDA The protein was extracted from the midbrain tissues ipsilateral and contralateral to the injection site respectively, and quantified by BCA method. The protein was subjected to the measurement of GSH, SOD and MDA respectively as previously described (Zhang et al., 2011).

2.16. Western blot analysis The SH-SY5Y cells or midbrain tissue samples were collected and homogenized in a lysis buffer consisting of 62.5 mM Tris, pH 6.8, 10 mM dithiothreitol (DTT), 2% sodium dodecyl sulfate (SDS), 10% glycerol, and a diluted protease inhibitor cocktail (100 mM phenylmethanesulfonyl fluoride, 15 μM aprotinin, 100 μM leupeptin, 100 μM bestatin, 100 μM pepstatin and 80 μM E-64 diluted in dimethyl sulfoxide). Total protein was quantified by BCA analysis, and then subjected to electrophoresis separation on SDS-PAGE. After transferred to a PVDF membrane (Millipore, Bedford, MA), the membrane was blocked with 5% non-fat dry milk in Tris-buffered saline (TBS, pH 7.4) and incubated with anti-Bcl-2 (1: 1000), anti-Bax (1: 200), anti-Smac (1: 500), anti-TH (1: 1000), anti-VMAT-2 (1: 500) and β-actin (1: 4000), respectively, at 4°C overnight. After wash with TBS/T (TBS with 0.1% Tween 20), IRDye 800-conjugated affinity purified goat anti-mouse IgG (1: 5000) or donkey anti-rabbit IgG (1: 5000) was applied at room temperature for 30 min. The images were scanned with Odyssey infrared imaging system (LI-COR, Lincoln, NE), and the data were analyzed with PDQuest 7.2.0 software (Bio-Rad, Hercules, CA). The β-actin was used as an internal control protein for normalizing protein loading.

2.17. Statistical analysis Data are presented as means ± SD. Comparisons were analyzed by one-way analysis of variance (ANOVA) and subsequent Bartlett's test. Differences were considered statistically significant at P<0.05.  

10

 

3. Results 3.1. PQQ protected SH-SY5Y dopaminergic cell line against rotenone injury

CCK-8 assay showed that there were no significant changes in cell viability of SH-SY5Y cells after treatment with different concentrations of PQQ (0.1-100 μM) compared to control (Fig. 1A), indicating that PQQ itself exerted no toxicity on cultured SH-SY5Y cells. CCK-8 assay also showed that exposure to 100 μM rotenone for 24 h caused about 40% reduction in cell viability of SH-SY5Y cells and C6 cells, but pretreatment with PQQ reversed rotenone-induced decrease in cell viability in a concentration dependent manner, and PQQ at 10 and 100 μM significantly reduced the cell viability loss, which was induced by exposure to rotenone (Fig. 1B and 1G). Additionally, cell viability decrease induced by long-term exposure to 10 μM rotenone for 72 h could also be rescued by 10 and 100 μM PQQ pretreatment (Fig. 1H). Morphological observation provided visible evidence for the neuroprotective action of PQQ. Under phase contrast microscopy, SH-SY5Y cells cultured in plain medium (without any treatment) exhibited a normal cell shape with a round cell body, intact cell membrane, and neurite-like processes (Fig. 1C); treatment with PQQ alone did not change the normal morphology of cells (Fig. 1D); rotenone-injured cells showed an early apoptotic cell death morphology, such as vacuolus emergence, cell shrinkage, and disappearance of processes (Fig. 1E); the cells, which were pretreated with 100 μM PQQ and then exposed to rotenone, demonstrated near-normal cell morphology or mild apoptotic changes (Fig. 1F).

3.2. PQQ rescued SH-SY5Y cells from rotenone-induced apoptosis

Hoechst 33342 staining and Annexin V/PI double staining were performed to determine the type of rotenone-induced cell damage in SH-SY5Y cells: apoptosis versus necrosis. In control cells, the blue fluorescence of Hoechst 33342 was evenly distributed throughout the cell nuclei (Fig. 2A). Rotenone injury caused about 38% of a cell population to display apoptotic morphology, including chromatin condensation, nuclear shrinkage, and apoptotic body formation (Fig. 2B and D). However, pretreatment with 100 μM PQQ protected about 30% of a cell population from apoptotic damage (Fig. 2C and D). FCM analysis also showed that rotenone- induced cell death in  

11

 

SH-SY5Y cells were reversed by PQQ pretreatment (Fig. 2E). Then, we detected the levels of Bcl-2 (anti-apoptotic), Bax (pro-apoptotic), and Smac (pro-apoptotic) to examine the effects of PQQ on the expression of apoptosis-related proteins in rotenone-injured SH-SY5Y cells. Western blot analysis showed that 100 μM rotenone led to a decrease in Bcl-2/Bax ratio, while pretreatment with PQQ (50 or 100 μM) significantly reversed rotenone-induced decrease in Bcl-2/Bax ratio, showing a concentration dependent pattern (Fig. 2F and G). Additionally, an increased expression of Smac in rotenone-injured SH-SY5Y cells was inhibited by PQQ (100 μM) pretreatment (Fig. 2H and 2I). The above results indicated that the regulation of apoptosis-related proteins might be involved in neuroprotection by PQQ.

3.3. PQQ inhibited ROS generation and improved mitochondrial function in rotenone-injured SH-SY5Y cells

ROS was detected by DCFH-DA-based FCM. Exposure of SH-SY5Y cells to 100 μM rotenone for 24 h caused the generation of an excessive amount (about 220%) of ROS compared to no exposure, whereas pretreatment with 100 μM PQQ significantly attenuated the excess production of ROS (Fig. 3A and 3B). The decrease in MMP is one of the earliest events in cell apoptosis, leading to a release of apoptosis-inducing factors. Therefore, we examined the effect of PQQ on MMP by using TMRM staining. According to TMRM fluorescence staining (Fig. 3C-H) and the corresponding quantitative comparisons for MMP (expressed as relative fluorescence intensity) (Fig. 3I), exposure to rotenone for 24 h induced a decline of MMP to about 54% of control level, but pretreatment with 0.1-100 μM of PQQ alleviated rotenone-induced decrease in TMRM fluorescence intensity in a concentration dependent manner, and the MMP levels recovered to 72-87% of control level by different concentrations of PQQ. MitoTracker Green was used to measure the mitochondrial mass in SH-SY5Y cells. Exposure to rotenone resulted in about 36% decrease in the mitochondrial mass, while pretreatment with 100 μM PQQ maintained the mitochondrial mass almost at the control level (Fig. 3J). Given the influence of PQQ on both the MMP and mitochondrial mass, we concluded that PQQ improved the mitochondrial function in rotenone injured SH-SY5Y cells.  

12

 

3.4. PQQ affected rotenone-induced Ca2+ influx in SH-SY5Y cells Ca2+ signaling is essential for rotenone-induced apoptosis in SH-SY5Y cells (Wang and Xu, 2005). By Fluo-3/AM staining, we found that exposure of SH-SY5Y cells to 100 μM rotenone for 24 h resulted in about three fold elevation of Ca2+ influx, and the increase was prevented by pretreatment with different concentrations of PQQ ( . 3K).

3.5. PQQ affected dopamine redistribution in rotenone injured SH-SY5Y cells

When SH-SY5Y cells were cultured in plain medium, the intracellular distribution of dopamine was the same as that of VMAT2, and both of them were localized in vesicles. After exposure to 100 μM rotenone for 24 h, cell nuclei became condensed and dopamine diffused throughout the cells in contrast to the distribution of VMAT2. PQQ pretreatment inhibited the rotenone-induced dopamine redistribution from vesicles to the cytosol, as evidenced by the same localization of dopamine and VMAT2 (Fig. 4A). Neuronal VMAT2 is essential to the redistribution of intracellular dopamine from the cytosol to vesicles. It has been reported that rotenone may directly affect VMAT2 via nitration of the tyrosine residues of VMAT2, thus inducing dopamine redistribution from vesicles to the cytosol (Watabe and Nakaki, 2008). Immunostaining showed that nitration of tyrosine residues of VMAT2 in rotenone-injured SH-SY5Y cells could be inhibited by PQQ pretreatment (Fig. 4B).

3.6. PQQ attenuated APO-evoked rotational behavior and reduced the neuronal loss in PD model rats

At 4 weeks after surgery, rats receiving rotenone injection exhibited typical PD features, including bradykinesia, postural instability, and rigidity. In these animals APO evoked the rotational behavior contralateral to the injection site (241.00±15.94/30 min), but co-injection with high dose of PQQ significantly reduced the rotenone-induced increase in APO-evoked rotation to 219.00±8.00/30 min (Fig. 5A). Nissl staining indicated that rotenone injection significantly decreased cell density in the SNc (Fig. 5B and 5C). The data are presented as % of ipsilateral to contralateral side (%I/C, hereinafter

 

13

 

the same). In rats receiving vehicle injection, the number of Nissl body in SNc at the ipsilateral side was almost the same as that at contralateral side. Co-injection with rotenone and high dose of PQQ could significantly reversed rotenone-induced decrease in %I/C of Nissl body in SNc. TH immunostaining also showed that in rats receiving rotenone injection TH-positive cells in the SNc ipsilateral to the injection site decreased compared to that in the SNc contralateral to the injection site, while PQQ prevented neuronal loss in SNc (Fig. 5D).

3.7. PQQ increased the antioxidant ability of PD model rats

GSH, SOD, and MDA are known as oxidative stress markers. To investigate the effects of PQQ injection on the antioxidative ability of PD model rats, GSH concentration, SOD activity, and MDA level in the midbrain tissues ipsilateral and contralateral to the injection site were measured at 4 weeks post-surgery respectively. In rats receiving vehicle injection, the level of GSH, SOD, or MDA at the ipsilateral side was almost the same as that at the contralateral side respectively. In rats receiving rotenone injection, GSH concentration and SOD activity at the ipsilateral side were decreased to about 70% of those at the contralateral side respectively, namely %I/C of GSH or SOD was significantly lower in rats receiving rotenone injection than in rats receiving vehicle injection. Co-injection with rotenone and high dose of PQQ could significantly reversed rotenone-induced decrease in %I/C of GSH or SOD, namely in this case GSH concentration and SOD activity at the ipsilateral side were increased to about 130 and 110% of those at the contralateral side respectively (Fig. 6A and 6B). Reversely, rotenone-induced increase in %I/C of MDA was significantly inhibited by co-injection of either low or high dose of PQQ (Fig. 6C). To further examine the antioxidant ability of PQQ, the mRNA levels of HO-1 and GCLC, two phase II detoxifying enzymes, were measured by qRT-PCR at 4 weeks post-surgery. In rats receiving rotenone injection, the mRNA levels of HO-1 and GCLC at the ipsilateral side were both decreased to about 60% of those at the contralateral side respectively, namely %I/C of HO-1 or GCLC was significantly lower in rats receiving rotenone injection than in rats receiving vehicle injection. Co-injection with rotenone and low or high dose of PQQ inhibited rotenone-induced decrease in %I/C of HO-1 or GCLC, and the significant inhibition was noted at low and high dose

 

14

 

of PQQ for HO-1 or only at high dose of PQQ for GCLC, which made the mRNA level of HO-1 or GCLC at the ipsilateral side the same as that at the contralateral side (Fig. 6D and 6E).

3.8. PQQ protected mitochondrial function in PD model rats

Mitochondrial functions are crucial for cell survival. Ndufs1, 2, 3, and 4, as the subunits of ECT complex I, play important roles in maintaining mitochondrial functions. qRT-PCR data showed that the mRNA levels of Ndufs1, Ndufs2, Ndufs3 and Ndufs4 at the ipsilateral side were decreased by rotenone injection compared to those at the contralateral side respectively, namely %I/C of Ndufs1, Ndufs2, Ndufs3 or Ndufs4 was significantly lower in rats receiving rotenone injection than in rats receiving vehicle injection. High dose of PQQ significantly reversed the rotenone-induced decreases in %I/C of Ndufs1, Ndufs2, Ndufs3 or Ndufs4, and even low dose of PQQ also significantly reversed rotenone-induced decrease in %I/C of Ndufs1 (Fig. 7A-D).

3.9. PQQ antagonized the decrease of TH and VMAT2 induced by rotenone

TH is the rate-limiting enzyme in dopamine synthesis. In rats receiving rotenone injection, the protein levels of TH and VMAT2 at the ipsilateral side was decreased to about 45 and 40 % of those at the contralateral side respectively, and thus %I/C of TH or VMAT2 was significantly lower in rats receiving rotenone injection than in rats receiving vehicle injection. High dose of PQQ significantly antagonized the rotenone-induced decrease in %I/C of TH or VMAT2 (Fig. 8A and 8B).

4. Discussion In this study, rotenone models of PD were used to obtain multiple lines of evidence for neuroprotective effects of PQQ both in vitro and in vivo. The evidence we obtained can be delineated as follows: (1) PQQ enhanced cell survival and inhibited cell apoptosis in cultured SH-SY5Y cells against rotenone toxicity, accompanied by the regulation of apoptosis-related proteins. (2) PQQ reduced rotenone-induced ROS generation and Ca2+ influx, ameliorated rotenone-induced decrease in the MMP and mitochondrial mass, thus maintaining mitochondrial functions in cultured SH-SY5Y cells. (3) PQQ inhibited rotenone-induced tyrosine residues  

15

 

nitration of VMAT2 and redistribution of intracellular dopamine in cultured SH-SY5Y cells. (4) PQQ attenuated rotenone-induced changes in APO-evoked rotation and rotenone-induced neuronal loss in PD model rats. (5) PQQ inhibited rotenone-induced decrease in GSH and SOD, rotenone-induced increase in MDA, and rotenone-induced down-regulations of HO-1 and GCLC in the unilaterally lesioned midbrain of PD model rats. (6) PQQ reversed rotenone-induced decrease in the mRNA expressions of Ndufs1-Ndufs4 and rotenone-induced decrease in the protein expressions of TH and VMAT2 in the unilaterally lesioned midbrain of PD model rats. PQQ, as a redox cofactor, is able to scavenge ROS and attenuate oxidative stress in mitochondria for protection against oxidative stress-induced cell damage (Hobara et al., 1988; Ohwada et al., 2008; Tao et al., 2007; Zhu et al., 2004). Our previous studies indicate that PQQ could antagonize glutamate-induced neuronal injury both in vitro and in vivo by scavenging ROS, activating phosphatidylinositol-3-kinase (PI3K)/Akt/glycogen synthase kinase 3β (GSK3β) signaling, and regulating nuclear factor erythroid 2-related factor 2 (Nrf2) activity (Zhang et al., 2013; 2012; 2011). PQQ is also shown to protect cultured SH-SY5Y cells against 6-hydroxydopamine-induced neurotoxicity, suggesting its therapeutic benefit in the treatment of PD due to the pathogenic link between 6- hydroxydopamine and PD (Hara et al., 2007). Rotenone is the principal toxic constituent of derris root and widely used as an insecticide and pesticide. Importantly, rotenone can cross cell membranes and penetrate the blood brain barrier to act as a high-affinity inhibitor of complex I of the mitochondrial ETC. Exposure of cells or animals to rotenone triggers a range of responses, including dopaminergic cell death and ROS production, which recapitulate the clinical features of PD (Cannon and Greenamyre, 2013; Chung et al., 2013; Giasson and Lee, 2000; Giordano et al., 2012). Accordingly, a rotenone model of PD may have some advantages over several other PD models (Cannon et al., 2009). Since dopaminergic neurons are particularly susceptible to rotenone toxicity, dopaminergic human neuroblastoma SH-SY5Y cells were exposed to rotenone to serve as the in vitro PD model in this study, while the in vivo PD model was established by unilateral injection with rotenone to the MFB of rats. Recently, we observed that ROS produced by the complex I inhibitor (rotenone) and the complex III inhibitor (antimycin A) could be attenuated by PQQ (Zhang et al., 2014). In that study, we were mainly concerned with the involvement of ERK1/2 pathway in neuroprotection of  

16

 

retonone-injured SH-SY5Y cells by PQQ. To expand the paradigm of PQQ research, in this study, we wanted to provide comprehensive insights into the in vitro and in vivo neuroprotective effects of PQQ by using both cell and animal models of PD. For the in vitro study, at first we confirmed that PQQ pretreatment prevented cultured SH-SY5Y cells from rotenone-induced cell viability loss and cell apoptosis, accompanied by modulation of apoptosis-related proteins (Bcl-2, Bax, and Smac). Subsequently, in addition to assessing the effects of PQQ on mitochondrial function, inhibition of intracellular ROS production and Ca2+ influx in rotenone-injured SH-SY5Y cells, we also evaluated the role of PQQ in suppression of rotenone-induced tyrosine residues nitration and dopamine redistribution. These new results undoubtedly enrich our understanding of PQQ-conferred neuroprotection in cell models of PD. For the in vivo study, at first we observed that PQQ injection significantly antagonized the increase in APO-evoked rotation and the loss of midbrain neurons in rotenone-lesioned animals. Afterwards, we continued to investigate how PQQ treatment responded to oxidative stress and mitochondrial dysfunction in rotenone-induced animal models of PD in an attempt to understand the molecular aspects involved in the in vivo neuroprotective effects of PQQ. Now we would like to discuss PQQ-conferred neuroprotection for cell and animal models of PD in terms of PQQ modulation of ROS production, mitochondrial function, and dopamine synthesis. It was assumed that the modulation of ROS production might play an important role in PQQ-conferred neuroprotection. Consistent with this speculation, rotenone-evoked ROS generation in SH-SY5Y cells was inhibited by PQQ pretreatment. It has been reported that Ca2+ could stimulate mitochondrial ROS release in the presence of rotenone, which may be an important factor in neuronal cell death in PD (Sousa et al., 2003). Here, we also found that Ca2+ influx induced by rotenone was inhibited by PQQ, indicating that the inhibition of Ca2+ influx might be involved in the decrease of ROS production. Meanwhile, the levels of SOD and GSH (two antioxidants) were increased and the level of MDA (a product of lipid peroxidation) was decreased in the rotenone-lesioned midbrain of rats. These in vitro and in vivo observations suggested that the antioxidative property of PQQ might be at least partly responsible for its neuroprotective effects. PQQ can stimulate mitochondrial biogenesis in mouse hepatocytes and is beneficial in  

17

 

diseases associated with mitochondrial dysfunction (Chowanadisai et al., 2009). Mitochondrial dysfunction is involved in induction of apoptosis and signal pathways relevant to apoptosis (Ly et al., 2003). The ratio of anti-apoptotic members (such as Bcl-2 and Bcl-XL) to pro-apoptotic members (such as Bax and Smac) is regarded as an important factor to govern cell survival or death by modulating mitochondrial function (Cheng et al., 2001; Gross et al., 1998; Jurgensmeier et al., 1998; Xu et al., 2008a; Xu et al., 2008b). In this study, PQQ regulated the rotenone-altered expressions of Bcl-2, Bax and Smac, and inhibited rotenone-induced decrease of MMP and mitochondrial mass in cultured SH-SY5Y cells. On the other hand, PQQ injection impeded the down-regulated mRNA expressions of Ndufs1–Ndufs4 in rotenone-lesioned midbrain of rats, whereas Ndufs1–Ndufs4 are mitochondrial complex I subunits required for complete assembly and function of the complex I (Alvarez-Fischer et al., 2011; Choi et al., 2008; Choi et al., 2011; Parsons et al., 2011; Scacco et al., 2003). These in vitro and in vivo observations suggested that PQQ modulation of mitochondrial functions might contribute to its neuroprotective effects. Dopamine is an important neurotransmitter, and dysfunction of the dopamine system is associated with neurological disorders, including PD. The mechanism of dopamine neurotoxicity is strongly linked to oxidative metabolism (Watabe and Nakaki, 2008). It has been reported that rotenone triggers dopamine redistribution from vesicles to the cytosol (Watabe and Nakaki, 2007). Dopamine can be transported from the cytoplasm into synaptic vesicles by mediation of VMATs. In mammals, VMAT1 and VMAT2 are two subtypes, and VMAT2 is mainly expressed in neural cells. Previous studies have shown a decreased expression of VMAT2 in nigral neurons of patients with PD (Harrington et al., 1996; Miller et al., 1999), suggesting that a reduction in the neuroprotective effect provided by VMAT2 is related to the progression of neurodegeneration. Rotenone inhibits VMAT2 activity by nitration of the tyrosine residues of VMAT2, leading to VMAT2 accumulation in an aggregate-like form in dopaminergic cells and dopamine redistribution to the cytosol and cell apoptosis (Watabe and Nakaki, 2008). On the contrary, an increased expression of VMAT2 protects dopaminergic cells against neurotoxicity (Chen et al., 2005). In this study, PQQ inhibited rotenone-induced dopamine redistribution by affecting nitration of VMAT2 in cultured SH-SY5Y cells, and PQQ antagonized rotenone-induced decrease of VMAT2 and TH levels in the rotenone-lesioned midbrain of rats. These in vitro and in vivo observations suggested that PQQ regulation of dopamine functions might be involved in its  

18

 

neuroprotective effects. In summary, PQQ significantly ameliorated the damage induced by rotenone in PD models both in vitro and in vivo. The protective effects appeared to be achieved by reducing the oxidative stress, improving mitochondrial functions, and regulating dopamine redistribution. Our findings suggested that PQQ might act as a promising neuroprotective agent for treating PD patients.

 

19

 

Acknowledgments This study was supported by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), National Natural Science Foundation of China (Grant No. 81171180 and 81201017), Natural Science Funding from the Education Department of Jiangsu Province, China (Grant No. 12KJB310011), The practice innovation training program projects for the Jiangsu College students (Grant No. 201410304065Y) and Qinglan Project. We thank Professor Jie Liu for assistance in manuscript preparation.

Conflict of interest statement The authors declare that there is no conflict of interest.

 

20

 

References Abou-Sleiman, P.M., Muqit, M.M., Wood, N.W., 2006. Expanding insights of mitochondrial dysfunction in Parkinson's disease. Nat Rev Neurosci 7, 207-219. Alvarez-Fischer, D., Fuchs, J., Castagner, F., Stettler, O., Massiani-Beaudoin, O., Moya, K.L., Bouillot, C., Oertel, W.H., Lombes, A., Faigle, W., Joshi, R.L., Hartmann, A., Prochiantz, A., 2011. Engrailed protects mouse midbrain dopaminergic neurons against mitochondrial complex I insults. Nat Neurosci 14, 1260-1266. Borlongan, C.V., Sanberg, P.R., 1995. Elevated body swing test: a new behavioral parameter for rats with 6-hydroxydopamine-induced hemiparkinsonism. J Neurosci 15, 5372-5378. Cannon, J.R., Greenamyre, J.T., 2013. Gene-environment interactions in Parkinson's disease: specific evidence in humans and mammalian models. Neurobiol Dis 57, 38-46. Cannon, J.R., Tapias, V., Na, H.M., Honick, A.S., Drolet, R.E., Greenamyre, J.T., 2009. A highly reproducible rotenone model of Parkinson's disease. Neurobiol Dis 34, 279-290. Chen, C.X., Huang, S.Y., Zhang, L., Liu, Y.J., 2005. Synaptophysin enhances the neuroprotection of VMAT2 in MPP+-induced toxicity in MN9D cells. Neurobiol Dis 19, 419-426. Cheng, E., Wei, M., Weiler, S., Flavell, R., Mak, T., Lindsten, T., Korsmeyer, S., 2001. BCL-2, BCL-XL sequester BH3 domain-only molecules preventing BAX-and BAK-mediated mitochondrial apoptosis. Mol Cell 8, 705-711. Choi, W.S., Kruse, S.E., Palmiter, R.D., Xia, Z., 2008. Mitochondrial complex I inhibition is not required for dopaminergic neuron death induced by rotenone, MPP+, or paraquat. Proc Natl Acad Sci U S A 105, 15136-15141. Choi, W.S., Palmiter, R.D., Xia, Z., 2011. Loss of mitochondrial complex I activity potentiates dopamine neuron death induced by microtubule dysfunction in a Parkinson's disease model. J Cell Biol 192, 873-882. Chowanadisai, W., Bauerly, K.A., Tchaparian, E., Wong, A., Cortopassi, G.A., Rucker, R.B., 2009. Pyrroloquinoline

quinone

stimulates

mitochondrial

biogenesis

through

cAMP

response

element-binding protein phosphorylation and increased PGC-1alpha expression. J Biol Chem 285, 142-152. Chung, S.J., Armasu, S.M., Anderson, K.J., Biernacka, J.M., Lesnick, T.G., Rider, D.N., Cunningham, J.M., Ahlskog, J.E., Frigerio, R., Maraganore, D.M., 2013. Genetic susceptibility loci, environmental exposures, and Parkinson's disease: a case-control study of gene-environment interactions. Parkinsonism Relat Disord 19, 595-599. Cline, H.T., Tsien, R.W., 1991. Glutamate-induced increases in intracellular Ca2+ in cultured frog tectal cells mediated by direct activation of NMDA receptor channels. Neuron 6, 259-267. Felton, L.M., Anthony, C., 2005. Biochemistry: role of PQQ as a mammalian enzyme cofactor? Nature 433, E10; discussion E11-12. Giasson, B.I., Lee, V.M.Y., 2000. A new link between pesticides and Parkinson's. Nat Neurosci 3, 1227. Giordano, S., Lee, J., Darley-Usmar, V.M., Zhang, J., 2012. Distinct effects of rotenone, 1-methyl-4-phenylpyridinium and 6-hydroxydopamine on cellular bioenergetics and cell death. PLoS One 7, e44610. Gross, A., Jockel, J., Wei, M., Korsmeyer, S., 1998. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. The EMBO journal 17, 3878-3885.  

21

 

Hara, H., Hiramatsu, H., Adachi, T., 2007. Pyrroloquinoline quinone is a potent neuroprotective nutrient against 6-hydroxydopamine-induced neurotoxicity. Neurochem Res 32, 489-495. Harrington, K.A., Augood, S.J., Kingsbury, A.E., Foster, O.J., Emson, P.C., 1996. Dopamine transporter (Dat) and synaptic vesicle amine transporter (VMAT2) gene expression in the substantia nigra of control and Parkinson's disease. Brain Research Molecular Brain Research 36, 157-162. Hauge, J.G., 1964. Glucose Dehydrogenase of Bacterium Anitratum: An Enzyme with a Novel Prosthetic Group. J Biol Chem 239, 3630-3639. Hobara, N., Watanabe, A., Kobayashi, M., Tsuji, T., Gomita, Y., Araki, Y., 1988. Quinone derivatives lower blood and liver acetaldehyde but not ethanol concentrations following ethanol loading to rats. Pharmacology 37, 264-267. Jankovic, J., Poewe, W., 2012. Therapies in Parkinson's disease. Curr Opin Neurobiol 25, 433-447. Jurgensmeier, J.M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D., Reed, J.C., 1998. Bax directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci U S A 95, 4997-5002. Kasahara, T., Kato, T., 2003. Nutritional biochemistry: A new redox-cofactor vitamin for mammals. Nature 422, 832. Liu, Y., Schubert, D.R., 2009. The specificity of neuroprotection by antioxidants. J Biomed Sci 16, 98. Ly, J.D., Grubb, D.R., Lawen, A., 2003. The mitochondrial membrane potential (deltapsi(m)) in apoptosis; an update. Apoptosis 8, 115-128. Mariani, E., Polidori, M.C., Cherubini, A., Mecocci, P., 2005. Oxidative stress in brain aging, neurodegenerative and vascular diseases: an overview. J Chromatogr B Analyt Technol Biomed Life Sci 827, 65-75. Miller, G.W., Erickson, J.D., Perez, J.T., Penland, S.N., Mash, D.C., Rye, D.B., Levey, A.I., 1999. Immunochemical analysis of vesicular monoamine transporter (VMAT2) protein in Parkinson's disease. Exp Neurol 156, 138-148. Misra, H.S., Khairnar, N.P., Barik, A., Indira Priyadarsini, K., Mohan, H., Apte, S.K., 2004. Pyrroloquinoline-quinone: a reactive oxygen species scavenger in bacteria. Febs Lett 578, 26-30. Misra, H.S., Rajpurohit, Y.S., Khairnar, N.P., 2012. Pyrroloquinoline-quinone and its versatile roles in biological processes. J Biosci 37, 313-325. Ohwada, K., Takeda, H., Yamazaki, M., Isogai, H., Nakano, M., Shimomura, M., Fukui, K., Urano, S., 2008. Pyrroloquinoline Quinone (PQQ) Prevents Cognitive Deficit Caused by Oxidative Stress in Rats. J Clin Biochem Nutr 42, 29-34. Panov, A., Dikalov, S., Shalbuyeva, N., Taylor, G., Sherer, T., Greenamyre, J.T., 2005. Rotenone model of Parkinson disease: multiple brain mitochondria dysfunctions after short term systemic rotenone intoxication. J Biol Chem 280, 42026-42035. Park, S.E., Sapkota, K., Choi, J.H., Kim, M.K., Kim, Y.H., Kim, K.M., Kim, K.J., Oh, H.N., Kim, S.J., Kim, S., 2014. Rutin from Dendropanax morbifera Leveille protects human dopaminergic cells against rotenone induced cell injury through inhibiting JNK and p38 MAPK signaling. Neurochemical research 39, 707-718. Parsons, R.B., Aravindan, S., Kadampeswaran, A., Evans, E.A., Sandhu, K.K., Levy, E.R., Thomas, M.G., Austen, B.M., Ramsden, D.B., 2011. The expression of nicotinamide N-methyltransferase increases ATP synthesis and protects SH-SY5Y neuroblastoma cells against the toxicity of Complex I inhibitors. Biochem J 436, 145-155. Rucker, R., Chowanadisai, W., Nakano, M., 2009. Potential physiological importance of pyrroloquinoline quinone. Altern Med Rev 14, 268-277.  

22

 

Rucker, R., Storms, D., Sheets, A., Tchaparian, E., Fascetti, A., 2005. Biochemistry: is pyrroloquinoline quinone a vitamin? Nature 433, E10-11; discussion E11-12. Salisbury, S.A., Forrest, H.S., Cruse, W.B., Kennard, O., 1979. A novel coenzyme from bacterial primary alcohol dehydrogenases. Nature 280, 843-844. Sanders, L.H., Timothy Greenamyre, J., 2013. Oxidative damage to macromolecules in human Parkinson disease and the rotenone model. Free Radic Biol Med 62, 111-120. Scacco, S., Petruzzella, V., Budde, S., Vergari, R., Tamborra, R., Panelli, D., van den Heuvel, L.P., Smeitink, J.A., Papa, S., 2003. Pathological mutations of the human NDUFS4 gene of the 18-kDa (AQDQ) subunit of complex I affect the expression of the protein and the assembly and function of the complex. J Biol Chem 278, 44161-44167. Sherer, T.B., Betarbet, R., Testa, C.M., Seo, B.B., Richardson, J.R., Kim, J.H., Miller, G.W., Yagi, T., Matsuno-Yagi, A., Greenamyre, J.T., 2003. Mechanism of toxicity in rotenone models of Parkinson's disease. J Neurosci 23, 10756-10764. Sousa, S.C., Maciel, E.N., Vercesi, A.E., Castilho, R.F., 2003. Ca2+-induced oxidative stress in brain mitochondria treated with the respiratory chain inhibitor rotenone. Febs Lett 543, 179-183. Stites, T.E., Mitchell, A.E., Rucker, R.B., 2000. Physiological importance of quinoenzymes and the O-quinone family of cofactors. J Nutr 130, 719-727. Tao, R., Karliner, J.S., Simonis, U., Zheng, J., Zhang, J., Honbo, N., Alano, C.C., 2007. Pyrroloquinoline quinone preserves mitochondrial function and prevents oxidative injury in adult rat cardiac myocytes. Biochem Biophys Res Commun 363, 257-262. Wang, X.J., Xu, J.X., 2005. Possible involvement of Ca2+ signaling in rotenone-induced apoptosis in human neuroblastoma SH-SY5Y cells. Neurosci Lett 376, 127-132. Watabe, M., Nakaki, T., 2007. Mitochondrial complex I inhibitor rotenone-elicited dopamine redistribution from vesicles to cytosol in human dopaminergic SH-SY5Y cells. J Pharmacol Exp Ther 323, 499-507. Watabe, M., Nakaki, T., 2008. Mitochondrial complex I inhibitor rotenone inhibits and redistributes vesicular monoamine transporter 2 via nitration in human dopaminergic SH-SY5Y cells. Mol Pharmacol 74, 933-940. Xu, Q., Dou, J., Wei, P., Tan, C., Yun, X., Wu, Y., Bai, X., Ma, X., Du, Y., 2008a. Chitooligosaccharides induce apoptosis of human hepatocellular carcinoma cells via up-regulation of Bax. Carbohyd Polym 71, 509-514. Xu, S., Zhong, W., Watson, N., Dickerson, E., Wake, J., Lindow, S., Newton, C., Atkin, S., 2008b. Fluvastatin reduces oxidative damage in human vascular endothelial cells by upregulating Bcl-2. Journal of Thrombosis and Haemostasis 6, 692-700. Zhang, Q., Ding, M., Cao, Z., Zhang, J., Ding, F., Ke, K., 2013. Pyrroloquinoline quinine protects rat brain cortex against acute glutamate-induced neurotoxicity. Neurochem Res 38, 1661-1671. Zhang, Q., Ding, M., Gao, X.R., Ding, F., 2012. Pyrroloquinoline quinone rescues hippocampal neurons from glutamate-induced cell death through activation of Nrf2 and up-regulation of antioxidant genes. Genet Mol Res 11, 2652-2664. Zhang, Q., Shen, M., Ding, M., Shen, D., Ding, F., 2011. The neuroprotective action of pyrroloquinoline quinone against glutamate-induced apoptosis in hippocampal neurons is mediated through the activation of PI3K/Akt pathway. Toxicol Appl Pharmacol 252, 62-72. Zhang, Q., Zhang, J., Jiang, C., Qin, J., Ke, K., Ding, F., 2014. Involvement Of ERK1/2 Pathway In Neuroprotective Effects Of Pyrroloquinoline Quinine Against Rotenone-Induced SH-SY5Y Cell Injury.  

23

 

Neuroscience 270, 183-191. Zhu, B.Q., Zhou, H.Z., Teerlink, J.R., Karliner, J.S., 2004. Pyrroloquinoline quinone (PQQ) decreases myocardial infarct size and improves cardiac function in rat models of ischemia and ischemia/reperfusion. Cardiovasc Drugs Ther 18, 421-431.

 

24

 

Figure captions Fig. 1 PQQ inhibited rotenone (Rot)-induced cell damage in cultured SH-SY5Y cells. (A) After SH-SY5Y cells were exposed to different concentrations of PQQ (0.1-100 μM) for 24 h, the cell viability was not significantly changed, as measured by CCK-8 assay. P>0.05 versus control (no treatment) (n=4). (B) Cultured SH-SY5Y cells were pretreated with different concentrations of PQQ (0.1–100 μM) for 24 h and then exposed to 100 μM Rot for additional 24 h. The cell viability was measured by CCK-8 assay (n=4). (C–F) Phase contrast micrograph of cultured SH-SY5Y cells non-treated (C, control), treated with 100 μM PQQ alone (D), exposed to 100 μM Rot alone (E), or pretreated with 100 μM PQQ and then exposed to 100 μM Rot (F) respectively. Bar=50 μm. (G) Cultured C6 cells were pretreated with different concentrations of PQQ (0.1–100 μM) for 24 h and then exposed to 100 μM Rot for additional 24 h. The cell viability was measured by CCK-8 assay (n=4). (H) Cultured SH-SY5Y cells were pretreated with different concentrations of PQQ (0.1–100 μM) for 24 h and then exposed to 10 μM Rot for additional 72 h. The cell viability was measured by CCK-8 assay (n=4). ##P<0.01 versus control (no treatment) and *P<0.05 versus exposure to Rot. Fig. 2 PQQ inhibited rotenone (Rot)-induced apoptosis in cultured SH-SY5Y cells. (A–C) Hoechst 33342 staining of cultured SH-SY5Y cells non-treated (A, control), exposed to 100 μM Rot alone (B) or pretreated with 100 μM PQQ and then exposed to 100 μM Rot (C) respectively. Bar=20 μm. (D) The percentage of SH-SY5Y cells with nuclear condensation in total cell population after indicated treatments, as measured by Hoechst 33342 staining (n=3). (E) The percentage of viable cells with early apoptosis and necrosis in total cell population after indicated treatments, as detected by FCM (n=3). Representative Western blot images of the protein expressions of Bcl-2, Bax and Smac in SH-SY5Y cells after indicated treatments (F and H), where β-actin served as an internal control. The Bcl-2/Bax expression ratio and Smac expression in SH-SY5Y cells were changed by different cell treatments (G and I) (n=3). #P<0.05 and ##P<0.01 versus control (no treatment); *P<0.05 and **P<0.01 versus exposure to Rot.

 

25

 

Fig. 3 PQQ inhibited ROS generation and maintained mitochondrial function in rotenone (Rot)-injured SH-SY5Y cells. (A) Representative FCM profile of ROS generation in SH-SY5Y cells, which were subjected to different treatments as indicated, where the cells without DCFH-DA incubation served as negative control. (B) The changes in the fluorescent intensity of DCFH-DA were analyzed after different treatments as indicated (n=3). (C-H) Representative fluorescent micrographs of TMRM staining to measure the MMP of cultured SH-SY5Y non-treated (C, control), exposed to 100 μM Rot (D), and pretreatment with 0.1 (E), 1 (F), 10 (G) and 100 μM (H) of PQQ before exposure to 100 μM Rot, respectively. Bar = 20 μm. (I) The fluorescent intensity of TMRM staining in cultured SH-SY5Y cells after different treatments as indicated, which was used for quantitative comparison of the MPP of cells (n=3). (J) Mitochondrial mass measured by Mito Tracker Green FM staining in cultured SH-SY5Y cells after different treatments as indicated (n=3). (K) SH-SY5Y cells were preloaded with Fluo-3/AM fluorescent dye and the Ca2+ influx was measured by FACS (n=3). In histograms, #P<0.05, ##P<0.01 versus control (no treatment); *P<0.05, **P<0.01 versus exposure to Rot. Fig. 4 Effects of PQQ on redistribution of intracellular dopamine (DA) and nitration of the tyrosine residue of VMAT2 in rotenone (Rot)-injured SH-SY5Y cells. (A and B) Immunocytochemical staining showed the intracellular localizations of DA (red), VMAT2 (green), the nucleus (blue, Hoechst staining) and their merge (A) or of nitrotyrosine (red), VMAT (green), the nucleus (blue, Hoechst staining) and their merge (B) in cultured SH-SY5Y cells non-treated, exposure to 100 μM Rot, and pretreated with 100 μM PQQ before exposure to 100 μM Rot, respectively. Bar = 20 μm. Fig. 5 PQQ attenuated APO-evoked rotational behavior and reduced the neuronal loss in PD model rats. (A) PQQ inhibited APO-evoked rotational behavior in PD rats. The animals were divided into vehicle group, rotenone injury group (Rot), PQQ low-dose group (Rot + PQQ-L) and PQQ high-dose group (Rot + PQQ-H) to receive different treatments (stereotaxic injection into the left MFB), respectively. At 4 weeks after surgery, 0.05 mg/kg APO was injected subcutaneously to induce rotational behavior and the rotation was recorded for 30 min (n=12). In histogram, ##P<0.01 versus vehicle group; *P<0.05 versus Rot group. (B-C) Nissl staining of the midbrain ipsilateral and contralateral to injection site  

26

 

in rats treated with vehicle, rotenone (Rot), Rot + PQQ-L, and Rot + PQQ-H, respectively. Bar = 200 μm. The relative number of Nissl body in the SNc is expressed as % of ipsilateral to contralateral (%I/C) (n=3). ##P<0.01 versus vehicle group; *P<0.05 versus Rot group. (D)TH immunostaining of the midbrain ipsilateral and contralateral to injection site in rats treated with vehicle, rotenone (Rot), Rot + PQQ-L, and Rot + PQQ-H, respectively. Bar = 100 μm. Fig. 6 Effects of PQQ on the antioxidant ability of PD rats. At 4 weeks after surgery, GSH concentration (A), SOD activity (B), MDA level (C), HO-1 mRNA level (D) and GCLC mRNA level (E) in the midbrain ipsilateral and contralateral to injection site in rats of 4 groups were measured respectively. All data are expressed as % of ipsilateral to contralateral (%I/C) (n=3). #P<0.05, ##P<0.01 versus vehicle group; *P<0.05, **P<0.01 versus Rot group. Fig. 7 Effects of PQQ on Ndufs1-4 in the midbrain of PD rats. The mRNA expressions of Ndufs1 (A), Ndufs2 (B), Ndufs3 (C) and Ndufs4 (D) in the midbrain were measured at 4 weeks after surgery. All data are expressed as % of ipsilateral to contralateral (%I/C) (n=3). ## P<0.01 versus vehicle group; *P<0.05, **P<0.01 versus Rot group. Fig. 8 Effects of PQQ on TH and VMAT2 in the midbrain of PD rats. The protein expressions of TH (A) and VMAT2 (B) in the midbrain were detected by Western blot at 4 weeks after surgery. All data are expressed as % of ipsilateral to contralateral (%I/C) (n=3). ## P<0.01 versus vehicle group; **P<0.01 versus Rot group. Also shown are representative Western blot images and β-actin served as an internal control.

 

27

 

Fig. 1

 

28

 

Fig. 2

 

29

 

Fig. 3

 

30

 

Fig. 4

 

31

 

Fig. 5

 

32

 

Fig. 6

 

33

 

Fig. 7

 

34

 

Fig. 8

 

35

 

Table Table 1 Oligonucleotide sequences used in qRT-PCR analysis. Gene Ndufs1 Ndufs2 Ndufs3 Ndufs4 HO-1 GCLC β-actin

 

Primer sequence (5’ – 3’) Forward- catgcaaatccctcgattct Reverse- caggatattccagcccttca Forward- acctacctcttgggcttatg Reverse- tcgccagattctattgttg Forward- cttctttgctaaccaccct Reverse- cacccgcttcacttcat Forward- acacatcgacatggaagctg Reverse- gcgagcaggaacaaagattc Forward-tttcaccttcccgagcat Reverse-gcctcttctgtcaccctgt Forward-gagtagagttccgaccaat Reverse-gctcctgtgccactttca Forward- aggcccctctgaaccctaag Reverse- ccagaggcatacagggacaac

Amplicon size 139 bp 104 bp 130 bp 146 bp 111 bp 159 bp 118 bp

36